Population Genetics of Structural Variation Speaker Dr. Don Conrad

Size: px
Start display at page:

Download "Population Genetics of Structural Variation Speaker Dr. Don Conrad"

Transcription

1 Population Genetics of Structural Variation Dr. Don Conrad Wellcome Trust Sanger Institute Cambridge, UK 1 Overview Ascertainment of CNVs What CNV data is available Humans, chimpanzee, macaque, Drosophila, mouse, rat Population genetic forces: mutation, selection, drift Mutation Processes Rates Recombination/gene conversion Demography/population structure Functional impact of CNVs What are constraints on copy number? Evidence for positive selection Fate of duplicated genes Future challenges/conclusions 2 Available data Human Whole genome surveys in 270 HapMap samples Redon et al., 2006, Nature; McCarroll et al., 2008, Nature Genetics Whole genome survey in 1000 global samples from the HGDP, Jakobsson et al., 2008, Nature Chimpanzee Perry et al., 06 PNAS ; Perry, et al., 08 Genome Research (30 samples) Macaque Lee et al., 08 Genome Research Drosophila Mice Rat Emerson et al., 08 Science, 15 lines of Drosophila Melanogaster Egan et al., 07 Nat Genet Graubert et al., 07 PLoS Genetics Guryev et al., 08 Nat Genet, 14 lines 3 1

2 Ascertainment frequency Power frequency Deletion length (kb) Power to detect a single deletion, as a function of deletion size in HapMap release 16.1c length of deletion (kb) Observed and predicted deletion sizes Conrad et al., (2006) Nature Genetics 4 The forces of population genetics Time The core population genetic forces: Mutation - input of new variation Drift - random change in allele frequency due to sampling Selection - alters the lifetime of mutation (e.g., accelerate the removal or fixation) Key point: all 3 forces are scaled by the population size implications for comparison of CNV patterns across populations and species 5 Mutation-drift-selection balance equency Fre f mutation mutation normal duplication The frequency of an allele at a given point in time results from the balance of the forces of mutation, selection, and drift; mutation adds new copies to the population, while drift and selection can remove them time 6 2

3 Structural variation mutation rates minisatellites Microsatellites CTCT -> CTCTCT Single nucleotide polymorphisms (SNPs) C->A Structural Variation (Deletions, Duplications, Inversions, Translocations) Retroelement insertions Jobling, Hurles, Tyler-Smith, Human Evolutionary Genetics 7 CNV breakpoints - clues to mechanisms Better understanding of mutational mechanisms better mutation models: Predict unobserved pathogenic mutations Power calculations for rare variant studies e.g. combine SNPs, indels and CNVs to maximise power Segmental duplications Density of G-quadraplex Left Flank CNV Right Flank Non-B DNA forming sequences: G-tetraplexes Left Flank CNV Right Flank 8 Mutation rates, cont. NAHR: events per locus/per generation Deletion 2x likely as duplications (D Turner et al., (2008) Nat Genet) Non homologous end joining: <10-7 Fork Stalling and Template Switching (FoSTeS): Rate unknown (Lee and Lupski et al., (2008) Cell) Retroelement insertion: 1 every births; Relative rates: - L1 (6kb): 8.4% - Alu (300bp): 87.2% - HERVK (10kb): 0.5% - SVA (1.6kb): 5% Inter-chromosomal duplication: rate unknown 9 3

4 Mutator alleles Inversion polymorphisms predispose their carrier to further chromosomal rearrangements An inversion is necessary for the CNV to form in some cases: - Sharp et al., (2006) Nat Genet, Visser et al.,.(2005) Am J Hum Genet, Giorda et al., (2007) Hum Mutat, Jobling et al., (1998) Curr Biol In other cases, inversions are enriched in the parents of children with de novo CNVs, but not required for rearrangement: - Gimelli et al., (2003) Hum Mol Genet, Osborne et al., (2001) Nat Genet A Possible mechanisms B centromere Heterologous synapsis Microloop Adapted from AJ Sharp (2008) Hum Mutat inversion telomere Heterologous synapsis Brown et al., (1998) Am J Hum Genet 10 Secondary affects of SV Additional ways in which SV can modulate molecular genetic processes: Large duplications suppress recombination in heterozygous form (Roberts and Broderick (1982) Genetics); Same should be true of large deletions Recombination is restricted between inversions in heterozygous individuals Both of these phenomenon should leave detectable traces in population genetic data a b c Recombination rate (p/kb) Inverted and noninverted Inverted noninverted Physical position (kb) Conrad and Hurles (2007) Nat Genet 11 SNPs and CNVs have similar LD properties C Conrad and Hurles (2007), Nature Genetics McCarroll et al., (2008) Nat Genet 12 4

5 Gene conversion moves variation T A T T Cartoon example of gene conversion between a duplication pair At least 30% of the euchromatic portion of the Y chromosome is contained in palindromic repeats of > 99.9% identity; these repeats also house most of the testis-specific genes on the Y; gene conversion between repeats provides a mechanism for the efficient removal of deleterious variation from the population Palindromes Skaletsky et al., (2003) Nature 13 Size distribution of CNVs >100bp CNV size distributions 2007/2008 Ventor >100 Watson >100 Redon 500K Korbel deletion Kidd deletion Densi ity 2006 Log10(CNV) length) 14 Landscape of CNVs in humans Within an individual appears to be ~10000 variants greater than 50bp in length (Standard array-based platforms are calling CNVs per genome) At the population level: Affymetrix 6.0 (McCarroll et al., 2008 Nat Genet) Synthesis of most CNV studies prior to 2007 Median length of 7.5 kb 1500 CNVs with at least 2 variants in 270 HapMap samples 374 common large CNVs (allele frequency > 5%) in Europeans (CEU) 15 5

