Population Genetics of Structural Variation Speaker Dr. Don Conrad
|
|
- Mervyn Potter
- 5 years ago
- Views:
Transcription
1 Population Genetics of Structural Variation Dr. Don Conrad Wellcome Trust Sanger Institute Cambridge, UK 1 Overview Ascertainment of CNVs What CNV data is available Humans, chimpanzee, macaque, Drosophila, mouse, rat Population genetic forces: mutation, selection, drift Mutation Processes Rates Recombination/gene conversion Demography/population structure Functional impact of CNVs What are constraints on copy number? Evidence for positive selection Fate of duplicated genes Future challenges/conclusions 2 Available data Human Whole genome surveys in 270 HapMap samples Redon et al., 2006, Nature; McCarroll et al., 2008, Nature Genetics Whole genome survey in 1000 global samples from the HGDP, Jakobsson et al., 2008, Nature Chimpanzee Perry et al., 06 PNAS ; Perry, et al., 08 Genome Research (30 samples) Macaque Lee et al., 08 Genome Research Drosophila Mice Rat Emerson et al., 08 Science, 15 lines of Drosophila Melanogaster Egan et al., 07 Nat Genet Graubert et al., 07 PLoS Genetics Guryev et al., 08 Nat Genet, 14 lines 3 1
2 Ascertainment frequency Power frequency Deletion length (kb) Power to detect a single deletion, as a function of deletion size in HapMap release 16.1c length of deletion (kb) Observed and predicted deletion sizes Conrad et al., (2006) Nature Genetics 4 The forces of population genetics Time The core population genetic forces: Mutation - input of new variation Drift - random change in allele frequency due to sampling Selection - alters the lifetime of mutation (e.g., accelerate the removal or fixation) Key point: all 3 forces are scaled by the population size implications for comparison of CNV patterns across populations and species 5 Mutation-drift-selection balance equency Fre f mutation mutation normal duplication The frequency of an allele at a given point in time results from the balance of the forces of mutation, selection, and drift; mutation adds new copies to the population, while drift and selection can remove them time 6 2
3 Structural variation mutation rates minisatellites Microsatellites CTCT -> CTCTCT Single nucleotide polymorphisms (SNPs) C->A Structural Variation (Deletions, Duplications, Inversions, Translocations) Retroelement insertions Jobling, Hurles, Tyler-Smith, Human Evolutionary Genetics 7 CNV breakpoints - clues to mechanisms Better understanding of mutational mechanisms better mutation models: Predict unobserved pathogenic mutations Power calculations for rare variant studies e.g. combine SNPs, indels and CNVs to maximise power Segmental duplications Density of G-quadraplex Left Flank CNV Right Flank Non-B DNA forming sequences: G-tetraplexes Left Flank CNV Right Flank 8 Mutation rates, cont. NAHR: events per locus/per generation Deletion 2x likely as duplications (D Turner et al., (2008) Nat Genet) Non homologous end joining: <10-7 Fork Stalling and Template Switching (FoSTeS): Rate unknown (Lee and Lupski et al., (2008) Cell) Retroelement insertion: 1 every births; Relative rates: - L1 (6kb): 8.4% - Alu (300bp): 87.2% - HERVK (10kb): 0.5% - SVA (1.6kb): 5% Inter-chromosomal duplication: rate unknown 9 3
4 Mutator alleles Inversion polymorphisms predispose their carrier to further chromosomal rearrangements An inversion is necessary for the CNV to form in some cases: - Sharp et al., (2006) Nat Genet, Visser et al.,.(2005) Am J Hum Genet, Giorda et al., (2007) Hum Mutat, Jobling et al., (1998) Curr Biol In other cases, inversions are enriched in the parents of children with de novo CNVs, but not required for rearrangement: - Gimelli et al., (2003) Hum Mol Genet, Osborne et al., (2001) Nat Genet A Possible mechanisms B centromere Heterologous synapsis Microloop Adapted from AJ Sharp (2008) Hum Mutat inversion telomere Heterologous synapsis Brown et al., (1998) Am J Hum Genet 10 Secondary affects of SV Additional ways in which SV can modulate molecular genetic processes: Large duplications suppress recombination in heterozygous form (Roberts and Broderick (1982) Genetics); Same should be true of large deletions Recombination is restricted between inversions in heterozygous individuals Both of these phenomenon should leave detectable traces in population genetic data a b c Recombination rate (p/kb) Inverted and noninverted Inverted noninverted Physical position (kb) Conrad and Hurles (2007) Nat Genet 11 SNPs and CNVs have similar LD properties C Conrad and Hurles (2007), Nature Genetics McCarroll et al., (2008) Nat Genet 12 4
