EXPLORING PROTEIN STRUCTURE

Transcription

1 EXPLORING PROTEIN STRUTURE A teaching tool for introducing students to protein structure. The final slide contains links to the files and programs students need to view proteins using n3d. Save this Power Point to your desktop prior to beginning the show. 1

2 Proteins. A protein hormone which helps to regulate your blood sugar levels If there is a job to be done in the molecular world of our cells, usually that job is done by a protein. ATALASE An enzyme which removes ydrogen peroxide from your body so it does not become toxic Examples of proteins include hormones acting as messengers; enzymes speeding up reactions; cell receptors acting as antennae ; antibodies fighting foreign invaders; membrane channels allowing specific molecules to enter or leave a cell; they make up the muscles for moving; let you grow hair, ligaments and fingernails; and let you see (the lens of your eye is pure crystalised protein). Source: ashington.edu/conj/protein/insulin2.gif w w.biochem.ucl.ac.uk/bsm/pdbsum/1gw f/main.html 2

3 Proteins can be fibrous or globular Let s explore the diversity of protein structure and function by investigating some examples 3

4 Fibrous proteins have a structural role ollagen is the most abundant protein in vertebrates. ollagen fibers are a major portion of tendons, bone and skin. Alpha helices of collagen make up a triple helix structure giving it tough and flexible properties. Fibroin fibers make the silk spun by spiders and silk worms stronger weight for weight than steel! The soft and flexible properties come from the beta structure. Keratin is a tough insoluble protein that makes up the quills of echidna, your hair and nails and the rattle of a rattle snake. The structure comes from alpha helices that are cross-linked by disulfide bonds. Source:

5 The globular proteins The globular proteins have a number of biologically important roles. They include: ell motility proteins link together to form filaments which make movement possible. Organic catalysts in biochemical reactions enzymes Regulatory proteins hormones, transcription factors Membrane proteins M markers, protein channels, gap junctions Defense against pathogens poisons/toxins, antibodies, complement Transport and storage hemoglobin and myosin 5

6 Proteins for cell motility Above: Myosin (red) and actin filaments (green) in coordinated muscle contraction. Right: Actin bound to the mysoin binding site (groove in red part of myosin protein). Add energy (ATP) and myosin moves, moving actin with it. Source: w w.ebsa.org/npbsn41/maf_home.html 6

7 Proteins in the ell ytoskeleton Source: Tubulin forms helical filaments heidelberg.mpg.de/shared/docs/staff/user/0001/24.php3?department=01&lang=en w w.fz-juelich.de/ibi/ibi-1/ellular_signaling/ Eukaryote cells have a cytoskeleton made up of straight hollow cylinders called microtubules (bottom left). They help cells maintain their shape, they act like conveyer belts moving organelles around in the cytoplasm, and they participate in forming spindle fibres in cell division. Microtubules are composed of filaments of the protein, tubulin (top left). These filaments are compressed like springs allowing microtubules to stretch and contract. 13 of these filaments attach side to side, a little like the slats in a barrel, to form a microtubule. This barrel shaped structure gives strength to the microtubule. 7

8 Proteins speed up reactions - Enzymes atalase speeds up the breakdown of hydrogen peroxide, ( 2 O 2 ) a toxic by product of metabolic reactions, to the harmless substances, water and oxygen. The reaction is extremely rapid as the enzyme lowers the energy needed to kick-start the reaction (activation energy) Energy No catalyst = Input of 71kJ energy required With catalase = Input of 8 kj energy required Substrate Progress of reaction Activation Energy Product 8

9 Proteins can regulate metabolism hormones When your body detects an increase in the sugar content of blood after a meal, the hormone insulin is released from cells in the pancreas. Insulin binds to cell membranes and this triggers the cells to absorb glucose for use or for storage as glycogen in the liver. Proteins span membranes protein channels The FTR membrane protein is an ion channel that regulates the flow of chloride ions. Not enough of this protein gets inserted into the membranes of people suffering ystic fibrosis. This causes secretions to become thick as they are not hydrated. The lungs and secretory ducts become blocked as a consequence. Source: w w.biology.arizona.edu/biochemistry/tutorials/chemistry/page2.html w w.cbp.pitt.edu/bradbury/projects.htm 9

10 Proteins Defend us against pathogens antibodies Left: Antibodies like IgG found in humans, recognise and bind to groups of molecules or epitopes found on foreign invaders. Right: The binding site of an antigen protein (left) interacting with the epitope of a foreign antigen (green) Source: w w.biology.arizona.edu/immunology/tutorials/antibody/fr.html w w.spilya.com/research/ w w.umass.edu/microbio/chime/ 10