6 Population structure and differentiation Conrad and Hurles (2007) Nat Genet CNVs appear quite similar to SNPs in terms of their informativeness for identifying structure, and in terms of their patterns of population differentiation F st for CNPs McCarroll et al., (2008) Nat Genet F st for SNPs 16 Population differentiation V ST =(V T -V S )/V T Vst for 27K BAC clones V ST CNV Genotypes UGT2B17 CCL3L1 Near MAPT Redon et al., 2006 Nature 17 Functional impact of CNVs in humans CNVs explain at least 9-18% of heritable variation in gene expression Suggests that per locus, CNV may affect 5 times as much variation as SNPs Strong prior evidence for an important role of CNV in human traits Stranger et al., (2007) Science 18 6

7 Deletions are deleterious Category CEU deletions YRI deletions Entire HapMap Coding non-synonymous ,449 Coding-synonymous Intron 760 1, ,541 Locus-region ,976 Mrna-utr ,534 NA 3,154 4, ,183 Nonidentical Splice-site Total 4,312 6,470 1,017,246 Additionally, Deletions appear more biased away from genes than duplications (this suggests that some genes in the genome are dosage sensitive) Large deletions appear 3x smaller than large duplications (43kb versus 120kb, Redon et al., 2006) Conrad et al., 2006 Nat Genetics 19 Deletion gene biological process % deletions - % genome Biological process unclassified Nucleoside, nucleotide and nucleic acid metabolism transport Cell proliferation and differentiation Cell cycle apoptosis Amino acid metabolism Development processes Electron transport Cell structure and mobility Intracellular protein traffic Other metabolism Blood circulation and gas exchange Lipid, fatty acid and steroid metabolism Oncogenesis Coenzyme and prosthetic group metabolism Protein targeting and localization Carbohydrate metabolism Muscle contraction Protein metabolism and modification Neuronal activities Cell adhesion Immunity and defense Sensory perception Signal transduction 20 genome % deletions - % g Deletion gene molecular function Molecular function unclassified nucleic acid binding Transcription factor transporter hydrolase Signaling molecule oxidoreductase Membrane traffic protein chaperone Miscellaneous function Isomerase Lyase Extracellular matrix Ligase Select calcium binding protein Synthase and synthetase Cytoskeletal protein Transfer/carrier protein Ion channel Cell junction protein Transferase Phosphatase Select regulatory molecule Cell adhesion molecule kinase Protease Defense/immunity protein Receptor 21 7

8 Mammals share patterns of CNV polymorphism Genes from the same functional categories, and often the same genes, show tolerance to CNV across all mammalian species examined thus far (Human, Chimp, Macaque, Mouse, Rat) The data suggests that this is largely due to neutral forces, not positive/balancing selection Deletions at these loci are probably recessive (i.e no phenotype is observed in heterozygotes) GO categories significantly overrepresented in mouse CNVs Duplications probably have no adverse effect Graubert et al., (2007) PLoS Genetics 22 Dosage sensitivity Change in copy number of a dosage sensitive genes leads to an abnormal phenotype Haploinsufficient genes are those specifically sensitive to deletion Position of a gene in a gene network is a useful predictor of dosage sensitivity Safely duplicated gene Non-duplicated gene Korbel et al., (2008) Current Opinion in Structural Biology 23 Selection in Drosophila 312 CNVs/genome detected in Emerson et al. 1 every 12kb Ratio of duplications:deletions 2.5:1 Estimate fitness impact of duplications (γ < 0 => negative impact on fitness) As a class, most CNVs appear to be neutral or deleterious 24 8

9 Malaria and CNV Two common deletions confer resistance to malaria: Deletions of alpha-globin (results in alpha-thalassemia) Deletion of AE1 cause Southeast Asian Ovalocytosis In both cases, the connection with malaria was made by recognizing that the geographic distribution of the mutation was correlated with rates of endemic malaria Healthy red blood cells Ovalocytic RBCs Wrong et al., (2002) Kidney International 25 The importance of duplicated genes Classic statement of the theory due to Susumu Ohno (Evolution by Gene Duplication, 1970) A newly duplicated gene is freed from functional contraint and can head explore previously forbidden mutations, and potentially gain new functions (neofunctionalization) Homeobox gene clusters evolved by duplication; The duplication is mirrored in the segmented body of Drosophila legs only halteres and legs legs and wings Antennapedia Bithorax 26 The fate of duplicated genes Regulatory elements Transcribed region Full function Dead function New function duplication Phase I nonfunctionalization neofunctionalization subfunctionalization Phase II Force et al., (1999) Genetics 27 9

10 Taming genome complexity SMAvar1 Seg dups SMAvar1 SMAvar2 Seg dups SMAvar2 Schmutz et al., (2005) Nature 28 Conclusions Near complete ascertainment of large, common CNVs in Europeans Only true for events assayable with clone/oligo arrays Extreme heterogeneity in mutation processes and rates LD, demographic properties of CNVs very similar to SNPs CNVs are not marker of choice for demographic inference Evidence for selection on CNVs Mostly purifying selection Interesting ways in which CNVs can achieve functional changes that SNPs cannot Small number of copy number variants confer traits that are critical to our species success and survival

Genomic structural variation

Genomic structural variation Genomic structural variation Mario Cáceres The new genomic variation DNA sequence differs across individuals much more than researchers had suspected through structural changes A huge amount of structural

More information

Global variation in copy number in the human genome

Global variation in copy number in the human genome Global variation in copy number in the human genome Redon et. al. Nature 444:444-454 (2006) 12.03.2007 Tarmo Puurand Study 270 individuals (HapMap collection) Affymetrix 500K Whole Genome TilePath (WGTP)

More information

CNV Detection and Interpretation in Genomic Data

CNV Detection and Interpretation in Genomic Data CNV Detection and Interpretation in Genomic Data Benjamin W. Darbro, M.D., Ph.D. Assistant Professor of Pediatrics Director of the Shivanand R. Patil Cytogenetics and Molecular Laboratory Overview What

More information

Structural Variation and Medical Genomics

Structural Variation and Medical Genomics Structural Variation and Medical Genomics Andrew King Department of Biomedical Informatics July 8, 2014 You already know about small scale genetic mutations Single nucleotide polymorphism (SNPs) Deletions,