5 Gene conversion moves variation T A T T Cartoon example of gene conversion between a duplication pair At least 30% of the euchromatic portion of the Y chromosome is contained in palindromic repeats of > 99.9% identity; these repeats also house most of the testis-specific genes on the Y; gene conversion between repeats provides a mechanism for the efficient removal of deleterious variation from the population Palindromes Skaletsky et al., (2003) Nature 13 Size distribution of CNVs >100bp CNV size distributions 2007/2008 Ventor >100 Watson >100 Redon 500K Korbel deletion Kidd deletion Densi ity 2006 Log10(CNV) length) 14 Landscape of CNVs in humans Within an individual appears to be ~10000 variants greater than 50bp in length (Standard array-based platforms are calling CNVs per genome) At the population level: Affymetrix 6.0 (McCarroll et al., 2008 Nat Genet) Synthesis of most CNV studies prior to 2007 Median length of 7.5 kb 1500 CNVs with at least 2 variants in 270 HapMap samples 374 common large CNVs (allele frequency > 5%) in Europeans (CEU) 15 5
6 Population structure and differentiation Conrad and Hurles (2007) Nat Genet CNVs appear quite similar to SNPs in terms of their informativeness for identifying structure, and in terms of their patterns of population differentiation F st for CNPs McCarroll et al., (2008) Nat Genet F st for SNPs 16 Population differentiation V ST =(V T -V S )/V T Vst for 27K BAC clones V ST CNV Genotypes UGT2B17 CCL3L1 Near MAPT Redon et al., 2006 Nature 17 Functional impact of CNVs in humans CNVs explain at least 9-18% of heritable variation in gene expression Suggests that per locus, CNV may affect 5 times as much variation as SNPs Strong prior evidence for an important role of CNV in human traits Stranger et al., (2007) Science 18 6
7 Deletions are deleterious Category CEU deletions YRI deletions Entire HapMap Coding non-synonymous ,449 Coding-synonymous Intron 760 1, ,541 Locus-region ,976 Mrna-utr ,534 NA 3,154 4, ,183 Nonidentical Splice-site Total 4,312 6,470 1,017,246 Additionally, Deletions appear more biased away from genes than duplications (this suggests that some genes in the genome are dosage sensitive) Large deletions appear 3x smaller than large duplications (43kb versus 120kb, Redon et al., 2006) Conrad et al., 2006 Nat Genetics 19 Deletion gene biological process % deletions - % genome Biological process unclassified Nucleoside, nucleotide and nucleic acid metabolism transport Cell proliferation and differentiation Cell cycle apoptosis Amino acid metabolism Development processes Electron transport Cell structure and mobility Intracellular protein traffic Other metabolism Blood circulation and gas exchange Lipid, fatty acid and steroid metabolism Oncogenesis Coenzyme and prosthetic group metabolism Protein targeting and localization Carbohydrate metabolism Muscle contraction Protein metabolism and modification Neuronal activities Cell adhesion Immunity and defense Sensory perception Signal transduction 20 genome % deletions - % g Deletion gene molecular function Molecular function unclassified nucleic acid binding Transcription factor transporter hydrolase Signaling molecule oxidoreductase Membrane traffic protein chaperone Miscellaneous function Isomerase Lyase Extracellular matrix Ligase Select calcium binding protein Synthase and synthetase Cytoskeletal protein Transfer/carrier protein Ion channel Cell junction protein Transferase Phosphatase Select regulatory molecule Cell adhesion molecule kinase Protease Defense/immunity protein Receptor 21 7
8 Mammals share patterns of CNV polymorphism Genes from the same functional categories, and often the same genes, show tolerance to CNV across all mammalian species examined thus far (Human, Chimp, Macaque, Mouse, Rat) The data suggests that this is largely due to neutral forces, not positive/balancing selection Deletions at these loci are probably recessive (i.e no phenotype is observed in heterozygotes) GO categories significantly overrepresented in mouse CNVs Duplications probably have no adverse effect Graubert et al., (2007) PLoS Genetics 22 Dosage sensitivity Change in copy number of a dosage sensitive genes leads to an abnormal phenotype Haploinsufficient genes are those specifically sensitive to deletion Position of a gene in a gene network is a useful predictor of dosage sensitivity Safely duplicated gene Non-duplicated gene Korbel et al., (2008) Current Opinion in Structural Biology 23 Selection in Drosophila 312 CNVs/genome detected in Emerson et al. 1 every 12kb Ratio of duplications:deletions 2.5:1 Estimate fitness impact of duplications (γ < 0 => negative impact on fitness) As a class, most CNVs appear to be neutral or deleterious 24 8
