Supplementary Information
|
|
|
- Malcolm Chapman
- 5 years ago
- Views:
Transcription
1 Supplementary Information Astrocytes regulate adult hippocampal neurogenesis through ephrin-b signaling Randolph S. Ashton, Anthony Conway, Chinmay Pangarkar, Jamie Bergen, Kwang-Il Lim, Priya Shah, Mina Bissell, and David V. Schaffer Inventory of Supplementary Information Supplementary Fig. 1 related to Fig. 3 Supplementary Fig. 2 related to Fig. 2 and Fig. 4 Supplementary Fig. 3 related to Fig. 4 Supplementary Fig. 4 related to Fig. 5 Supplementary Fig. 5 related to Fig. 6 Supplementary Fig. 6 related to Fig. 7 Supplementary Fig. 7 related to Fig. 7 Supplementary Fig. 8 Supplementary Fig. 9 related to Fig. 7 Supplementary Table 1
2 a GFAP/BrdU/DAPI b Supplementary Figure 1, related to Figure 3. Quantification of hippocampal gliogenesis. Fcephrin-B2 does not affect gliogenesis in vivo. (a) In general, only a small fraction of BrdU+ cells co-labeled as astrocytes (GFAP+). (b) The percentage of non-radial GFAP+/BrdU+ astrocytes was not affected by Fc-ephrin-B2 induced signaling (n = 4 experimental replicates ± s.d.).
3 Supplementary Figure 2, related to Figure 2 and Figure 4. Ephrin-B2 expression upon astrocytic differentiation. In vitro analysis of ephrin-b2 expression in hippocampus-derived astrocytes and differentiated NSCs. (a) Using QPCR, we compared efnb2 expression levels in cultures of NSCs, differentiated NSCs, and hippocampus-derived astrocytes. Hippocampusderived astrocytes express efnb2 at levels three order-of-magnitude higher than NSCs, and it appears as though efnb2 expression increased as the fraction and maturity of astrocytes in the cell population also increased. Data is normalized to NSC efnb2 expression level (n = 3, technical replicates ± s.d.). (b) NSCs were differentiated into oligodendrocytes (MBP + ), astrocytes (GFAP + ), and immature neurons (DCX + ) and stained for expression of ephrin-b2 and EphB4. NSCs differentiated into astrocytes down-regulated EphB4 and up-regulated ephrin-b2 expression, while NSCs differentiated into neurons still expressed EphB4 on the cell soma. NSCs differentiated into oligodendrocytes did not express high levels of either ephrin-b2 or EphB4. The scale bar represents 10 µm.
4 Supplementary Figure 3, related to Figure 4. Ephrin-B2 shrna screen. Screen for effective shrna targeting efnb2. QPCR analysis of hippocampus-derived astrocytes expressing shrna sequences designed to knockdown expression of efnb2. Five shrna sequences were tested using human or mouse U6 promoters. Naïve astrocytes, NSCs, and astrocytes expressing a shrna sequence targeting LacZ mrna were used as controls, and data was normalized to efnb2 expression of non-infected astrocytes (n = 3, technical replicates ± s.d.).
5 Supplementary Figure 4, related to Figure 5. In vivo validation of astrocytic shrna expression. We hypothesized that selective expression of GFP in hippocampal neurons (see Figure 5) was due to low activity of the ubiquitin-c promoter in astrocytes, not inactivity of the U6 promoter-shrna cassette or a neuronal tropism of the lentiviral vector. (a,b) The ubiquitin-c promoter was replaced by a mouse (m) and a human (h) GFAP promoter, and as evidenced by histology, the new shrna vectors were expressed by GFAP + astrocytes proving that prior localization of GFP expression to neurons was an artifact of the ubiquitin-c promoter. Dotted line marks SGZ/Hilus boundary and dashed line marks GCL/MCL boundary. (c) QPCR analysis of shrna vector-expressing astrocytes in culture demonstrated sustained effectiveness of the efnb2 shrna #1 and #2 vectors (n = 3, technical replicates ± s.d.).
6 Supplementary Figure 5, related to Figure 6. Effect of Fc-ephrin-B2 on Nestin + (β-gal + ) NSCs in vivo. (a) In fate mapping experiments using Nestin-CreER T2 ; R26-stop fl/fl -lacz mice, the proliferative rate of recombined cells was consistent between Anti-Fc and Fc-ephrin-B2 experimental groups indicating that the increase in BrdU + cells observed in Figure 3c was not due to ephrin-b2 induced proliferation of Nestin + NSCs (n = 4 experimental replicates ± s.d.). (b) Analysis of cell phenotype amongst clonal β-gal + cell clusters at Day 5 showed a similar distribution as observed at the population level in Figure 6d-h and no significant change in levels of gliogenesis between Anti-Fc and Fc-ephrin-B2 treated groups. ** indicates P <0.05; n = 4 brains, analyzed 8 hippocampal sections per brain.
