Table S1: Summary of seminal characteristics of ejaculates collected by manual massage from Australian saltwater crocodiles.
|
|
- Bethanie Collins
- 5 years ago
- Views:
Transcription
1 Electronic supplementary material Table S1: Summary of seminal characteristics of ejaculates collected by manual massage from Australian saltwater crocodiles. Seminal characteristic Mean ± SEM Range Volume (ml) 1.15 ± Sperm concentration ( 10 9 ml -1 ) 2.6 ± Mass activity (0 5) a 1.4 ± % Motile 87 ± Rate of motility (0 5) b 4.2 ± a Mass activity is defined as the amount of swirling (or wave motion) present in the undiluted semen sample and is a function of both sperm concentration and individual sperm motility. The scale for this estimate ranges from: 0 (no swirl no oscillation of individual sperm), 1 (no swirl - generalized oscillation of individual sperm only), 2 (very slow distinct swirl), 3 (slow distinct swirl), 4 (moderately fast distinct swirl), 5 (fast distinct swirl - appearance of good quality semen). b The rate of sperm movement being determined using the following criteria: 0 (no sperm movement), 1 (slight tail undulation without forward motion), 2 (slow tail undulation with slow or stop and start forward motion), 3 (forward progression at a moderate speed), 4 (rapid forward progression), 5 (very rapid progression in which cells are difficult to follow visually).
2 Table S2: Identification of substrates for protein tyrosine phosphorylation following exposure of crocodile spermatozoa to capacitation stimuli. Protein a Symbol Species MW pi MASCOT Peptides (kda) Score b Cytoskeletal function Dynein, axonemal, heavy chain 17 DNAH17 Cathartes aura (Turkey vulture) Filamin A, alpha FLNA Corvus brachyrhynchos (American crow) Outer dense fibre of sperm tails 2 ODF2 Anas platyrhynchos (Mallard) Molecular chaperoning activity Heat shock protein 90kDa alpha (cytosolic), HSP90AA1 Corvus brachyrhynchos class A member 1 (American crow) Heat shock 70kDa protein 5 (glucose- HSPA5 Phoenicopterus ruber regulated protein, 78kDa) ruber
3 (American flamingo) Mitochondrial function Aconitase 2, soluble ACO2 Phalacrocorax carbo (Great cormorant) Cellular signalling RAB2A, member RAS oncogene family RAB2A Corvus brachyrhynchos (American crow) Phosphatidylethanolamine binding protein 1 PEBP1 Taeniopygia guttata (Zebra finch) a Protein identifications were based on alignment of sequenced peptides with those of the Archosauria crown group comprising birds and crocodilians within the UniprotKB database. Proteins have been grouped according to putative function. b The MASCOT Score is a probabilistic scoring algorithm for protein identification ( The recorded MASCOT Score for each protein represents the summed score for all matching peptides, with positive protein identification assigned on the basis of a MASCOT score >35 (corresponding to a 95% confidence level).
4 Figure S1 (a) DAPI PSA Tubulin (b) Acrosome Nucleus Mid-piece Principal-piece Figure S1. Structural characterization of Australian saltwater crocodile spermatozoa. (a) Following isolation, populations of ejaculated crocodile spermatozoa were prepared for labelling of key functional domains with PSA (acrosomal cap, green), DAPI (nucleus, blue), and tubulin (principal-piece of flagellum, red). (b) Alternatively, spermatozoa were lysed in SDS extraction buffer and the extracted proteins resolved by SDS-PAGE alongside those of mouse and human spermatozoa. The separated proteins were subsequently stained with silver reagent.
5
6 Figure S2. Localisation of proteins of interest in crocodile spermatozoa. Following preparation, populations of non-capacitated (NC) and capacitated (CAP) crocodile spermatozoa they were fixed and labelled with either (a) anti-phosphotyrosine or (b) anti-phospho-pka substrate antibodies (green). Alternatively, crocodile spermatozoa were labelled with antibodies against the target proteins of (c) PKA (red) or (d) ODF2 (red) or (e) adenylate cyclase 10 (soluble) (ADCY10) (green). (f) The specificity of the anti-adcy10 antibody was confirmed by immunoblotting of crocodile and mouse sperm lysates as well as a homogenate of mouse brain. Consistent with published evidence the dominant ADCY10 protein detected in sperm lysates was ~48 kda [1]. (g) A proximity ligation assay was also employed to confirm that ODF2 is a substrate for tyrosine phosphorylation during the capacitation of crocodile spermatozoa. This assay produces punctate red fluorescent signals when target antigens of interest (ODF2 and phosphotyrosine residues) reside within a maximum of 40 nm from each other [2]. All experiments were replicated on independent samples from 5 different crocodiles and representative immunolabelling and PLA labelling patterns are shown. In all experiments, cells were counterstained with DAPI (blue). Scale bar = 5µm. 1. Jaiswal B.S., Conti M Identification and functional analaysis of splice variants of the germ cell soluble adenylyl cyclase. J Biol Chem 276(34), (doi: /jbc.m ) 2. Soderberg O., Gullberg M., Jarvius M., Ridderstrale K., Leuchowius K.J., Jarvius J., Wester K., Hydbring P., Bahram F., Larsson L.G., et al Direct observation of individual endogenous protein complexes in situ by proximity ligation. Nat Methods 3(12), (doi: /nmeth947).