More information

Computational Systems Biology: Biology X

Computational Systems Biology: Biology X Bud Mishra Room 1002, 715 Broadway, Courant Institute, NYU, New York, USA L#4:(October-0-4-2010) Cancer and Signals 1 2 1 2 Evidence in Favor Somatic mutations, Aneuploidy, Copy-number changes and LOH

More information

Introduction to genetic variation. He Zhang Bioinformatics Core Facility 6/22/2016

Introduction to genetic variation. He Zhang Bioinformatics Core Facility 6/22/2016 Introduction to genetic variation He Zhang Bioinformatics Core Facility 6/22/2016 Outline Basic concepts of genetic variation Genetic variation in human populations Variation and genetic disorders Databases

More information

LTA Analysis of HapMap Genotype Data

LTA Analysis of HapMap Genotype Data LTA Analysis of HapMap Genotype Data Introduction. This supplement to Global variation in copy number in the human genome, by Redon et al., describes the details of the LTA analysis used to screen HapMap

More information

The Biology and Genetics of Cells and Organisms The Biology of Cancer

The Biology and Genetics of Cells and Organisms The Biology of Cancer The Biology and Genetics of Cells and Organisms The Biology of Cancer Mendel and Genetics How many distinct genes are present in the genomes of mammals? - 21,000 for human. - Genetic information is carried

More information

DETECTING HIGHLY DIFFERENTIATED COPY-NUMBER VARIANTS FROM POOLED POPULATION SEQUENCING

DETECTING HIGHLY DIFFERENTIATED COPY-NUMBER VARIANTS FROM POOLED POPULATION SEQUENCING DETECTING HIGHLY DIFFERENTIATED COPY-NUMBER VARIANTS FROM POOLED POPULATION SEQUENCING DANIEL R. SCHRIDER * Department of Biology and School of Informatics and Computing, Indiana University, 1001 E Third

More information

CNV detection. Introduction and detection in NGS data. G. Demidov 1,2. NGSchool2016. Centre for Genomic Regulation. CNV detection. G.

CNV detection. Introduction and detection in NGS data. G. Demidov 1,2. NGSchool2016. Centre for Genomic Regulation. CNV detection. G. Introduction and detection in NGS data 1,2 1 Genomic and Epigenomic Variation in Disease group, Centre for Genomic Regulation 2 Universitat Pompeu Fabra NGSchool2016 methods: methods Outline methods: methods

More information

Gene copy-number polymorphism in nature

Gene copy-number polymorphism in nature Gene copy-number polymorphism in nature Daniel R. Schrider and Matthew W. Hahn Proc. R. Soc. B 2010 277, 3213-3221 first published online 30 June 2010 doi: 10.1098/rspb.2010.1180 Supplementary data References

More information

Supplementary note: Comparison of deletion variants identified in this study and four earlier studies

Supplementary note: Comparison of deletion variants identified in this study and four earlier studies Supplementary note: Comparison of deletion variants identified in this study and four earlier studies Here we compare the results of this study to potentially overlapping results from four earlier studies

More information

Introduction to Genetics

Introduction to Genetics Introduction to Genetics Table of contents Chromosome DNA Protein synthesis Mutation Genetic disorder Relationship between genes and cancer Genetic testing Technical concern 2 All living organisms consist

More information

Chromosomes and Human Inheritance. Chapter 11

Chromosomes and Human Inheritance. Chapter 11 Chromosomes and Human Inheritance Chapter 11 11.1 Human Chromosomes Human body cells have 23 pairs of homologous chromosomes 22 pairs of autosomes 1 pair of sex chromosomes Autosomes and Sex Chromosomes

More information

Chromosome Structure & Recombination

Chromosome Structure & Recombination Chromosome Structure & Recombination (CHAPTER 8- Brooker Text) April 4 & 9, 2007 BIO 184 Dr. Tom Peavy Genetic variation refers to differences between members of the same species or those of different

More information

Chapter 1 : Genetics 101

Chapter 1 : Genetics 101 Chapter 1 : Genetics 101 Understanding the underlying concepts of human genetics and the role of genes, behavior, and the environment will be important to appropriately collecting and applying genetic

More information

George R. Honig Junius G. Adams III. Human Hemoglobin. Genetics. Springer-Verlag Wien New York

George R. Honig Junius G. Adams III. Human Hemoglobin. Genetics. Springer-Verlag Wien New York George R. Honig Junius G. Adams III Human Hemoglobin Genetics Springer-Verlag Wien New York George R. Honig, M.D., Ph.D. Professor and Head Department of Pediatrics, College of Medicine University of Illinois

More information

Figure 1: Transmission of Wing Shape & Body Color Alleles: F0 Mating. Figure 1.1: Transmission of Wing Shape & Body Color Alleles: Expected F1 Outcome

Figure 1: Transmission of Wing Shape & Body Color Alleles: F0 Mating. Figure 1.1: Transmission of Wing Shape & Body Color Alleles: Expected F1 Outcome I. Chromosomal Theory of Inheritance As early cytologists worked out the mechanism of cell division in the late 1800 s, they began to notice similarities in the behavior of BOTH chromosomes & Mendel s

More information

SEX. Genetic Variation: The genetic substrate for natural selection. Sex: Sources of Genotypic Variation. Genetic Variation

SEX. Genetic Variation: The genetic substrate for natural selection. Sex: Sources of Genotypic Variation. Genetic Variation Genetic Variation: The genetic substrate for natural selection Sex: Sources of Genotypic Variation Dr. Carol E. Lee, University of Wisconsin Genetic Variation If there is no genetic variation, neither

More information

Introduction to Cancer Biology

Introduction to Cancer Biology Introduction to Cancer Biology Robin Hesketh Multiple choice questions (choose the one correct answer from the five choices) Which ONE of the following is a tumour suppressor? a. AKT b. APC c. BCL2 d.