7 * Supplementary Figure 6, related to Figure 7. In vitro validation of lentiviral vectors encoding Tcf-Luc reporter (TFP), dnwnt-ires-gfp (dnwnt), and IRES-GFP (dnwnt Control) cassettes. Naïve NSCs, NSCs infected with TFP vector, and NSCs co-infected with TFP and either dnwnt or dnwnt control vectors were assayed for their ability to report β-catenin signaling, as evidenced by luciferase expression, in response to a 24-hour incubation in Wnt3a supplemented (200 ng/ml) or standard media. No Luc expression was observed in the absence of Wnt3a, and a significant decrease in Wnt3a-induced Luc reporting was observed in NSCs expressing dnwnt as compared to the dnwnt control construct, thus validating proper activity of the three constructs (n = 3 technical replicates ± s.d.). * indicates a P <0.01.
8 a b Supplementary Figure 7, related to Figure 7. Fc-ephrin-B2 induces expression of Mash1 and NeuroD1 in NSCs in vitro. Similar to experiments in Figure 1, Fc-ephrin-B2 stimulation also induced a dose-dependent increase in the expression of two proneural transcription factors, Mash1 and NeuroD1, known to play important roles in adult hippocampal neurogenesis (n = 3, technical replicates ± s.d.). * indicates P < 0.01.
9 Supplementray Figure 8. Proposed model of ephrin-b2 signaling in regulating adult neurogenesis. In the SGZ, ephrin-b2 + hippocampal astrocytes induce neuronal differentiation of Sox2 + /EphB4 + NSCs through juxtacrine ephrin-b2/ephb4 forward signaling via a β-catenin dependent mechanism. However, the effect EphB4/ephrin-B2 reverse-signaling on hippocampal astrocytes remains unknown.
10 Supplementary Figure 9. Full-length pictures of the blots presented in Fig. 7. Each experimental group was assayed at both 8 and 24 h post-treatment. The bands for the 24-hour time point are included in Fig.7.
11 Supplementary Table 1. shrna primers for RNAi. Efnb2 shrna Primer Sequence h2 5 - AAAATTAATTAAAAAGCCAAATTTCTACCCGGACATCTCTTGAATGTCCGGGTAG AAATTTGGCGGTGTTTCGTCCTTTCCACAAGATATATAAAGCC-3 h3 (#1) 5 - AAAATTAATTAAAAAGCCGCAGGAGACACCGCAAATCTCTTGAATTTGCGGTGT CTCCTGCGGCGGTGTTTCGTCCTTTCCACAAGATATATAAAGCC-3 h4 5 - AAAATTAATTAAAAAGAGCCGACAGATGCACTATTTCTCTTGAAAATAGTGCATC TGTCGGCTCGGTGTTTCGTCCTTTCCACAAGATATATAAAGCC-3 h5 5 - AAAATTAATTAAAAAGCAGACAAGAGCCATGAAGATCTCTTGAATCTTCATGGCT CTTGTCTGCGGTGTTTCGTCCTTTCCACAAGATATATAAAGCC-3 m1 (#2) 5 - AAAATTAATTAAAAAGGCTAGAAGCTGGTACGAATTCTCTTGAAATTCGTACCAG CTTCTAGCCAAACAAGGCTTTTCTCCAAGGGATATTTATAGTCTC-3 m2 5 - AAAATTAATTAAAAAGCCAAATTTCTACCCGGACATCTCTTGAATGTCCGGGTAG AAATTTGGCAAACAAGGCTTTTCTCCAAGGGATATTTATAGTCTC-3 m5 5 - AAAATTAATTAAAAAGCAGACAAGAGCCATGAAGATCTCTTGAATCTTCATGGCT CTTGTCTGCAAACAAGGCTTTTCTCCAAGGGATATTTATAGTCTC-3 LacZ 5 -GGGGTTAATTAAAAGGTCGGGCAGGAAGAGGGC-3 sense LacZ 5 -GGGGTTAATTAAAAAAAGTGACCAGCGAATACCTGTTCTC-3 antisense
SUPPLEMENTARY FIGURES
SUPPLEMENTARY FIGURES 1 Supplementary Figure 1, Adult hippocampal QNPs and TAPs uniformly express REST a-b) Confocal images of adult hippocampal mouse sections showing GFAP (green), Sox2 (red), and REST
Zhu et al, page 1. Supplementary Figures
Zhu et al, page 1 Supplementary Figures Supplementary Figure 1: Visual behavior and avoidance behavioral response in EPM trials. (a) Measures of visual behavior that performed the light avoidance behavior
GFP/Iba1/GFAP. Brain. Liver. Kidney. Lung. Hoechst/Iba1/TLR9!
Supplementary information a +KA Relative expression d! Tlr9 5!! 5! NSC Neuron Astrocyte Microglia! 5! Tlr7!!!! NSC Neuron Astrocyte! GFP/Sβ/! Iba/Hoechst Microglia e Hoechst/Iba/TLR9! GFP/Iba/GFAP f Brain
Supplemental Figure 1. Intracranial transduction of a modified ptomo lentiviral vector in the mouse
Supplemental figure legends Supplemental Figure 1. Intracranial transduction of a modified ptomo lentiviral vector in the mouse hippocampus targets GFAP-positive but not NeuN-positive cells. (A) Stereotaxic
Supplementary Table 1. List of primers used in this study
Supplementary Table 1. List of primers used in this study Gene Forward primer Reverse primer Rat Met 5 -aggtcgcttcatgcaggt-3 5 -tccggagacacaggatgg-3 Rat Runx1 5 -cctccttgaaccactccact-3 5 -ctggatctgcctggcatc-3
Neocortex Zbtb20 / NFIA / Sox9
Neocortex / NFIA / Sox9 Supplementary Figure 1. Expression of, NFIA, and Sox9 in the mouse neocortex at. The lower panels are higher magnification views of the oxed area. Arrowheads indicate triple-positive
SUPPLEMENTARY FIG. S2. Representative counting fields used in quantification of the in vitro neural differentiation of pattern of dnscs.