SUPPLEMENTARY INFORMATION
Supplementary Figures Supplementary Figure S1. Binding of full-length OGT and deletion mutants to PIP strips (Echelon Biosciences). Supplementary Figure S2. Binding of the OGT (919-1036) fragments with
More informationAnimal Science 434. Sperm Head. Sperm From Different Species. Sperm Structure. Epididymis, Ejaculation and Semen. Head Acrosome Neck Middle Piece
Sperm Structure Head Acrosome Neck Middle Piece Animal Science 434 Annulus Principal Piece Epididymis, Ejaculation and Semen End Piece Sperm From Different Species Sperm Head (Equatorial Segment) Nucleus
More informationRayBio KinaseSTAR TM Akt Activity Assay Kit
Activity Assay Kit User Manual Version 1.0 March 13, 2015 RayBio KinaseSTAR TM Akt Activity Kit Protocol (Cat#: 68AT-Akt-S40) RayBiotech, Inc. We Provide You With Excellent Support And Service Tel:(Toll
More informationA. Macroscopic and Physical tests:- 1. Volume 2. Colour 3. Consistency and cloudiness 4. Osmotic pressure 5. Specific Gravity 6. Electro Conductivity
EXAMINATION AND EVALUATION OF SEMEN. Evaluation of Semen. A. Macroscopic and Physical tests:- 1. Volume 2. Colour 3. Consistency and cloudiness 4. Osmotic pressure 5. Specific Gravity 6. Electro Conductivity
More informationMicroscope Requirements
SEMEN EVALUATION EQUIPMENT Microscope Requirements Good quality lenses Phase-contrast preferred for % progressive motility evaluations Objectives 10X, 20X*, 40X*, 100X, minimum Heated stage preferred *Preferably
More informationhexahistidine tagged GRP78 devoid of the KDEL motif (GRP78-His) on SDS-PAGE. This
SUPPLEMENTAL FIGURE LEGEND Fig. S1. Generation and characterization of. (A) Coomassie staining of soluble hexahistidine tagged GRP78 devoid of the KDEL motif (GRP78-His) on SDS-PAGE. This protein was expressed
More informationSUPPLEMENTARY INFORMATION
Figure S1 Treatment with both Sema6D and Plexin-A1 sirnas induces the phenotype essentially identical to that induced by treatment with Sema6D sirna alone or Plexin-A1 sirna alone. (a,b) The cardiac tube
More informationFertilization: Beginning a New New Organism Or
Fertilization: Beginning a New Organism 1. Contact and recognition between sperm and egg. In most cases, this ensures that the sperm and egg are of the same species. 2. Regulation of sperm entry into the
More information33VASTVNGATSANNHGEPPS51PADARPR58
Pro-rich region Trans-membrane region 214 246 359 381 UL50 1 397 211SSRTAS216PPPPPR222 NLS CR1 CR2 CR3 CR4 UL53 1 376 11RERRS15ALRS19LLRKRRR25 33VASTVNGATSANNHGEPPS51PADARPR58 FIG S1. UL97 phosphorylation
More informationANDROVISION - MORE THAN CASA
ANDROVISION - MORE THAN CASA AndroVision CASA system with Zeiss AxioScope optics and automated ScanStage Computerized semen analysis AndroVision is a highly precise CASA* system for standardised, interactive
More informationExpression constructs
Gene expressed in bebe3 ZmBEa Expression constructs 35S ZmBEa Pnos:Hygromycin r 35S Pnos:Hygromycin r 35S ctp YFP Pnos:Hygromycin r B -1 Chl YFP- Merge Supplemental Figure S1: Constructs Used for the Expression
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2988 Supplementary Figure 1 Kif7 L130P encodes a stable protein that does not localize to cilia tips. (a) Immunoblot with KIF7 antibody in cell lysates of wild-type, Kif7 L130P and Kif7
More informationSupplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus
Supplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus changes in corresponding proteins between wild type and Gprc5a-/-
More information(a) Significant biological processes (upper panel) and disease biomarkers (lower panel)
Supplementary Figure 1. Functional enrichment analyses of secretomic proteins. (a) Significant biological processes (upper panel) and disease biomarkers (lower panel) 2 involved by hrab37-mediated secretory
More informationDramatic increase in SHP2 binding activity of Helicobacter. pylori Western CagA by EPIYA-C duplication: its
Supplementary Information Dramatic increase in SHP2 binding activity of Helicobacter pylori Western CagA by EPIYA-C duplication: its implications in gastric carcinogenesis Lisa Nagase, Takeru Hayashi,
More informationElena Moretti, Ph.D., Nicola Antonio Pascarelli, Ph.D., Maria Grazia Federico, Ph.D., Tommaso Renieri, Ph.D., and Giulia Collodel, Ph.D.