9 Malaria and CNV Two common deletions confer resistance to malaria: Deletions of alpha-globin (results in alpha-thalassemia) Deletion of AE1 cause Southeast Asian Ovalocytosis In both cases, the connection with malaria was made by recognizing that the geographic distribution of the mutation was correlated with rates of endemic malaria Healthy red blood cells Ovalocytic RBCs Wrong et al., (2002) Kidney International 25 The importance of duplicated genes Classic statement of the theory due to Susumu Ohno (Evolution by Gene Duplication, 1970) A newly duplicated gene is freed from functional contraint and can head explore previously forbidden mutations, and potentially gain new functions (neofunctionalization) Homeobox gene clusters evolved by duplication; The duplication is mirrored in the segmented body of Drosophila legs only halteres and legs legs and wings Antennapedia Bithorax 26 The fate of duplicated genes Regulatory elements Transcribed region Full function Dead function New function duplication Phase I nonfunctionalization neofunctionalization subfunctionalization Phase II Force et al., (1999) Genetics 27 9
10 Taming genome complexity SMAvar1 Seg dups SMAvar1 SMAvar2 Seg dups SMAvar2 Schmutz et al., (2005) Nature 28 Conclusions Near complete ascertainment of large, common CNVs in Europeans Only true for events assayable with clone/oligo arrays Extreme heterogeneity in mutation processes and rates LD, demographic properties of CNVs very similar to SNPs CNVs are not marker of choice for demographic inference Evidence for selection on CNVs Mostly purifying selection Interesting ways in which CNVs can achieve functional changes that SNPs cannot Small number of copy number variants confer traits that are critical to our species success and survival
Genomic structural variation
Genomic structural variation Mario Cáceres The new genomic variation DNA sequence differs across individuals much more than researchers had suspected through structural changes A huge amount of structural
More informationGlobal variation in copy number in the human genome
Global variation in copy number in the human genome Redon et. al. Nature 444:444-454 (2006) 12.03.2007 Tarmo Puurand Study 270 individuals (HapMap collection) Affymetrix 500K Whole Genome TilePath (WGTP)
More informationCNV Detection and Interpretation in Genomic Data
CNV Detection and Interpretation in Genomic Data Benjamin W. Darbro, M.D., Ph.D. Assistant Professor of Pediatrics Director of the Shivanand R. Patil Cytogenetics and Molecular Laboratory Overview What
More informationStructural Variation and Medical Genomics
Structural Variation and Medical Genomics Andrew King Department of Biomedical Informatics July 8, 2014 You already know about small scale genetic mutations Single nucleotide polymorphism (SNPs) Deletions,
More informationComputational Systems Biology: Biology X
Bud Mishra Room 1002, 715 Broadway, Courant Institute, NYU, New York, USA L#4:(October-0-4-2010) Cancer and Signals 1 2 1 2 Evidence in Favor Somatic mutations, Aneuploidy, Copy-number changes and LOH
More informationIntroduction to genetic variation. He Zhang Bioinformatics Core Facility 6/22/2016
Introduction to genetic variation He Zhang Bioinformatics Core Facility 6/22/2016 Outline Basic concepts of genetic variation Genetic variation in human populations Variation and genetic disorders Databases
More informationLTA Analysis of HapMap Genotype Data
LTA Analysis of HapMap Genotype Data Introduction. This supplement to Global variation in copy number in the human genome, by Redon et al., describes the details of the LTA analysis used to screen HapMap
More informationThe Biology and Genetics of Cells and Organisms The Biology of Cancer
The Biology and Genetics of Cells and Organisms The Biology of Cancer Mendel and Genetics How many distinct genes are present in the genomes of mammals? - 21,000 for human. - Genetic information is carried
More informationDETECTING HIGHLY DIFFERENTIATED COPY-NUMBER VARIANTS FROM POOLED POPULATION SEQUENCING
DETECTING HIGHLY DIFFERENTIATED COPY-NUMBER VARIANTS FROM POOLED POPULATION SEQUENCING DANIEL R. SCHRIDER * Department of Biology and School of Informatics and Computing, Indiana University, 1001 E Third
More informationCNV detection. Introduction and detection in NGS data. G. Demidov 1,2. NGSchool2016. Centre for Genomic Regulation. CNV detection. G.