Supplementary Data SUPPLEMENTARY FIG. S1. Representative counting fields used in quantification of the in vitro neural differentiation of pattern of anpcs. A panel of lineage-specific markers were used
mir-7a regulation of Pax6 in neural stem cells controls the spatial origin of forebrain dopaminergic neurons
Supplemental Material mir-7a regulation of Pax6 in neural stem cells controls the spatial origin of forebrain dopaminergic neurons Antoine de Chevigny, Nathalie Coré, Philipp Follert, Marion Gaudin, Pascal
Supplementary Figure 1
Supplementary Figure 1 Kif1a RNAi effect on basal progenitor differentiation Related to Figure 2. Representative confocal images of the VZ and SVZ of rat cortices transfected at E16 with scrambled or Kif1a
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION Supplementary Figure 1. The expression of ephrin-b2 H2BGFP persists in the post-hearingonset organ of Corti and is specifically restricted to supporting cells. Sox2 immunolabeling
SUPPLEMENTARY FIGURES AND TABLE
SUPPLEMENTARY FIGURES AND TABLE Supplementary Figure S1: Characterization of IRE1α mutants. A. U87-LUC cells were transduced with the lentiviral vector containing the GFP sequence (U87-LUC Tet-ON GFP).
Supplemental Information. Menin Deficiency Leads to Depressive-like. Behaviors in Mice by Modulating. Astrocyte-Mediated Neuroinflammation
Neuron, Volume 100 Supplemental Information Menin Deficiency Leads to Depressive-like Behaviors in Mice by Modulating Astrocyte-Mediated Neuroinflammation Lige Leng, Kai Zhuang, Zeyue Liu, Changquan Huang,
Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells
Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells (b). TRIM33 was immunoprecipitated, and the amount of
In vivo reprogramming reactive glia into ipscs to produce new neurons in the
In vivo reprogramming reactive glia into ipscs to produce new neurons in the cortex following traumatic brain injury Xiang Gao 1, Xiaoting Wang 1, Wenhui Xiong 1, Jinhui Chen 1, * 1 Spinal Cord and Brain
Supplementary Figure 1. Expression of phospho-sik3 in normal and osteoarthritic articular cartilage in the knee. (a) Semiserial histological sections
Supplementary Figure 1. Expression of phospho-sik3 in normal and osteoarthritic articular cartilage in the knee. (a) Semiserial histological sections of normal cartilage were stained with safranin O-fast
Supplementary Figure S1: Tanycytes are restricted to the central/posterior hypothalamus
Supplementary Figure S1: Tanycytes are restricted to the central/posterior hypothalamus a: Expression of Vimentin, GFAP, Sox2 and Nestin in anterior, central and posterior hypothalamus. In the anterior
effects on organ development. a-f, Eye and wing discs with clones of ε j2b10 show no
Supplementary Figure 1. Loss of function clones of 14-3-3 or 14-3-3 show no significant effects on organ development. a-f, Eye and wing discs with clones of 14-3-3ε j2b10 show no obvious defects in Elav
Tbk1-TKO! DN cells (%)! 15! 10!
a! T Cells! TKO! B Cells! TKO! b! CD4! 8.9 85.2 3.4 2.88 CD8! Tbk1-TKO! 1.1 84.8 2.51 2.54 c! DN cells (%)! 4 3 2 1 DP cells (%)! 9 8 7 6 CD4 + SP cells (%)! 5 4 3 2 1 5 TKO! TKO! TKO! TKO! 15 1 5 CD8
Nature Neuroscience: doi: /nn Supplementary Figure 1. MADM labeling of thalamic clones.