CASE REPORT Abnormal elongation of midpiece, absence of axoneme and outer dense fibers at principal piece level, supernumerary microtubules: a sperm defect of possible genetic origin? Elena Moretti, Ph.D.,
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/8/364/ra18/dc1 Supplementary Materials for The tyrosine phosphatase (Pez) inhibits metastasis by altering protein trafficking Leila Belle, Naveid Ali, Ana Lonic,
More informationNature Structural & Molecular Biology: doi: /nsmb.3218
Supplementary Figure 1 Endogenous EGFR trafficking and responses depend on biased ligands. (a) Lysates from HeLa cells stimulated for 2 min. with increasing concentration of ligands were immunoblotted
More informationSpermatozoa motility in reverse gear? An observation of backward-moving human spermatozoa.
Spermatozoa motility in reverse gear? An observation of backward-moving human spermatozoa. Correspondence sranjanivenkadesan@gmail.com Disciplines Medical Sciences Keywords Spermatozoa, Motility Humans
More informationMammalian Tissue Protein Extraction Reagent
Mammalian Tissue Protein Extraction Reagent Catalog number: AR0101 Boster s Mammalian Tissue Protein Extraction Reagent is a ready-to-use Western blot related reagent solution used for efficient extraction
More informationT H E J O U R N A L O F C E L L B I O L O G Y
Supplemental material Jewell et al., http://www.jcb.org/cgi/content/full/jcb.201007176/dc1 T H E J O U R N A L O F C E L L B I O L O G Y Figure S1. IR Munc18c association is independent of IRS-1. (A and
More informationSupplementary Materials
Supplementary Materials Supplementary Figure S1 Regulation of Ubl4A stability by its assembly partner A, The translation rate of Ubl4A is not affected in the absence of Bag6. Control, Bag6 and Ubl4A CRISPR
More informationSupplementary Figure 1: Characterisation of phospho-fgfr-y463 antibody. (A)
Supplementary Figure 1: Characterisation of phospho-fgfr-y463 antibody. (A) Cells over-expressing hfgfr1-pcdna3 (+) or pcdna3 (-) were stimulated for 10 minutes with 50ng/ml FGF2 and lysates immunoblotted
More informationComputerized semen analysis. Product features. Basic system
AndroVision - more than CASA AndroVision CASA system with Zeiss AxioScope optics and automated ScanStage Computerized semen analysis AndroVision is a highly precise CASA* system for standardised, interactive
More informationSupplementary Figure 1. Supernatants electrophoresis from CD14+ and dendritic cells. Supernatants were resolved by SDS-PAGE and stained with
Supplementary Figure 1. Supernatants electrophoresis from CD14+ and dendritic cells. Supernatants were resolved by SDS-PAGE and stained with Coomassie brilliant blue. One µg/ml recombinant human (rh) apo-e
More informationcondition. Left panel, the HCT-116 cells were lysed with RIPA buffer containing 0.1%
FIGURE LEGENDS Supplementary Fig 1 (A) sumoylation pattern detected under denaturing condition. Left panel, the HCT-116 cells were lysed with RIPA buffer containing 0.1% SDS in the presence and absence
More informationRodriguez The Semen Analysis
RODRIGUEZ 2016 Rodriguez 2016 The Semen Analysis DISCLOSURE "Yo divulgo que no tengo relación financiera con intereses comerciales". RODRIGUEZ 2016 Question1 Fill the Blanks with the Correct Statement
More informationNature Neuroscience: doi: /nn Supplementary Figure 1. PICALM expression in brain capillary endothelium in human brain and in mouse brain.