Introduction and detection in NGS data 1,2 1 Genomic and Epigenomic Variation in Disease group, Centre for Genomic Regulation 2 Universitat Pompeu Fabra NGSchool2016 methods: methods Outline methods: methods
More informationGene copy-number polymorphism in nature
Gene copy-number polymorphism in nature Daniel R. Schrider and Matthew W. Hahn Proc. R. Soc. B 2010 277, 3213-3221 first published online 30 June 2010 doi: 10.1098/rspb.2010.1180 Supplementary data References
More informationSupplementary note: Comparison of deletion variants identified in this study and four earlier studies
Supplementary note: Comparison of deletion variants identified in this study and four earlier studies Here we compare the results of this study to potentially overlapping results from four earlier studies
More informationIntroduction to Genetics
Introduction to Genetics Table of contents Chromosome DNA Protein synthesis Mutation Genetic disorder Relationship between genes and cancer Genetic testing Technical concern 2 All living organisms consist
More informationChromosomes and Human Inheritance. Chapter 11
Chromosomes and Human Inheritance Chapter 11 11.1 Human Chromosomes Human body cells have 23 pairs of homologous chromosomes 22 pairs of autosomes 1 pair of sex chromosomes Autosomes and Sex Chromosomes
More informationChromosome Structure & Recombination
Chromosome Structure & Recombination (CHAPTER 8- Brooker Text) April 4 & 9, 2007 BIO 184 Dr. Tom Peavy Genetic variation refers to differences between members of the same species or those of different
More informationChapter 1 : Genetics 101
Chapter 1 : Genetics 101 Understanding the underlying concepts of human genetics and the role of genes, behavior, and the environment will be important to appropriately collecting and applying genetic
More informationGeorge R. Honig Junius G. Adams III. Human Hemoglobin. Genetics. Springer-Verlag Wien New York
George R. Honig Junius G. Adams III Human Hemoglobin Genetics Springer-Verlag Wien New York George R. Honig, M.D., Ph.D. Professor and Head Department of Pediatrics, College of Medicine University of Illinois
More informationFigure 1: Transmission of Wing Shape & Body Color Alleles: F0 Mating. Figure 1.1: Transmission of Wing Shape & Body Color Alleles: Expected F1 Outcome
I. Chromosomal Theory of Inheritance As early cytologists worked out the mechanism of cell division in the late 1800 s, they began to notice similarities in the behavior of BOTH chromosomes & Mendel s
More informationSEX. Genetic Variation: The genetic substrate for natural selection. Sex: Sources of Genotypic Variation. Genetic Variation
Genetic Variation: The genetic substrate for natural selection Sex: Sources of Genotypic Variation Dr. Carol E. Lee, University of Wisconsin Genetic Variation If there is no genetic variation, neither
More informationIntroduction to Cancer Biology
Introduction to Cancer Biology Robin Hesketh Multiple choice questions (choose the one correct answer from the five choices) Which ONE of the following is a tumour suppressor? a. AKT b. APC c. BCL2 d.