Supplementary Figure 1 MADM labeling of thalamic clones. (a) Confocal images of an E12 Nestin-CreERT2;Ai9-tdTomato brain treated with TM at E10 and stained for BLBP (green), a radial glial progenitor-specific
SUPPLEMENTARY FIGURES
SUPPLEMENTARY FIGURES 1 2 3 4 SUPPLEMENTARY TABLES Supplementary Table S1. Brain Tumors used in the study Code Tumor Classification Age Gender HuTuP51 Glioblastoma 57 Male HuTuP52 Glioblastoma 53 Male
(A) SW480, DLD1, RKO and HCT116 cells were treated with DMSO or XAV939 (5 µm)
Supplementary Figure Legends Figure S1. Tankyrase inhibition suppresses cell proliferation in an axin/β-catenin independent manner. (A) SW480, DLD1, RKO and HCT116 cells were treated with DMSO or XAV939
Supplementary Figure 1
Supplementary Figure 1 AAV-GFP injection in the MEC of the mouse brain C57Bl/6 mice at 4 months of age were injected with AAV-GFP into the MEC and sacrificed at 7 days post injection (dpi). (a) Brains
Prss56, a novel marker of adult neurogenesis in the mouse brain. - Supplemental Figures 1 to 5- Brain Structure and Function
Prss56, a novel marker of adult neurogenesis in the mouse brain - Supplemental Figures 1 to 5- Brain Structure and Function Alexandre Jourdon 1,2, Aurélie Gresset 1, Nathalie Spassky 1, Patrick Charnay
Fragile X Mental Retardation Protein Regulates Proliferation and Differentiation of Adult Neural Stem/ Progenitor Cells
Fragile X Mental Retardation Protein Regulates Proliferation and Differentiation of Adult Neural Stem/ Progenitor Cells Yuping Luo 1., Ge Shan 2., Weixiang Guo 1., Richard D. Smrt 1", Eric B. Johnson 1",
Supplementary Figures
Supplementary Figures Supplementary Figure 1 Characterization of stable expression of GlucB and sshbira in the CT26 cell line (a) Live cell imaging of stable CT26 cells expressing green fluorescent protein
Lack of cadherins Celsr2 and Celsr3 impairs ependymal ciliogenesis, leading to fatal
Lack of cadherins Celsr2 and Celsr3 impairs ependymal ciliogenesis, leading to fatal hydrocephalus Fadel TISSIR, Yibo QU, Mireille MONTCOUQUIOL, Libing ZHOU, Kouji KOMATSU, Dongbo SHI, Toshihiko FUJIMORI,
Glioblastoma Multiforme
Glioblastoma Multiforme Highly malignant, invasive, difficult-to-treat primary brain tumor" " Frequency: 9,000 cases/year (peak age, 55 65 years)" " Recurrence: rapid growth; size may double every 10 days"
Supplementary Materials and Methods
Supplementary Materials and Methods Hepatocyte toxicity assay. Freshly isolated hepatocytes were incubated for overnight with varying concentrations (-25 µm) of sodium glycochenodeoxycholate (GCDC) or
SUPPLEMENTARY INFORMATION
doi:10.1038/nature12652 Supplementary Figure 1. PRDM16 interacts with endogenous EHMT1 in brown adipocytes. Immunoprecipitation of PRDM16 complex by flag antibody (M2) followed by Western blot analysis
Supplementary Information
Supplementary Information mediates STAT3 activation at retromer-positive structures to promote colitis and colitis-associated carcinogenesis Zhang et al. a b d e g h Rel. Luc. Act. Rel. mrna Rel. mrna
293T cells were transfected with indicated expression vectors and the whole-cell extracts were subjected
SUPPLEMENTARY INFORMATION Supplementary Figure 1. Formation of a complex between Slo1 and CRL4A CRBN E3 ligase. (a) HEK 293T cells were transfected with indicated expression vectors and the whole-cell
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nature11306 Supplementary Figures Supplementary Figure 1. Basic characterization of GFP+ RGLs in the dentate gyrus of adult nestin-gfp mice. a, Sample confocal images
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2535 Figure S1 SOX10 is expressed in human giant congenital nevi and its expression in human melanoma samples suggests that SOX10 functions in a MITF-independent manner. a, b, Representative
Supplementary Figure 1
Supplementary Figure 1 3 3 3 1 1 Bregma -1.6mm 3 : Bregma Ref) Http://www.mbl.org/atlas165/atlas165_start.html Bregma -.18mm Supplementary Figure 1 Schematic representation of the utilized brain slice
Supplementary methods:
Supplementary methods: Primers sequences used in real-time PCR analyses: β-actin F: GACCTCTATGCCAACACAGT β-actin [11] R: AGTACTTGCGCTCAGGAGGA MMP13 F: TTCTGGTCTTCTGGCACACGCTTT MMP13 R: CCAAGCTCATGGGCAGCAACAATA
Supplementary Figure 1: Additional metabolic parameters of obesity mouse models and controls. (a) Body weight, (b) blood glucose and (c) insulin
Supplementary Figure 1: Additional metabolic parameters of obesity mouse models and controls. (a) Body weight, (b) blood glucose and (c) insulin resistance index of homeostatic model assessment (HOMA IR)
SUPPLEMENTARY FIGURE LEGENDS. atypical adenomatous hyperplasias (AAH); Grade II: adenomas; Grade III: adenocarcinomas;
SUPPLEMENTARY FIGURE LEGENDS Supplementary Figure S1: Tumor grades in Ras G12D ; p53 / lung tumors. Representative histology (H&E) of K-Ras G12D ; p53 / lung tumors 13 weeks after tumor initiation. Grade
EGFR shrna A: CCGGCGCAAGTGTAAGAAGTGCGAACTCGAGTTCGCACTTCTTACACTTGCG TTTTTG. EGFR shrna B: CCGGAGAATGTGGAATACCTAAGGCTCGAGCCTTAGGTATTCCACATTCTCTT TTTG
Supplementary Methods Sequence of oligonucleotides used for shrna targeting EGFR EGFR shrna were obtained from the Harvard RNAi consortium. The following oligonucleotides (forward primer) were used to
Supplemental Figure 1
Supplemental Figure 1 1a 1c PD-1 MFI fold change 6 5 4 3 2 1 IL-1α IL-2 IL-4 IL-6 IL-1 IL-12 IL-13 IL-15 IL-17 IL-18 IL-21 IL-23 IFN-α Mut Human PD-1 promoter SBE-D 5 -GTCTG- -1.2kb SBE-P -CAGAC- -1.kb
Supplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus
Supplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus changes in corresponding proteins between wild type and Gprc5a-/-
Supplementary Figure 1. Spatial distribution of LRP5 and β-catenin in intact cardiomyocytes. (a) and (b) Immunofluorescence staining of endogenous
Supplementary Figure 1. Spatial distribution of LRP5 and β-catenin in intact cardiomyocytes. (a) and (b) Immunofluorescence staining of endogenous LRP5 in intact adult mouse ventricular myocytes (AMVMs)
Supplementary Figures
Supplementary Figures Supplementary Figure 1. Confirmation of Dnmt1 conditional knockout out mice. a, Representative images of sorted stem (Lin - CD49f high CD24 + ), luminal (Lin - CD49f low CD24 + )
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2566 Figure S1 CDKL5 protein expression pattern and localization in mouse brain. (a) Multiple-tissue western blot from a postnatal day (P) 21 mouse probed with an antibody against CDKL5.