Supplementary Figure 1 PICALM expression in brain capillary endothelium in human brain and in mouse brain. a, Double immunostaining for PICALM (red, left) and lectin positive endothelial profiles (blue,
More informationAdapted from Preg. & Part., Senger
MALE ENDOCRINOLOGY AND SPERMATOGENESIS (Chapter 10) AVS 222 (Instructor: Dr. Amin Ahmadzadeh) I. MALE ENDOCRINOLOGY (Figure10-1 to 10-3) A. Glands and their respective hormones 1) Hypothalamic hormone:
More informationSupplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation.
Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation. (a) Embryonic fibroblasts isolated from wildtype (WT), BRAF -/-, or CRAF -/- mice were irradiated (6 Gy) and DNA damage
More informationProteasome activity and its relationship with protein phosphorylation during capacitation and acrosome reaction in human spermatozoa
Proteasome activity and its relationship with protein phosphorylation Proteasome activity and its relationship with protein phosphorylation during capacitation and acrosome reaction in human spermatozoa
More informationProject report October 2012 March 2013 CRF fellow: Principal Investigator: Project title:
Project report October 2012 March 2013 CRF fellow: Gennaro Napolitano Principal Investigator: Sergio Daniel Catz Project title: Small molecule regulators of vesicular trafficking to enhance lysosomal exocytosis
More informationSUPPLEMENTARY INFORMATION
Supplementary Table 1. Cell sphingolipids and S1P bound to endogenous TRAF2. Sphingolipid Cell pmol/mg TRAF2 immunoprecipitate pmol/mg Sphingomyelin 4200 ± 250 Not detected Monohexosylceramide 311 ± 18
More informationSupplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells
Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells (b). TRIM33 was immunoprecipitated, and the amount of
More informationERK1/2/MAPK pathway-dependent regulation of the telomeric factor TRF2
ERK1/2/MAPK pathway-dependent regulation of the telomeric factor TRF2 SUPPLEMENTARY FIGURES AND TABLE Supplementary Figure S1: Conservation of the D domain throughout evolution. Alignment of TRF2 sequences
More informationSupplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk
Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk -/- mice were stained for expression of CD4 and CD8.
More informationSupplementary Information. Induction of human pancreatic beta cell replication by inhibitors of dual specificity tyrosine regulated kinase
Journal: Nature Medicine Supplementary Information Induction of human pancreatic beta cell replication by inhibitors of dual specificity tyrosine regulated kinase 1,2 Peng Wang PhD, 1,2 Juan-Carlos Alvarez-Perez
More informationSeminal fluid analysis
What is semen? Semen is the fluid formed at ejaculation. Made of secretions of all the accessory glands of the male genital tract and testicular sperm component Semen quality is maintained by all the accessory
More informationSUPPLEMENTARY MATERIAL
SUPPLEMENTARY MATERIAL IL-1 signaling modulates activation of STAT transcription factors to antagonize retinoic acid signaling and control the T H 17 cell it reg cell balance Rajatava Basu 1,5, Sarah K.
More informationA Hepatocyte Growth Factor Receptor (Met) Insulin Receptor hybrid governs hepatic glucose metabolism SUPPLEMENTARY FIGURES, LEGENDS AND METHODS
A Hepatocyte Growth Factor Receptor (Met) Insulin Receptor hybrid governs hepatic glucose metabolism Arlee Fafalios, Jihong Ma, Xinping Tan, John Stoops, Jianhua Luo, Marie C. DeFrances and Reza Zarnegar
More informationRescue of mutant rhodopsin traffic by metformin-induced AMPK activation accelerates photoreceptor degeneration Athanasiou et al
Supplementary Material Rescue of mutant rhodopsin traffic by metformin-induced AMPK activation accelerates photoreceptor degeneration Athanasiou et al Supplementary Figure 1. AICAR improves P23H rod opsin
More informationTRAF6 ubiquitinates TGFβ type I receptor to promote its cleavage and nuclear translocation in cancer
Supplementary Information TRAF6 ubiquitinates TGFβ type I receptor to promote its cleavage and nuclear translocation in cancer Yabing Mu, Reshma Sundar, Noopur Thakur, Maria Ekman, Shyam Kumar Gudey, Mariya
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nature11429 S1a 6 7 8 9 Nlrc4 allele S1b Nlrc4 +/+ Nlrc4 +/F Nlrc4 F/F 9 Targeting construct 422 bp 273 bp FRT-neo-gb-PGK-FRT 3x.STOP S1c Nlrc4 +/+ Nlrc4 F/F casp1
More informationType of file: PDF Title of file for HTML: Supplementary Information Description: Supplementary Figures
Type of file: PDF Title of file for HTML: Supplementary Information Description: Supplementary Figures Type of file: MOV Title of file for HTML: Supplementary Movie 1 Description: NLRP3 is moving along
More informationSupplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 )
770 771 Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 ) Human CXCL1 GCGCCCAAACCGAAGTCATA ATGGGGGATGCAGGATTGAG PF4 CCCCACTGCCCAACTGATAG TTCTTGTACAGCGGGGCTTG
More informationSupplementary Table 1: Motor-clutch gene mrna expression Myosin Motors
Supplementary Table 1: Motor-clutch gene mrna expression Myosin Motors Symbol Description Expression Rank MYL6 myosin, light chain 6, alkali, smooth muscle and non-muscle 11903 79 MYH9 myosin, heavy chain
More informationLPS LPS P6 - + Supplementary Fig. 1.