More information

A gene is a sequence of DNA that resides at a particular site on a chromosome the locus (plural loci). Genetic linkage of genes on a single

A gene is a sequence of DNA that resides at a particular site on a chromosome the locus (plural loci). Genetic linkage of genes on a single 8.3 A gene is a sequence of DNA that resides at a particular site on a chromosome the locus (plural loci). Genetic linkage of genes on a single chromosome can alter their pattern of inheritance from those

More information

Nature Biotechnology: doi: /nbt.1904

Nature Biotechnology: doi: /nbt.1904 Supplementary Information Comparison between assembly-based SV calls and array CGH results Genome-wide array assessment of copy number changes, such as array comparative genomic hybridization (acgh), is

More information

22q11.2 DELETION SYNDROME. Anna Mª Cueto González Clinical Geneticist Programa de Medicina Molecular y Genética Hospital Vall d Hebrón (Barcelona)

22q11.2 DELETION SYNDROME. Anna Mª Cueto González Clinical Geneticist Programa de Medicina Molecular y Genética Hospital Vall d Hebrón (Barcelona) 22q11.2 DELETION SYNDROME Anna Mª Cueto González Clinical Geneticist Programa de Medicina Molecular y Genética Hospital Vall d Hebrón (Barcelona) Genomic disorders GENOMICS DISORDERS refers to those diseases

More information

Chromothripsis: A New Mechanism For Tumorigenesis? i Fellow s Conference Cheryl Carlson 6/10/2011

Chromothripsis: A New Mechanism For Tumorigenesis? i Fellow s Conference Cheryl Carlson 6/10/2011 Chromothripsis: A New Mechanism For Tumorigenesis? i Fellow s Conference Cheryl Carlson 6/10/2011 Massive Genomic Rearrangement Acquired in a Single Catastrophic Event during Cancer Development Cell 144,

More information

Introduction retroposon

Introduction retroposon 17.1 - Introduction A retrovirus is an RNA virus able to convert its sequence into DNA by reverse transcription A retroposon (retrotransposon) is a transposon that mobilizes via an RNA form; the DNA element

More information

Supplementary Information. Supplementary Figures

Supplementary Information. Supplementary Figures Supplementary Information Supplementary Figures.8 57 essential gene density 2 1.5 LTR insert frequency diversity DEL.5 DUP.5 INV.5 TRA 1 2 3 4 5 1 2 3 4 1 2 Supplementary Figure 1. Locations and minor

More information

Variations in Chromosome Structure & Function. Ch. 8

Variations in Chromosome Structure & Function. Ch. 8 Variations in Chromosome Structure & Function Ch. 8 1 INTRODUCTION! Genetic variation refers to differences between members of the same species or those of different species Allelic variations are due

More information

DOES THE BRCAX GENE EXIST? FUTURE OUTLOOK

DOES THE BRCAX GENE EXIST? FUTURE OUTLOOK CHAPTER 6 DOES THE BRCAX GENE EXIST? FUTURE OUTLOOK Genetic research aimed at the identification of new breast cancer susceptibility genes is at an interesting crossroad. On the one hand, the existence

More information

Lecture 17: Human Genetics. I. Types of Genetic Disorders. A. Single gene disorders

Lecture 17: Human Genetics. I. Types of Genetic Disorders. A. Single gene disorders Lecture 17: Human Genetics I. Types of Genetic Disorders A. Single gene disorders B. Multifactorial traits 1. Mutant alleles at several loci acting in concert C. Chromosomal abnormalities 1. Physical changes

More information

Mutational and selective effects on copy-number variants in the human genome

Mutational and selective effects on copy-number variants in the human genome Mutational and selective effects on copy-number variants in the human genome Gregory M Cooper, Deborah A Nickerson & Evan E Eichler Comprehensive descriptions of large insertion/deletion or segmental duplication

More information

Alternative splicing. Biosciences 741: Genomics Fall, 2013 Week 6

Alternative splicing. Biosciences 741: Genomics Fall, 2013 Week 6 Alternative splicing Biosciences 741: Genomics Fall, 2013 Week 6 Function(s) of RNA splicing Splicing of introns must be completed before nuclear RNAs can be exported to the cytoplasm. This led to early

More information

Ch. 18 Regulation of Gene Expression

Ch. 18 Regulation of Gene Expression Ch. 18 Regulation of Gene Expression 1 Human genome has around 23,688 genes (Scientific American 2/2006) Essential Questions: How is transcription regulated? How are genes expressed? 2 Bacteria regulate

More information

GENOME-WIDE ASSOCIATION STUDIES

GENOME-WIDE ASSOCIATION STUDIES GENOME-WIDE ASSOCIATION STUDIES SUCCESSES AND PITFALLS IBT 2012 Human Genetics & Molecular Medicine Zané Lombard IDENTIFYING DISEASE GENES??? Nature, 15 Feb 2001 Science, 16 Feb 2001 IDENTIFYING DISEASE

More information

CURRENT GENETIC TESTING TOOLS IN NEONATAL MEDICINE. Dr. Bahar Naghavi

CURRENT GENETIC TESTING TOOLS IN NEONATAL MEDICINE. Dr. Bahar Naghavi 2 CURRENT GENETIC TESTING TOOLS IN NEONATAL MEDICINE Dr. Bahar Naghavi Assistant professor of Basic Science Department, Shahid Beheshti University of Medical Sciences, Tehran,Iran 3 Introduction Over 4000

More information

Prentice Hall. Biology: Concepts and Connections, 6th Edition (Campbell, et al) High School

Prentice Hall. Biology: Concepts and Connections, 6th Edition (Campbell, et al) High School Prentice Hall Biology: Concepts and Connections, 6th Edition (Campbell, et al) 2009 High School C O R R E L A T E D T O Biology I Students should understand that scientific knowledge is gained from observation

More information

All mutations are alterations in the nucleotide sequence of DNA. At the molecular level, we can divide mutations into two categories:

All mutations are alterations in the nucleotide sequence of DNA. At the molecular level, we can divide mutations into two categories: Mutations Accurate DNA replication, transcription, and translation all depend on the reliable pairing of complementary bases. Errors occur, though infrequently, in all three processes least often in DNA

More information

Inflammatory Bowel Disease - Target Initial Survey

Inflammatory Bowel Disease - Target Initial Survey Date: / / This document has been created as input for the upcoming target evaluation meeting with where this initial candidate list will be discussed. After the evaluation meeting Euretos will undertake

More information

MODULE NO.14: Y-Chromosome Testing

MODULE NO.14: Y-Chromosome Testing SUBJECT Paper No. and Title Module No. and Title Module Tag FORENSIC SIENCE PAPER No.13: DNA Forensics MODULE No.21: Y-Chromosome Testing FSC_P13_M21 TABLE OF CONTENTS 1. Learning Outcome 2. Introduction:

More information

Ch. 23 The Evolution of Populations

Ch. 23 The Evolution of Populations Ch. 23 The Evolution of Populations 1 Essential question: Do populations evolve? 2 Mutation and Sexual reproduction produce genetic variation that makes evolution possible What is the smallest unit of

More information

Welcome to the Genetic Code: An Overview of Basic Genetics. October 24, :00pm 3:00pm

Welcome to the Genetic Code: An Overview of Basic Genetics. October 24, :00pm 3:00pm Welcome to the Genetic Code: An Overview of Basic Genetics October 24, 2016 12:00pm 3:00pm Course Schedule 12:00 pm 2:00 pm Principles of Mendelian Genetics Introduction to Genetics of Complex Disease

More information

Chapter 11 Gene Expression

Chapter 11 Gene Expression Chapter 11 Gene Expression 11-1 Control of Gene Expression Gene Expression- the activation of a gene to form a protein -a gene is on or expressed when it is transcribed. -cells do not always need to produce

More information

The Meaning of Genetic Variation

The Meaning of Genetic Variation Activity 2 The Meaning of Genetic Variation Focus: Students investigate variation in the beta globin gene by identifying base changes that do and do not alter function, and by using several CD-ROM-based

More information

CHROMOSOMAL MICROARRAY (CGH+SNP)

CHROMOSOMAL MICROARRAY (CGH+SNP) Chromosome imbalances are a significant cause of developmental delay, mental retardation, autism spectrum disorders, dysmorphic features and/or birth defects. The imbalance of genetic material may be due

More information

Bio 312, Spring 2017 Exam 3 ( 1 ) Name:

Bio 312, Spring 2017 Exam 3 ( 1 ) Name: Bio 312, Spring 2017 Exam 3 ( 1 ) Name: Please write the first letter of your last name in the box; 5 points will be deducted if your name is hard to read or the box does not contain the correct letter.

More information

Exam #2 BSC Fall. NAME_Key correct answers in BOLD FORM A

Exam #2 BSC Fall. NAME_Key correct answers in BOLD FORM A Exam #2 BSC 2011 2004 Fall NAME_Key correct answers in BOLD FORM A Before you begin, please write your name and social security number on the computerized score sheet. Mark in the corresponding bubbles

More information

Genome-Wide Analysis of Copy Number Variations in Normal Population Identified by SNP Arrays

Genome-Wide Analysis of Copy Number Variations in Normal Population Identified by SNP Arrays 54 The Open Biology Journal, 2009, 2, 54-65 Open Access Genome-Wide Analysis of Copy Number Variations in Normal Population Identified by SNP Arrays Jian Wang 1,2, Tsz-Kwong Man 1,3,4, Kwong Kwok Wong

More information

Structural Variants and Susceptibility to Common Human Disorders Dr. Xavier Estivill

Structural Variants and Susceptibility to Common Human Disorders Dr. Xavier Estivill Structural Variants and Susceptibility Genetic Causes of Disease Lab Genes and Disease Program Center for Genomic Regulation (CRG) Barcelona 1 Complex genetic diseases Changes in prevalence (>10 fold)

More information

Agilent s Copy Number Variation (CNV) Portfolio

Agilent s Copy Number Variation (CNV) Portfolio Technical Overview Agilent s Copy Number Variation (CNV) Portfolio Abstract Copy Number Variation (CNV) is now recognized as a prevalent form of structural variation in the genome contributing to human

More information

The Role of Host: Genetic Variation

The Role of Host: Genetic Variation The Role of Host: Genetic Variation Patrick J. Stover, PhD The Janet and Gordon Lankton Professor of Nutrition Director, Division of Nutritional Sciences, Cornell University Dietary Requirements are Complex

More information

Genetics and Genomics in Medicine Chapter 6 Questions

Genetics and Genomics in Medicine Chapter 6 Questions Genetics and Genomics in Medicine Chapter 6 Questions Multiple Choice Questions Question 6.1 With respect to the interconversion between open and condensed chromatin shown below: Which of the directions

More information

Science. Webinar Series. CNVs vs SNPs: 16 July, Participating Experts: Understanding Human Structural Variation in Disease

Science. Webinar Series. CNVs vs SNPs: 16 July, Participating Experts: Understanding Human Structural Variation in Disease Science Webinar Series CNVs vs SNPs: 16 July, 2008 Understanding Human Structural Variation in Disease Brought to you by the Science/AAAS Business Office Participating Experts: Charles Lee, Ph.D. Harvard

More information

Tumor suppressor genes D R. S H O S S E I N I - A S L

Tumor suppressor genes D R. S H O S S E I N I - A S L Tumor suppressor genes 1 D R. S H O S S E I N I - A S L What is a Tumor Suppressor Gene? 2 A tumor suppressor gene is a type of cancer gene that is created by loss-of function mutations. In contrast to

More information

SALSA MLPA KIT P050-B2 CAH

SALSA MLPA KIT P050-B2 CAH SALSA MLPA KIT P050-B2 CAH Lot 0510, 0909, 0408: Compared to lot 0107, extra control fragments have been added at 88, 96, 100 and 105 nt. The 274 nt probe gives a higher signal in lot 0510 compared to