Supplementary Figure 1. AdipoR1 silencing and overexpression controls. (a) Representative blots (upper and lower panels) showing the AdipoR1 protein
Supplementary Figure 1. AdipoR1 silencing and overexpression controls. (a) Representative blots (upper and lower panels) showing the AdipoR1 protein content relative to GAPDH in two independent experiments.
marker. DAPI labels nuclei. Flies were 20 days old. Scale bar is 5 µm. Ctrl is
Supplementary Figure 1. (a) Nos is detected in glial cells in both control and GFAP R79H transgenic flies (arrows), but not in deletion mutant Nos Δ15 animals. Repo is a glial cell marker. DAPI labels
Conserved properties of dentate gyrus neurogenesis across postnatal development revealed by single-cell RNA sequencing
SUPPLEMENTARY INFORMATION Resource https://doi.org/10.1038/s41593-017-0056-2 In the format provided by the authors and unedited. Conserved properties of dentate gyrus neurogenesis across postnatal development
Supplemental Information. Induction of Expansion and Folding. in Human Cerebral Organoids
Cell Stem Cell, Volume 20 Supplemental Information Induction of Expansion and Folding in Human Cerebral Organoids Yun Li, Julien Muffat, Attya Omer, Irene Bosch, Madeline A. Lancaster, Mriganka Sur, Lee
Supplemental Information. NRF2 Is a Major Target of ARF. in p53-independent Tumor Suppression
Molecular Cell, Volume 68 Supplemental Information NRF2 Is a Major Target of ARF in p53-independent Tumor Suppression Delin Chen, Omid Tavana, Bo Chu, Luke Erber, Yue Chen, Richard Baer, and Wei Gu Figure
Supplementary Figure S1 Supplementary Figure S2
Supplementary Figure S A) The blots shown in Figure B were qualified by using Gel-Pro analyzer software (Rockville, MD, USA). The ratio of LC3II/LC3I to actin was then calculated. The data are represented
The Timing of Differentiation of Adult Hippocampal Neurons Is Crucial for Spatial Memory
The Timing of Differentiation of Adult Hippocampal Neurons Is Crucial for Spatial Memory PLoS BIOLOGY Stefano Farioli-Vecchioli 1[, Daniele Saraulli 2,3[, Marco Costanzi 2,3[, Simone Pacioni 4[, Irene
Supplementary Figures
Supplementary Figures Supplementary Fig. 1. Galectin-3 is present within tumors. (A) mrna expression levels of Lgals3 (galectin-3) and Lgals8 (galectin-8) in the four classes of cell lines as determined
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/8/364/ra18/dc1 Supplementary Materials for The tyrosine phosphatase (Pez) inhibits metastasis by altering protein trafficking Leila Belle, Naveid Ali, Ana Lonic,
Suppl. Information Supplementary Figure 1. Strategy/latency analysis of individual mice during maze learning. a,
Goal-oriented searching mediated by ventral hippocampus early in trial-and-error learning Ruediger, S, Spirig, D., Donato, F., Caroni, P. Suppl. Information Supplementary Figure 1. Strategy/latency analysis
SUPPLEMENTARY INFORMATION. Otx2 controls neuron subtype identity in ventral tegmental area and antagonizes
Di Salvio et al. 1 SUPPLEMENTARY INFORMATION Otx2 controls neuron subtype identity in ventral tegmental area and antagonizes vulnerability to MPTP Michela Di Salvio, Luca Giovanni Di Giovannantonio, Dario
Supplementary Figure 1. Blood glucose and insulin levels in mice during 4-day infusion.