P6 LPS - - - + + + - LPS + + - - P6 + Supplementary Fig. 1. Pharmacological inhibition of the JAK/STAT blocks LPS-induced HMGB1 nuclear translocation. RAW 267.4 cells were stimulated with LPS in the absence
More informationNature Immunology: doi: /ni.3631
Supplementary Figure 1 SPT analyses of Zap70 at the T cell plasma membrane. (a) Total internal reflection fluorescent (TIRF) excitation at 64-68 degrees limits single molecule detection to 100-150 nm above
More informationsupplementary information
DOI: 10.1038/ncb2133 Figure S1 Actomyosin organisation in human squamous cell carcinoma. (a) Three examples of actomyosin organisation around the edges of squamous cell carcinoma biopsies are shown. Myosin
More informationSUPPLEMENTAL INFORMATIONS
1 SUPPLEMENTAL INFORMATIONS Figure S1 Cumulative ZIKV production by testis explants over a 9 day-culture period. Viral titer values presented in Figure 1B (viral release over a 3 day-culture period measured
More information(a) Schematic diagram of the FS mutation of UVRAG in exon 8 containing the highly instable
Supplementary Figure 1. Frameshift (FS) mutation in UVRAG. (a) Schematic diagram of the FS mutation of UVRAG in exon 8 containing the highly instable A 10 DNA repeat, generating a premature stop codon
More informationDefinition of Fertilization
Fertilization Definition of Fertilization is the fusion of gametes to initiate the development of a new individual organism In animals, the process involves the fusion of an ovum with a sperm, which eventually
More informationSupplementary Figure 1. Prevalence of U539C and G540A nucleotide and E172K amino acid substitutions among H9N2 viruses. Full-length H9N2 NS
Supplementary Figure 1. Prevalence of U539C and G540A nucleotide and E172K amino acid substitutions among H9N2 viruses. Full-length H9N2 NS nucleotide sequences (a, b) or amino acid sequences (c) from
More informationTITLE: Proteomic profiling of crocodile spermatozoa refutes the tenet that posttesticular
MCP Papers in Press. Published on August 2, 208 as Manuscript RA8.000904 TITLE: Proteomic profiling of crocodile spermatozoa refutes the tenet that posttesticular maturation is restricted to mammals SHORT
More informationHuman recombinat MIF protein (hrmif), MW: Da. m/z. hrmif ( Da) + 4-IPP (282 Da) MWtot ~ Da. m/z.