11 Making Proteins ow are such a diverse range of proteins possible? The code for making a protein is found in your genes (on your DNA). This genetic code is copied onto a messenger RNA molecule. The mrna code is read in multiples of 3 (a codon) by ribosomes which join amino acids together to form a polypeptide. This is known as gene expression. Source: 11

12 Gene Expression The protein folds to form its working shape Gene hromosome NULEUS DNA G T A T A The order of bases in DNA is a code for making proteins. The code is read in groups of three AUGAGUAAAGGAGAAGAAUUUUAUGGAUA M S E E L K ELL F T ell machinery copies the code making an mrna molecule. This moves into the cytoplasm. Ribosomes read the code and accurately join Amino acids together to make a protein 12

13 The building blocks The amino acids for making new proteins come from the proteins that you eat and digest. Every time you eat a burger (vege or beef), you break the proteins down into single amino acids ready for use in building new proteins. And yes, proteins have the job of digesting proteins, they are known as proteases. There are only 20 different amino acids but they can be joined together in many different combinations to form the diverse range of proteins that exist on this planet 13

14 Amino Acids An amino acid is a relatively small molecule with characteristic groups of atoms that determine its chemical behaviour. The structural formula of an amino acid is shown at the end of the animation below. The R group is the only part that differs between the 20 amino acids. Phenylalanine ysteine Alanine Glycine Valine S 3 3 R Amino N O O Acid 14

15 The 20 Amino Acids The amino acids each have their own shape and charge due to their specific R group. View the molecular shape of amino acids by clicking on the URL link below: Would the shape of a protein be affected if the wrong amino acid were added to a growing protein chain? 15

16 Making a Polypeptide R O 2 N 2 N O O Peptide Bond R N R Peptide Bond O N R O N O Peptide Bond O N R O O N R O O O R O Polypeptide Growth Polypeptide production = ondensation Reaction 16

17 Why Investigate Protein Structure? Proteins are complex molecules whose structure can be discussed in terms of: primary structure secondary structure tertiary structure quaternary structure The structure of proteins is important as the shape of a protein allows it to perform its particular role or function 17

18 Protein Primary Structure The primary structure is the sequence of amino acids that are linked together. The linear structure is called a polypeptide 18

19 Protein Secondary Structure The secondary structure of proteins consists of: alpha helices beta sheets Random coils usually form the binding and active sites of proteins Source: 19

20 Protein Tertiary Structure Involves the way the random coils, alpha helices and beta sheets fold in respect to each other. This shape is held in place by bonds such as weak ydrogen bonds between amino acids that lie close to each other, strong ionic bonds between R groups with positive and negative charges, and disulfide bridges (strong covalent S-S bonds) Amino acids that were distant in the primary structure may now become very close to each other after the folding has taken place S ource: io.uwinnipeg.ca/~simmons/ cm1503/proteins.htm The subunit of a more complex protein has now been formed. It may be globular or fibrous. It now has its functional shape or conformation. 20

21 Protein Quaternary Structure This is packing of the protein subunits to form the final protein complex. For example, the human hemoglobin molecule is a tetramer made up of two alpha and two beta polypeptide chains (right) Source: Pun_Evolution/hapter2/2.6.htm This is also when the protein associates with non-proteic groups. For example, carbohydrates can be added to form a glycoprotein Source: am.gif 21

22 Explore your proteins Scientists have worked out the shape of many proteins by conducting experiments. When they have their results, they publish them and this information is then entered into supercomputing systems for people to access. You can view the three dimensional structure of some of your proteins using the computer program n3d. If you do not have n3d installed on your computer you can download this free application from the URL link: Download n3d aemoglobin Amylase ollagen 22

23 Research another protein. Discuss what you can learn about its structure, function and the organism it comes from using the skills you learned today and website resources. You can explore a number of proteins using n3d. Go to the following URL: In the for box, try some of the proteins listed below (one at a time) and then hit go. You will get a list of options. lick on the writing in blue to select one. A new page will appear. lick on the View 3D structure button. Explore using your n3d skills. Misc Enzym es Genetics Toxins ollagen Amylase Endonuclease Ricin Tubulin Rubisco Taq DNA Polymerase Arsenic Porphyrin Pepsin Ribosome Tetanus toxin Prion Alcohol dehydrogenase elicase Funnel w eb toxin 23