Supplementary Figure 1. Blood glucose and insulin levels in mice during 4-day infusion. (A-B) WT and HT mice infused with saline or glucose had overlapping achieved blood glucose and insulin levels, necessitating
Supplementary Information
1 Supplementary Information A role for primary cilia in glutamatergic synaptic integration of adult-orn neurons Natsuko Kumamoto 1,4,5, Yan Gu 1,4, Jia Wang 1,4, Stephen Janoschka 1,2, Ken-Ichi Takemaru
Supporting Information Table of content
Supporting Information Table of content Supporting Information Fig. S1 Supporting Information Fig. S2 Supporting Information Fig. S3 Supporting Information Fig. S4 Supporting Information Fig. S5 Supporting
Supplementary Figure 1. EC-specific Deletion of Snail1 Does Not Affect EC Apoptosis. (a,b) Cryo-sections of WT (a) and Snail1 LOF (b) embryos at
Supplementary Figure 1. EC-specific Deletion of Snail1 Does Not Affect EC Apoptosis. (a,b) Cryo-sections of WT (a) and Snail1 LOF (b) embryos at E10.5 were double-stained for TUNEL (red) and PECAM-1 (green).
Supplementary Table 1. Metabolic parameters in GFP and OGT-treated mice
Supplementary Table 1. Metabolic parameters in GFP and OGT-treated mice Fasted Refed GFP OGT GFP OGT Liver G6P (mmol/g) 0.03±0.01 0.04±0.02 0.60±0.04 0.42±0.10 A TGs (mg/g of liver) 20.08±5.17 16.29±0.8
MII. Supplement Figure 1. CapZ β2. Merge. 250ng. 500ng DIC. Merge. Journal of Cell Science Supplementary Material. GFP-CapZ β2 DNA
A GV GVBD MI DNA CapZ β2 CapZ β2 Merge B DIC GFP-CapZ β2 Merge CapZ β2-gfp 250ng 500ng Supplement Figure 1. MII A early MI late MI Control RNAi CapZαβ DNA Actin Tubulin B Phalloidin Intensity(A.U.) n=10
Supplementary Information
Supplementary Information Figure S1: Follicular melanocytes in the wound peripheral area migrate to the epidermis in response to wounding stimuli. Dorsal skin of Trp2-LacZ mice stained with X-gal and analyzed
Tcf21 MCM ; R26 mtmg Sham GFP Col 1/3 TAC 8W TAC 2W. Postn MCM ; R26 mtmg Sham GFP Col 1/3 TAC 8W TAC 2W
A Tcf21 MCM ; R26 mtmg Sham GFP Col 1/3 Tcf21 MCM ; R26 mtmg TAC 2W Tcf21 MCM ; R26 mtmg TAC 8W B Postn MCM ; R26 mtmg Sham GFP Col 1/3 Postn MCM ; R26 mtmg TAC 2W Postn MCM ; R26 mtmg TAC 8W Supplementary
SOPten flox/flox (KO) Pten flox/flox (WT) flox allele 6.0 kb. Pten. Actin. ! allele 2.3 kb. Supplementary Figure S1. Yanagi, et al.
s1 A Pten flox/flox () SOPten flox/flox () flox allele 6. kb B Pten flox/flox () SOPten flox/flox () Pten Actin! allele 2.3 kb Supplementary Figure S1. Yanagi, et al. A B BrdU BrdU positive cells ( ) 3
Supplementary Figure 1. Electroporation of a stable form of β-catenin causes masses protruding into the IV ventricle. HH12 chicken embryos were
Supplementary Figure 1. Electroporation of a stable form of β-catenin causes masses protruding into the IV ventricle. HH12 chicken embryos were electroporated with β- Catenin S33Y in PiggyBac expression
Supplementary Figure 1. Validation of astrocytes. Primary astrocytes were
Supplementary Figure 1. Validation of astrocytes. Primary astrocytes were separated from the glial cultures using a mild trypsinization protocol. Anti-glial fibrillary acidic protein (GFAP) immunofluorescent
SUPPLEMENTARY INFORMATION
DOI: 1.138/ncb3355 a S1A8 + cells/ total.1.8.6.4.2 b S1A8/?-Actin c % T-cell proliferation 3 25 2 15 1 5 T cells Supplementary Figure 1 Inter-tumoral heterogeneity of MDSC accumulation in mammary tumor
Supplementary Figure 1 IMQ-Induced Mouse Model of Psoriasis. IMQ cream was
Supplementary Figure 1 IMQ-Induced Mouse Model of Psoriasis. IMQ cream was painted on the shaved back skin of CBL/J and BALB/c mice for consecutive days. (a, b) Phenotypic presentation of mouse back skin
RNA interference induced hepatotoxicity results from loss of the first synthesized isoform of microrna-122 in mice
SUPPLEMENTARY INFORMATION RNA interference induced hepatotoxicity results from loss of the first synthesized isoform of microrna-122 in mice Paul N Valdmanis, Shuo Gu, Kirk Chu, Lan Jin, Feijie Zhang,
Supplementary Fig. 1: TBR2+ cells in different brain regions.