Intensity % Intensity % A Human recombinat MIF protein (hrmif), MW: 12428.31 Da m/z hrmif (12428.31 Da) + 4-IPP (282 Da) MWtot ~ 12715.21 Da m/z B HTC/C3 DAPI phistone-h3 Merge HTC/C3 DAPI phistone-h3
More informationSupplementary Information
Supplementary Information Intrinsic Photosensitivity Enhances Motility of T Lymphocytes by Phan X. Thieu, Barbara Jaruga, Sandeep C. Pingle, Bidhan C. Bandyopadhyay, & Gerard P. Ahern Supplementary Figure
More informationSupplementary Figure 1. Characterization of NMuMG-ErbB2 and NIC breast cancer cells expressing shrnas targeting LPP. NMuMG-ErbB2 cells (a) and NIC
Supplementary Figure 1. Characterization of NMuMG-ErbB2 and NIC breast cancer cells expressing shrnas targeting LPP. NMuMG-ErbB2 cells (a) and NIC cells (b) were engineered to stably express either a LucA-shRNA
More informationGeneral Laboratory methods Plasma analysis: Gene Expression Analysis: Immunoblot analysis: Immunohistochemistry:
General Laboratory methods Plasma analysis: Plasma insulin (Mercodia, Sweden), leptin (duoset, R&D Systems Europe, Abingdon, United Kingdom), IL-6, TNFα and adiponectin levels (Quantikine kits, R&D Systems
More informationNature Biotechnology: doi: /nbt.3828
Supplementary Figure 1 Development of a FRET-based MCS. (a) Linker and MA2 modification are indicated by single letter amino acid code. indicates deletion of amino acids and N or C indicate the terminus
More informationPreservation of Liquid Boar Semen: Effect of Genotype, Boar and Sperm Parameters on Motility and Acrosome Integrity
VETERINARY RESEARCH INTERNATIONAL Journal homepage: www.jakraya.com/journal/vri ORIGINAL ARTICLE Preservation of Liquid Boar Semen: Effect of Genotype, Boar and Sperm Parameters on Motility and Acrosome
More informationName Animal source Vendor Cat # Dilutions
Supplementary data Table S1. Primary and Secondary antibody sources Devi et al, TXNIP in mitophagy A. Primary Antibodies Name Animal source Vendor Cat # Dilutions 1. TXNIP mouse MBL KO205-2 1:2000 (WB)
More informationSupplementary information. The Light Intermediate Chain 2 Subpopulation of Dynein Regulates Mitotic. Spindle Orientation
Supplementary information The Light Intermediate Chain 2 Subpopulation of Dynein Regulates Mitotic Spindle Orientation Running title: Dynein LICs distribute mitotic functions. Sagar Mahale a, d, *, Megha
More informationNature Structural and Molecular Biology: doi: /nsmb Supplementary Figure 1
Supplementary Figure 1 Mutational analysis of the SA2-Scc1 interaction in vitro and in human cells. (a) Autoradiograph (top) and Coomassie stained gel (bottom) of 35 S-labeled Myc-SA2 proteins (input)
More informationSupporting Information. Post translational Modifications of Serotonin Type 4 Receptor Heterologously Expressed in. Mouse Rod Cells
Supporting Information Post translational Modifications of Serotonin Type 4 Receptor Heterologously Expressed in Mouse Rod Cells David Salom,, Benlian Wang,, Zhiqian Dong, Wenyu Sun, Pius Padayatti, Steven
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/6/278/rs11/dc1 Supplementary Materials for In Vivo Phosphoproteomics Analysis Reveals the Cardiac Targets of β-adrenergic Receptor Signaling Alicia Lundby,* Martin
More informationFigure S1. Sorting nexin 9 (SNX9) specifically binds psmad3 and not psmad 1/5/8. Lysates from AKR-2B cells untreated (-) or stimulated (+) for 45 min
Figure S1. Sorting nexin 9 (SNX9) specifically binds psmad3 and not psmad 1/5/8. Lysates from AKR2B cells untreated () or stimulated () for 45 min with 5 ng/ml TGFβ or 10 ng/ml BMP4 were incubated with
More informationSUPPLEMENTARY INFORMATION
doi: 10.1038/nature06994 A phosphatase cascade by which rewarding stimuli control nucleosomal response A. Stipanovich*, E. Valjent*, M. Matamales*, A. Nishi, J.H. Ahn, M. Maroteaux, J. Bertran-Gonzalez,
More informationAlpha-Tubulin Housekeeping 10,000 tests
Headquarters & Europe Office Cisbio Bioassays Phone: +33 (0)4 66 79 67 05 Fax: +33 (0)4 66 79 19 20 bioassays@cisbio.com cisbio_dd_pi_64atubpeh USA Office Cisbio US, Inc. Phone: +1 888 963 4567 Fax: +1
More informationRegulation of cell function by intracellular signaling