More information

Chapter 11. Chromosomes and Human Inheritance

Chapter 11. Chromosomes and Human Inheritance Chapter 11 Chromosomes and Human Inheritance Human Chromosomes Human body cells have 23 pairs of homologous chromosomes 22 pairs of autosomes 1 pair of sex chromosomes Autosomesand Sex Chromosomes Paired

More information

Muscular Dystrophy. Biol 405 Molecular Medicine

Muscular Dystrophy. Biol 405 Molecular Medicine Muscular Dystrophy Biol 405 Molecular Medicine Duchenne muscular dystrophy Duchenne muscular dystrophy is a neuromuscular disease that occurs in ~ 1/3,500 male births. The disease causes developmental

More information

Identification of regions with common copy-number variations using SNP array

Identification of regions with common copy-number variations using SNP array Identification of regions with common copy-number variations using SNP array Agus Salim Epidemiology and Public Health National University of Singapore Copy Number Variation (CNV) Copy number alteration

More information

Understanding DNA Copy Number Data

Understanding DNA Copy Number Data Understanding DNA Copy Number Data Adam B. Olshen Department of Epidemiology and Biostatistics Helen Diller Family Comprehensive Cancer Center University of California, San Francisco http://cc.ucsf.edu/people/olshena_adam.php

More information

Genetics and Genomics in Medicine Chapter 8 Questions

Genetics and Genomics in Medicine Chapter 8 Questions Genetics and Genomics in Medicine Chapter 8 Questions Linkage Analysis Question Question 8.1 Affected members of the pedigree above have an autosomal dominant disorder, and cytogenetic analyses using conventional

More information

Lecture 20. Disease Genetics

Lecture 20. Disease Genetics Lecture 20. Disease Genetics Michael Schatz April 12 2018 JHU 600.749: Applied Comparative Genomics Part 1: Pre-genome Era Sickle Cell Anaemia Sickle-cell anaemia (SCA) is an abnormality in the oxygen-carrying

More information

Statistical Analysis of Single Nucleotide Polymorphism Microarrays in Cancer Studies

Statistical Analysis of Single Nucleotide Polymorphism Microarrays in Cancer Studies Statistical Analysis of Single Nucleotide Polymorphism Microarrays in Cancer Studies Stanford Biostatistics Workshop Pierre Neuvial with Henrik Bengtsson and Terry Speed Department of Statistics, UC Berkeley

More information

1042SCG Genetics & Evolutionary Biology Semester Summary

1042SCG Genetics & Evolutionary Biology Semester Summary 1042SCG Genetics & Evolutionary Biology Semester Summary Griffith University, Nathan Campus Semester 1, 2014 Topics include: - Mendelian Genetics - Eukaryotic & Prokaryotic Genes - Sex Chromosomes - Variations

More information

Chromosomal Mutations

Chromosomal Mutations Notes 2/17 Chromosomal Mutations A chromosome mutation is an unpredictable change that occurs in a chromosome. These changes are most often brought on by problems that occur during meiosis or by mutagens

More information

Name: PS#: Biol 3301 Midterm 1 Spring 2012

Name: PS#: Biol 3301 Midterm 1 Spring 2012 Name: PS#: Biol 3301 Midterm 1 Spring 2012 Multiple Choice. Circle the single best answer. (4 pts each) 1. Which of the following changes in the DNA sequence of a gene will produce a new allele? a) base

More information

Overview: Conducting the Genetic Orchestra Prokaryotes and eukaryotes alter gene expression in response to their changing environment

Overview: Conducting the Genetic Orchestra Prokaryotes and eukaryotes alter gene expression in response to their changing environment Overview: Conducting the Genetic Orchestra Prokaryotes and eukaryotes alter gene expression in response to their changing environment In multicellular eukaryotes, gene expression regulates development

More information

Introduction. Cancer Biology. Tumor-suppressor genes. Proto-oncogenes. DNA stability genes. Mechanisms of carcinogenesis.

Introduction. Cancer Biology. Tumor-suppressor genes. Proto-oncogenes. DNA stability genes. Mechanisms of carcinogenesis. Cancer Biology Chapter 18 Eric J. Hall., Amato Giaccia, Radiobiology for the Radiologist Introduction Tissue homeostasis depends on the regulated cell division and self-elimination (programmed cell death)

More information

Study the Evolution of the Avian Influenza Virus

Study the Evolution of the Avian Influenza Virus Designing an Algorithm to Study the Evolution of the Avian Influenza Virus Arti Khana Mentor: Takis Benos Rachel Brower-Sinning Department of Computational Biology University of Pittsburgh Overview Introduction

More information

Applications of Chromosomal Microarray Analysis (CMA) in pre- and postnatal Diagnostic: advantages, limitations and concerns

Applications of Chromosomal Microarray Analysis (CMA) in pre- and postnatal Diagnostic: advantages, limitations and concerns Applications of Chromosomal Microarray Analysis (CMA) in pre- and postnatal Diagnostic: advantages, limitations and concerns جواد کریمزاد حق PhD of Medical Genetics آزمايشگاه پاتوبيولوژي و ژنتيك پارسه

More information

Genome Structural Variation

Genome Structural Variation Genome Structural Variation Evan Eichler Howard Hughes Medical Institute University of Washington January 18 th, 2013, Comparative Genomics, Český Krumlov Disclosure: EEE was a member of the Pacific Biosciences

More information

Dr Rick Tearle Senior Applications Specialist, EMEA Complete Genomics Complete Genomics, Inc.