Hip SVZ OB Cere Hypo Supplementary Fig. 1: TBR2 + cells in different brain regions. Three weeks after the last tamoxifen injection, TBR2 immunostaining images reveal a large reduction of TBR2 + cells in
supplementary information
DOI: 10.1038/ncb2153 Figure S1 Ectopic expression of HAUSP up-regulates REST protein. (a) Immunoblotting showed that ectopic expression of HAUSP increased REST protein levels in ENStemA NPCs. (b) Immunofluorescent
well for 2 h at rt. Each dot represents an individual mouse and bar is the mean ±
Supplementary data: Control DC Blimp-1 ko DC 8 6 4 2-2 IL-1β p=.5 medium 8 6 4 2 IL-2 Medium p=.16 8 6 4 2 IL-6 medium p=.3 5 4 3 2 1-1 medium IL-1 n.s. 25 2 15 1 5 IL-12(p7) p=.15 5 IFNγ p=.65 4 3 2 1
Neural Stem Cells, Neurogenesis, Behavior and Repair
Neural Stem Cells, Neurogenesis, Behavior and Repair Bi156 Feb. 3, 2012 Paul Patterson Questions Are there stem cells in the adult brain and do they generate new neurons? How would you detect them? Do
Ophthalmology, Radiation Oncology,
Supporting Online Material Journal: Nature Neuroscience Article Title: Corresponding Author: All Authors: Affiliations: Tanycytes of the Hypothalamic Median Eminence Form a Diet- Responsive Neurogenic
Nature Immunology: doi: /ni Supplementary Figure 1. Id2 and Id3 define polyclonal T H 1 and T FH cell subsets.
Supplementary Figure 1 Id2 and Id3 define polyclonal T H 1 and T FH cell subsets. Id2 YFP/+ (a) or Id3 GFP/+ (b) mice were analyzed 7 days after LCMV infection. T H 1 (SLAM + CXCR5 or CXCR5 PD-1 ), T FH
Supplementary Figure 1: Neuregulin 1 increases the growth of mammary organoids compared to EGF. (a) Mammary epithelial cells were freshly isolated,
1 2 3 4 5 6 7 8 9 10 Supplementary Figure 1: Neuregulin 1 increases the growth of mammary organoids compared to EGF. (a) Mammary epithelial cells were freshly isolated, embedded in matrigel and exposed
Supplementary Figure 1. Establishment of prostacyclin-secreting hmscs. (a) PCR showed the integration of the COX-1-10aa-PGIS transgene into the
Supplementary Figure 1. Establishment of prostacyclin-secreting hmscs. (a) PCR showed the integration of the COX-1-10aa-PGIS transgene into the genomic DNA of hmscs (PGI2- hmscs). Native hmscs and plasmid
Fig. S1. Upregulation of K18 and K14 mrna levels during ectoderm specification of hescs. Quantitative real-time PCR analysis of mrna levels of OCT4
Fig. S1. Upregulation of K18 and K14 mrna levels during ectoderm specification of hescs. Quantitative real-time PCR analysis of mrna levels of OCT4 (n=3 independent differentiation experiments for each
Electron micrograph of phosphotungstanic acid-stained exosomes derived from murine
1 SUPPLEMENTARY INFORMATION SUPPLEMENTARY FIGURES Supplementary Figure 1. Physical properties of murine DC-derived exosomes. a, Electron micrograph of phosphotungstanic acid-stained exosomes derived from
Nature Immunology: doi: /ni Supplementary Figure 1. Cellularity of leukocytes and their progenitors in naive wild-type and Spp1 / mice.
Supplementary Figure 1 Cellularity of leukocytes and their progenitors in naive wild-type and Spp1 / mice. (a, b) Gating strategies for differentiated cells including PMN (CD11b + Ly6G hi and CD11b + Ly6G
Primary Mouse Cerebral Cortex Neurons V: 80% TE: 70%
Primary Mouse Cerebral Cortex Neurons V: 80% TE: 70% Pictures: 9 days after electroporation Red: MAP2 Blue: GFAP Green: GFP The cells were from Embryonic Day 14 Mouse Cerebral Cortex Primary Mouse Hippocampal
Milestones of neuronal development in the adult hippocampus
Milestones of neuronal development in the adult hippocampus Gerd Kempermann 1,2, Sebastian Jessberger 2, Barbara Steiner 2 and Golo Kronenberg 1,3 1 Max Delbrück Center for Molecular Medicine (MDC) Berlin-Buch,
(a-r) Whole mount X-gal staining on a developmental time-course of hearts from
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 Supplementary Figure 1 (a-r) Whole mount X-gal staining on a developmental time-course of hearts from Sema3d +/- ;Ephb4 LacZ/+ and Sema3d -/- ;Ephb4 LacZ/+ embryos.
Supplementary Figure 1 IL-27 IL
Tim-3 Supplementary Figure 1 Tc0 49.5 0.6 Tc1 63.5 0.84 Un 49.8 0.16 35.5 0.16 10 4 61.2 5.53 10 3 64.5 5.66 10 2 10 1 10 0 31 2.22 10 0 10 1 10 2 10 3 10 4 IL-10 28.2 1.69 IL-27 Supplementary Figure 1.