Regulation of cell function by intracellular signaling Objectives: Regulation principle Allosteric and covalent mechanisms, Popular second messengers, Protein kinases, Kinase cascade and interaction. regulation
More informationLecture 5: Drug targets (continued)
Lecture 5: Drug targets (continued) IIa. Enzymes as drug targets (HMG-CoA example) Many drugs are inhibitors of enzymes that catalyze biologically important reactions. The conversion of HMG-CoA to mevalonic
More informationSUPPLEMENTARY INFORMATION
Supplementary Figure 1. Behavioural effects of ketamine in non-stressed and stressed mice. Naive C57BL/6 adult male mice (n=10/group) were given a single dose of saline vehicle or ketamine (3.0 mg/kg,
More informationMolecular BASIS OF FERTILIZATION
COLLEGE OF HEALTH SCIENCE DEPARTMENT OF PHYSIOLOGY PRESENTATION ON: Molecular BASIS OF FERTILIZATION By TEKETEL ERISTU Kediso 1 Presentation Outline Introduction Fertilization Types of Fertilization Cellular
More informationDevelopment: is the growth of an individual organism from a simple to a more complex or mature level. A slow process of progressive change
1. Define the following terms (use your own words): development, growth, differentiation, histogenesis, organogenesis, morphogenesis, reproduction, tissue, organ, organ system, and organism. Development:
More informationSupplementary Figure S1
Supplementary Figure S1 Supplementary Figure S1. PARP localization patterns using GFP-PARP and PARP-specific antibody libraries GFP-PARP localization in non-fixed (A) and formaldehyde fixed (B) GFP-PARPx
More informationCalcium channels in chicken sperm regulate motility and the acrosome reaction
Calcium channels in chicken sperm regulate motility and the acrosome reaction Thi Mong Diep Nguyen,,,, Anne Duittoz,,, Christophe Praud 5, Yves Combarnous,, and Elisabeth Blesbois,, Institut National de
More informationInformation Sheet. Male Infertility
Infertility National Public Awareness Campaign Information Sheet Male Infertility In approximately half of couples complaining of infertility part of the problem lies with the male. Male infertility has
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION Supplementary Figure 1. The expression of ephrin-b2 H2BGFP persists in the post-hearingonset organ of Corti and is specifically restricted to supporting cells. Sox2 immunolabeling
More informationSupplementary Figure 1
Supplementary Figure 1 14 12 SEM4C PLXN2 8 SEM4C C 3 Cancer Cell Non Cancer Cell Expression 1 8 6 6 4 log2 ratio Expression 2 1 4 2 2 p value.1 D Supplementary Figure 1. Expression of Sema4C and Plexin2
More informationWAVE DYNAMYCS OF HUMAN SPERM MOTILITY
Page 1 of 14 WAVE PARAMETERS OF THE SPERM FLAGELLUM AS PREDICTORS OF HUMAN SPERMATOZOA MOTILITY Andrologia 30: 153-157, 1998 O. Vera 1, M.G. Muñoz 2 and K. Jaffe 2 1 Facultad de Ciencias Veterinarias,
More informationSupplementary figure 1
Supplementary figure 1 (A) Quantitative analysis of F-actin signal intensity in NIH3T3 cells treated with PTD4-myc- RBD. NIH3T3 cells were treated with PTD4-myc-RBD as described. Please note the increase
More information1.0 Purpose - This procedure specifies the method for conducting analysis for semen and sperm in forensic casework.
Procedure for Semen and Sperm Analysis 1.0 Purpose - This procedure specifies the method for conducting analysis for semen and sperm in forensic casework. 2.0 Scope - This procedure applies to those Forensic
More informationSupplemental Table I
Supplemental Table I Cortex Hippocampus Age (weeks) Genotype STE 61 pste 61 STE 61 pste 61 8 100.0 ± 4.4 96.2 ± 6.0 99.8 ± 8.7 167.5 ± 7.8* 100.0 ± 7.0 90.5 ± 13.8 100.0 ± 12.8 260.4 ± 33.9** 12 100.0
More informationHelen Kim, Ph.D. and John Cutts. Dept of Pharmacology & Toxicology University of Alabama at Birmingham
Understanding the actions of a dietary anti-oxidant at the protein and small molecule level using top-down proteomics, enzyme assays and mass spectrometry elen Kim, Ph.D. and John Cutts Mar 9, 2012 UAB
More informationThe spermatogenesis CHARACTERISTICS OF THE SPERMATOZOON 26/04/2017. Reproductive Biotechnologies Andrology I. Prof. Alberto Contri
Reproductive Biotechnologies Andrology I The spermatogenesis Prof. Alberto Contri CHARACTERISTICS OF THE SPERMATOZOON 1) Aploid cell with high condensed DNA 2) Forward motility - flagellum 3) Enzymes for