Dr Rick Tearle Senior Applications Specialist, EMEA Complete Genomics Complete Genomics, Inc. Dr Rick Tearle Senior Applications Specialist, EMEA Complete Genomics Topics Overview of Data Processing Pipeline Overview of Data Files 2 DNA Nano-Ball (DNB) Read Structure Genome : acgtacatgcattcacacatgcttagctatctctcgccag

More information

Genome Structural Variation

Genome Structural Variation Genome Structural Variation Evan Eichler Howard Hughes Medical Institute University of Washington January 11 th, 2016, Genomics Workshop, Český Krumlov Genetic Variation Types Sequence Single base-pair

More information

and SNPs: Understanding Human Structural Variation in Disease. My

and SNPs: Understanding Human Structural Variation in Disease. My CNVs vs. SNPs: Understanding Human Structural Variation in Disease [0:00:00] Hello and welcome to today s Science/AAAS live webinar entitled, CNVs and SNPs: Understanding Human Structural Variation in

More information

Ch 4: Mendel and Modern evolutionary theory

Ch 4: Mendel and Modern evolutionary theory Ch 4: Mendel and Modern evolutionary theory 1 Mendelian principles of inheritance Mendel's principles explain how traits are transmitted from generation to generation Background: eight years breeding pea

More information

Genetic Variation Junior Science

Genetic Variation Junior Science 2018 Version Genetic Variation Junior Science http://img.publishthis.com/images/bookmarkimages/2015/05/d/5/c/d5cf017fb4f7e46e1c21b874472ea7d1_bookmarkimage_620x480_xlarge_original_1.jpg Sexual Reproduction

More information

BIOLOGY - CLUTCH CH.15 - CHROMOSOMAL THEORY OF INHERITANCE

BIOLOGY - CLUTCH CH.15 - CHROMOSOMAL THEORY OF INHERITANCE !! www.clutchprep.com Chromosomal theory of inheritance: chromosomes are the carriers of genetic material. Independent Assortment alleles for different characters sort independently of each other during

More information

Thalassemias. Emanuela Veras, M.D. 01/08/2006

Thalassemias. Emanuela Veras, M.D. 01/08/2006 Thalassemias Emanuela Veras, M.D. 01/08/2006 Structure and Function of normal Hemoglobin molecules: 2/3 1/3 β: increases from 6 th week of fetal life to 12 months of age At birth: HbF: 75-90% HbA: 10-25%

More information

Challenges of CGH array testing in children with developmental delay. Dr Sally Davies 17 th September 2014

Challenges of CGH array testing in children with developmental delay. Dr Sally Davies 17 th September 2014 Challenges of CGH array testing in children with developmental delay Dr Sally Davies 17 th September 2014 CGH array What is CGH array? Understanding the test Benefits Results to expect Consent issues Ethical

More information

BIO360 Fall 2013 Quiz 1

BIO360 Fall 2013 Quiz 1 BIO360 Fall 2013 Quiz 1 1. Examine the diagram below. There are two homologous copies of chromosome one and the allele of YFG carried on the light gray chromosome has undergone a loss-of-function mutation.

More information

The Molecular Evolution of Gene Birth and Death. Author: Ann Brokaw AP Biology Teacher Rocky River High School Rocky River, Ohio

The Molecular Evolution of Gene Birth and Death. Author: Ann Brokaw AP Biology Teacher Rocky River High School Rocky River, Ohio The Molecular Evolution of Gene Birth and Death Author: Ann Brokaw AP Biology Teacher Rocky River High School Rocky River, Ohio The Birth and Death of Genes To the student: The following slides provide

More information

JULY 21, Genetics 101: SCN1A. Katie Angione, MS CGC Certified Genetic Counselor CHCO Neurology

JULY 21, Genetics 101: SCN1A. Katie Angione, MS CGC Certified Genetic Counselor CHCO Neurology JULY 21, 2018 Genetics 101: SCN1A Katie Angione, MS CGC Certified Genetic Counselor CHCO Neurology Disclosures: I have no financial interests or relationships to disclose. Objectives 1. Review genetic

More information

Beta Thalassemia Case Study Introduction to Bioinformatics

Beta Thalassemia Case Study Introduction to Bioinformatics Beta Thalassemia Case Study Sami Khuri Department of Computer Science San José State University San José, California, USA sami.khuri@sjsu.edu www.cs.sjsu.edu/faculty/khuri Outline v Hemoglobin v Alpha

More information

1) DNA unzips - hydrogen bonds between base pairs are broken by special enzymes.

1) DNA unzips - hydrogen bonds between base pairs are broken by special enzymes. Biology 12 Cell Cycle To divide, a cell must complete several important tasks: it must grow, during which it performs protein synthesis (G1 phase) replicate its genetic material /DNA (S phase), and physically

More information

Annotation of Chimp Chunk 2-10 Jerome M Molleston 5/4/2009

Annotation of Chimp Chunk 2-10 Jerome M Molleston 5/4/2009 Annotation of Chimp Chunk 2-10 Jerome M Molleston 5/4/2009 1 Abstract A stretch of chimpanzee DNA was annotated using tools including BLAST, BLAT, and Genscan. Analysis of Genscan predicted genes revealed

More information

SNP Array NOTE: THIS IS A SAMPLE REPORT AND MAY NOT REFLECT ACTUAL PATIENT DATA. FORMAT AND/OR CONTENT MAY BE UPDATED PERIODICALLY.