Embargoed until Oct. 15, 2 p.m. CST Contacts: Kat Snodgrass, (202) Press Room, Oct : (504) Todd Bentsen, (202)
Embargoed until Oct. 15, 2 p.m. CST Contacts: Kat Snodgrass, (202) 962-4090 Press Room, Oct. 13 17: (504) 670-4630 Todd Bentsen, (202) 962-4086 REALIZING THE POTENTIAL OF STEM CELL THERAPY: STUDIES REPORT
TISSUE-SPECIFIC STEM CELLS
TISSUE-SPECIFIC STEM CELLS Running Rescues Defective Adult Neurogenesis by Shortening the Length of the Cell Cycle of Neural Stem and Progenitor Cells STEFANO FARIOLI VECCHIOLI, a ANDREA MATTERA, a LAURA
Supplemental Figures:
Supplemental Figures: Figure 1: Intracellular distribution of VWF by electron microscopy in human endothelial cells. a) Immunogold labeling of LC3 demonstrating an LC3-positive autophagosome (white arrow)
Neural progenitor cells - potent models of normal and disease neurobiology
Neural progenitor cells - potent models of normal and disease neurobiology Brian Shapiro, Ph.D. Technical Writer, Cell Biology, ATCC November 19, 2015 About ATCC Founded in 1925, ATCC is a non-profit organization
Supplemental Table S1
Supplemental Table S. Tumorigenicity and metastatic potential of 44SQ cell subpopulations a Tumorigenicity b Average tumor volume (mm ) c Lung metastasis d CD high /4 8. 8/ CD low /4 6./ a Mice were injected
Kaul 1. Kaul et al _Inventory of Supplemental Materials. Supplemental Figures and Figure Legends. Figure S1, related to Figure 1
Kaul 1 Kaul et al _Inventory of Supplemental Materials Supplemental Figures and Figure Legends Figure S1, related to Figure 1 Figure S2, related to Figure 2 Figure S3, related to Figure 3 Figure S4, related
Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 )
770 771 Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 ) Human CXCL1 GCGCCCAAACCGAAGTCATA ATGGGGGATGCAGGATTGAG PF4 CCCCACTGCCCAACTGATAG TTCTTGTACAGCGGGGCTTG
Supplementary Figure 1
Supplementary Figure 1 Genetic labeling of microglia Male and female 2-3 month-old CreERT2;R26-tdTomato mice or CreERT2;R26-tdTomato;Iba1-eGFP transgenic mice were treated with 1x, 2x (48 h apart), or
Supplementary Figure S1. Monolayer differentiation of mouse ESCs into telencephalic neural precursors. (a) Schematic representation of the protocols
Supplementary Figure S1. Monolayer differentiation of mouse ESCs into telencephalic neural precursors. (a) Schematic representation of the protocols used to differentiate mouse ESCs. (b) Representative
Wnt7a Inhibits Cartilage Matrix Degradation in a Mouse In Vivo Osteoarthritis Model
Wnt7a Inhibits Cartilage Matrix Degradation in a Mouse In Vivo Osteoarthritis Model Averi Leahy, Andrea Foote, Tomoya Uchimura, Li Zeng, PhD. Tufts University, Boston, MA, USA. Disclosures: A. Leahy: None.
Nature Medicine: doi: /nm.4324
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 Supplementary Figure 1. Kinetics of SnCs development in surgically-induced OA and effect of GCV-induced SnC clearance on OA disease progression
a 0,8 Figure S1 8 h 12 h y = 0,036x + 0,2115 y = 0,0366x + 0,206 Labeling index Labeling index ctrl shrna Time (h) Time (h) ctrl shrna S G2 M G1
(GFP+ BrdU+)/GFP+ Labeling index Labeling index Figure S a, b, y =,x +, y =,x +,,,,,,,, Time (h) - - Time (h) c d S G M G h M G S G M G S G h Time of BrdU injection after electroporation (h) M G S G M
Supplementary Figures. T Cell Factor-1 initiates T helper 2 fate by inducing GATA-3 and repressing Interferon-γ
Supplementary Figures T Cell Factor-1 initiates T helper 2 fate by inducing GATA-3 and repressing Interferon-γ Qing Yu, Archna Sharma, Sun Young Oh, Hyung-Geun Moon, M. Zulfiquer Hossain, Theresa M. Salay,
Supplementary Figure 1. Chimeric analysis of inner ears. (A-H) Chimeric inner ears with fluorescent ES cells and (I,J) Rainbow inner ears.
Supplementary Figure 1. himeric analysis of inner ears. (A-H) himeric inner ears with fluorescent ES cells and (I,J) Rainbow inner ears. (A,B) omposite images showing three colors in different vestibular
Supplemental Materials Molecular Biology of the Cell
Supplemental Materials Molecular Biology of the Cell Garcia-Alvarez et al. Supplementary Figure Legends Figure S1.Expression and RNAi-mediated silencing of STIM1 in hippocampal neurons (DIV, days in vitro).
TISSUE-SPECIFIC STEM CELLS
TISSUE-SPECIFIC STEM CELLS Brain Insulin-Like Growth Factor-I Directs the Transition from Stem Cells to Mature Neurons During Postnatal/Adult Hippocampal Neurogenesis VANESA NIETO-ESTÉVEZ, a,b CARLOS O.
Soft Agar Assay. For each cell pool, 100,000 cells were resuspended in 0.35% (w/v)
SUPPLEMENTARY MATERIAL AND METHODS Soft Agar Assay. For each cell pool, 100,000 cells were resuspended in 0.35% (w/v) top agar (LONZA, SeaKem LE Agarose cat.5004) and plated onto 0.5% (w/v) basal agar.