More informationSupplementary Appendix
Supplementary Appendix This appendix has been provided by the authors to give readers additional information about their work. Supplement to: Choi YL, Soda M, Yamashita Y, et al. EML4-ALK mutations in
More informationSection 1 Proteins and Proteomics
Section 1 Proteins and Proteomics Learning Objectives At the end of this assignment, you should be able to: 1. Draw the chemical structure of an amino acid and small peptide. 2. Describe the difference
More informationp = formed with HCI-001 p = Relative # of blood vessels that formed with HCI-002 Control Bevacizumab + 17AAG Bevacizumab 17AAG
A.. Relative # of ECs associated with HCI-001 1.4 1.2 1.0 0.8 0.6 0.4 0.2 0.0 ol b p < 0.001 Relative # of blood vessels that formed with HCI-001 1.4 1.2 1.0 0.8 0.6 0.4 0.2 0.0 l b p = 0.002 Control IHC:
More informationNovel Regulation of Glycoprotein VI Signaling in platelets
Novel Regulation of Glycoprotein VI Signaling in platelets Satya P. Kunapuli, Ph.D. Department of Physiology, Sol Sherry Thrombosis Research Center Temple University School of Medicine, Philadelphia, PA
More informationISOQUERCITRIN ON THE BEHAVIOR OF
BENEFICIAL EFFECTS OF ISOQUERCITRIN ON THE BEHAVIOR OF BOVINE SPERMATOZOA IN VITRO Hana Greifová*, Eva Tvrdá, Norbert Lukáč 8th CASEE Conference "Sustainable development in Europe cooperation between science
More informationT H E J O U R N A L O F C E L L B I O L O G Y
T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Dunsch et al., http://www.jcb.org/cgi/content/full/jcb.201202112/dc1 Figure S1. Characterization of HMMR and CHICA antibodies. (A) HeLa
More informationa b G75 G60 Sw-2 Sw-1 Supplementary Figure 1. Structure predictions by I-TASSER Server.
a b G75 2 2 G60 Sw-2 Sw-1 Supplementary Figure 1. Structure predictions by I-TASSER Server. a. Overlay of top 10 models generated by I-TASSER illustrates the potential effect of 7 amino acid insertion
More informationG-Protein Signaling. Introduction to intracellular signaling. Dr. SARRAY Sameh, Ph.D
G-Protein Signaling Introduction to intracellular signaling Dr. SARRAY Sameh, Ph.D Cell signaling Cells communicate via extracellular signaling molecules (Hormones, growth factors and neurotransmitters
More informationGPR120 *** * * Liver BAT iwat ewat mwat Ileum Colon. UCP1 mrna ***
a GPR120 GPR120 mrna/ppia mrna Arbitrary Units 150 100 50 Liver BAT iwat ewat mwat Ileum Colon b UCP1 mrna Fold induction 20 15 10 5 - camp camp SB202190 - - - H89 - - - - - GW7647 Supplementary Figure
More informationCELLS. Cells. Basic unit of life (except virus)
Basic unit of life (except virus) CELLS Prokaryotic, w/o nucleus, bacteria Eukaryotic, w/ nucleus Various cell types specialized for particular function. Differentiation. Over 200 human cell types 56%
More informationSUPPLEMENTARY INFORMATION
DOI: 1.138/ncb222 / b. WB anti- WB anti- ulin Mitotic index (%) 14 1 6 2 T (h) 32 48-1 1 2 3 4 6-1 4 16 22 28 3 33 e. 6 4 2 Time (min) 1-6- 11-1 > 1 % cells Figure S1 depletion leads to mitotic defects
More informationSupplementary Figure 1. The CagA-dependent wound healing or transwell migration of gastric cancer cell. AGS cells transfected with vector control or
Supplementary Figure 1. The CagA-dependent wound healing or transwell migration of gastric cancer cell. AGS cells transfected with vector control or 3xflag-CagA expression vector were wounded using a pipette
More informationdoi: /nature10632
SUPPLEMENTARY INFORMATION doi:10.1038/nature10632 Supplementary Figure 1 Lyn mediates neutrophil wound responses as a redox sensor. a, A schematic model. Wounded epithelial cells release H 2 O 2 by an
More information(A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and a
Supplementary figure legends Supplementary Figure 1. Expression of Shh signaling components in a panel of gastric cancer. (A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and
More informationDetermination of the ultrastructural pathology of human sperm by atomic force microscopy
FERTILITY AND STERILITY VOL. 75, NO. 5, MAY 2001 Copyright 2001 American Society for Reproductive Medicine Published by Elsevier Science Inc. Printed on acid-free paper in U.S.A. Determination of the ultrastructural
More information