SNP Array NOTE: THIS IS A SAMPLE REPORT AND MAY NOT REFLECT ACTUAL PATIENT DATA. FORMAT AND/OR CONTENT MAY BE UPDATED PERIODICALLY. SAMPLE REPORT SNP Array NOTE: THIS IS A SAMPLE REPORT AND MAY NOT REFLECT ACTUAL PATIENT DATA. FORMAT AND/OR CONTENT MAY BE UPDATED PERIODICALLY. RESULTS SNP Array Copy Number Variations Result: LOSS,

More information

Introduction to Genetics and Genomics

Introduction to Genetics and Genomics 2016 Introduction to enetics and enomics 3. ssociation Studies ggibson.gt@gmail.com http://www.cig.gatech.edu Outline eneral overview of association studies Sample results hree steps to WS: primary scan,

More information

THE GENETICAL THEORY OF NATURAL SELECTION

THE GENETICAL THEORY OF NATURAL SELECTION Chapter 12 THE GENETICAL THEORY OF NATURAL SELECTION Important points to remember about natural selection: 1. Natural selection is not the same as evolution. Evolution requires the origin of variation

More information

Toll-like Receptors (TLRs): Biology, Pathology and Therapeutics

Toll-like Receptors (TLRs): Biology, Pathology and Therapeutics Toll-like Receptors (TLRs): Biology, Pathology and Therapeutics Dr Sarah Sasson SydPATH Registrar 23 rd June 2014 TLRs: Introduction Discovered in 1990s Recognise conserved structures in pathogens Rely

More information

2015 AP Biology Unit #4 Test Cell Communication, Cancer, Heredity and The Cell Cycle Week of 30 November

2015 AP Biology Unit #4 Test Cell Communication, Cancer, Heredity and The Cell Cycle Week of 30 November Class: Date: 2015 AP Biology Unit #4 Test Cell Communication, Cancer, Heredity and The Cell Cycle Week of 30 November Multiple Choice 1 point each Identify the choice that best completes the statement

More information

Chromosomes. Bacterial chromosomes are circular. Most higher organisms have linear chromosomes with a centromere that attaches them to the spindle

Chromosomes. Bacterial chromosomes are circular. Most higher organisms have linear chromosomes with a centromere that attaches them to the spindle 1 Chromosomes Bacterial chromosomes are circular Most higher organisms have linear chromosomes with a centromere that attaches them to the spindle Centromere can be in the center (metacentric), off-center

More information

Variant Classification. Author: Mike Thiesen, Golden Helix, Inc.

Variant Classification. Author: Mike Thiesen, Golden Helix, Inc. Variant Classification Author: Mike Thiesen, Golden Helix, Inc. Overview Sequencing pipelines are able to identify rare variants not found in catalogs such as dbsnp. As a result, variants in these datasets

More information

Chemistry 107 Exam 4 Study Guide

Chemistry 107 Exam 4 Study Guide Chemistry 107 Exam 4 Study Guide Chapter 10 10.1 Recognize that enzyme catalyze reactions by lowering activation energies. Know the definition of a catalyst. Differentiate between absolute, relative and

More information

Phenylketonuria (PKU) the Biochemical Basis. Biol 405 Molecular Medicine

Phenylketonuria (PKU) the Biochemical Basis. Biol 405 Molecular Medicine Phenylketonuria (PKU) the Biochemical Basis Biol 405 Molecular Medicine PKU a history In 1934 Følling identified a clinical condition - imbecillitas phenylpyruvica. Mental retardation associated with this

More information

Chapter 15: The Chromosomal Basis of Inheritance

Chapter 15: The Chromosomal Basis of Inheritance Name Period Chapter 15: The Chromosomal Basis of Inheritance Concept 15.1 Mendelian inheritance has its physical basis in the behavior of chromosomes 1. What is the chromosome theory of inheritance? 2.

More information

The Chromosomal Basis of Inheritance

The Chromosomal Basis of Inheritance The Chromosomal Basis of Inheritance Factors and Genes Mendel s model of inheritance was based on the idea of factors that were independently assorted and segregated into gametes We now know that these

More information

of TERT, MLL4, CCNE1, SENP5, and ROCK1 on tumor development were discussed.

of TERT, MLL4, CCNE1, SENP5, and ROCK1 on tumor development were discussed. Supplementary Note The potential association and implications of HBV integration at known and putative cancer genes of TERT, MLL4, CCNE1, SENP5, and ROCK1 on tumor development were discussed. Human telomerase

More information

Genetics Review. Alleles. The Punnett Square. Genotype and Phenotype. Codominance. Incomplete Dominance

Genetics Review. Alleles. The Punnett Square. Genotype and Phenotype. Codominance. Incomplete Dominance Genetics Review Alleles These two different versions of gene A create a condition known as heterozygous. Only the dominant allele (A) will be expressed. When both chromosomes have identical copies of the

More information

Proteins. Length of protein varies from thousands of amino acids to only a few insulin only 51 amino acids

Proteins. Length of protein varies from thousands of amino acids to only a few insulin only 51 amino acids Proteins Protein carbon, hydrogen, oxygen, nitrogen and often sulphur Length of protein varies from thousands of amino acids to only a few insulin only 51 amino acids During protein synthesis, amino acids

More information

Unit 5 Review Name: Period:

Unit 5 Review Name: Period: Unit 5 Review Name: Period: 1 4 5 6 7 & give an example of the following. Be able to apply their meanings: Homozygous Heterozygous Dominant Recessive Genotype Phenotype Haploid Diploid Sex chromosomes

More information

Genetics 1. Down s syndrome is caused by an extra copy of cshromosome no 21. What percentage of

Genetics 1. Down s syndrome is caused by an extra copy of cshromosome no 21. What percentage of Genetics 1. Down s syndrome is caused by an extra copy of cshromosome no 21. What percentage of offspring produced by an affected mother and a normal father would be affected by this disorder? (2003) 1)

More information

Multiple Copy Number Variations in a Patient with Developmental Delay ASCLS- March 31, 2016

Multiple Copy Number Variations in a Patient with Developmental Delay ASCLS- March 31, 2016 Multiple Copy Number Variations in a Patient with Developmental Delay ASCLS- March 31, 2016 Marwan Tayeh, PhD, FACMG Director, MMGL Molecular Genetics Assistant Professor of Pediatrics Department of Pediatrics

More information

Review. Ageing 2: Cancer! Review: Mutations. Mutations 2/14/11. The Raw Material for Evolution. The Double Edged Sword

Review. Ageing 2: Cancer! Review: Mutations. Mutations 2/14/11. The Raw Material for Evolution. The Double Edged Sword Ageing 2: Cancer! Review: The force of natural selection declines with ageing due to increase in extrinsic mortality (= weakening of natural selection) and reduction in reproduction with age (selection

More information