More informationA gene is a sequence of DNA that resides at a particular site on a chromosome the locus (plural loci). Genetic linkage of genes on a single
8.3 A gene is a sequence of DNA that resides at a particular site on a chromosome the locus (plural loci). Genetic linkage of genes on a single chromosome can alter their pattern of inheritance from those
More informationNature Biotechnology: doi: /nbt.1904
Supplementary Information Comparison between assembly-based SV calls and array CGH results Genome-wide array assessment of copy number changes, such as array comparative genomic hybridization (acgh), is
More information22q11.2 DELETION SYNDROME. Anna Mª Cueto González Clinical Geneticist Programa de Medicina Molecular y Genética Hospital Vall d Hebrón (Barcelona)
22q11.2 DELETION SYNDROME Anna Mª Cueto González Clinical Geneticist Programa de Medicina Molecular y Genética Hospital Vall d Hebrón (Barcelona) Genomic disorders GENOMICS DISORDERS refers to those diseases
More informationChromothripsis: A New Mechanism For Tumorigenesis? i Fellow s Conference Cheryl Carlson 6/10/2011
Chromothripsis: A New Mechanism For Tumorigenesis? i Fellow s Conference Cheryl Carlson 6/10/2011 Massive Genomic Rearrangement Acquired in a Single Catastrophic Event during Cancer Development Cell 144,
More informationIntroduction retroposon
17.1 - Introduction A retrovirus is an RNA virus able to convert its sequence into DNA by reverse transcription A retroposon (retrotransposon) is a transposon that mobilizes via an RNA form; the DNA element
More informationSupplementary Information. Supplementary Figures
Supplementary Information Supplementary Figures.8 57 essential gene density 2 1.5 LTR insert frequency diversity DEL.5 DUP.5 INV.5 TRA 1 2 3 4 5 1 2 3 4 1 2 Supplementary Figure 1. Locations and minor
More informationVariations in Chromosome Structure & Function. Ch. 8
Variations in Chromosome Structure & Function Ch. 8 1 INTRODUCTION! Genetic variation refers to differences between members of the same species or those of different species Allelic variations are due
More informationDOES THE BRCAX GENE EXIST? FUTURE OUTLOOK
CHAPTER 6 DOES THE BRCAX GENE EXIST? FUTURE OUTLOOK Genetic research aimed at the identification of new breast cancer susceptibility genes is at an interesting crossroad. On the one hand, the existence
More informationLecture 17: Human Genetics. I. Types of Genetic Disorders. A. Single gene disorders
Lecture 17: Human Genetics I. Types of Genetic Disorders A. Single gene disorders B. Multifactorial traits 1. Mutant alleles at several loci acting in concert C. Chromosomal abnormalities 1. Physical changes
More informationMutational and selective effects on copy-number variants in the human genome
Mutational and selective effects on copy-number variants in the human genome Gregory M Cooper, Deborah A Nickerson & Evan E Eichler Comprehensive descriptions of large insertion/deletion or segmental duplication
More informationAlternative splicing. Biosciences 741: Genomics Fall, 2013 Week 6
Alternative splicing Biosciences 741: Genomics Fall, 2013 Week 6 Function(s) of RNA splicing Splicing of introns must be completed before nuclear RNAs can be exported to the cytoplasm. This led to early
More informationCh. 18 Regulation of Gene Expression
Ch. 18 Regulation of Gene Expression 1 Human genome has around 23,688 genes (Scientific American 2/2006) Essential Questions: How is transcription regulated? How are genes expressed? 2 Bacteria regulate
More informationGENOME-WIDE ASSOCIATION STUDIES
GENOME-WIDE ASSOCIATION STUDIES SUCCESSES AND PITFALLS IBT 2012 Human Genetics & Molecular Medicine Zané Lombard IDENTIFYING DISEASE GENES??? Nature, 15 Feb 2001 Science, 16 Feb 2001 IDENTIFYING DISEASE
More informationCURRENT GENETIC TESTING TOOLS IN NEONATAL MEDICINE. Dr. Bahar Naghavi
2 CURRENT GENETIC TESTING TOOLS IN NEONATAL MEDICINE Dr. Bahar Naghavi Assistant professor of Basic Science Department, Shahid Beheshti University of Medical Sciences, Tehran,Iran 3 Introduction Over 4000
More informationPrentice Hall. Biology: Concepts and Connections, 6th Edition (Campbell, et al) High School
Prentice Hall Biology: Concepts and Connections, 6th Edition (Campbell, et al) 2009 High School C O R R E L A T E D T O Biology I Students should understand that scientific knowledge is gained from observation
More informationAll mutations are alterations in the nucleotide sequence of DNA. At the molecular level, we can divide mutations into two categories:
Mutations Accurate DNA replication, transcription, and translation all depend on the reliable pairing of complementary bases. Errors occur, though infrequently, in all three processes least often in DNA
More informationInflammatory Bowel Disease - Target Initial Survey
Date: / / This document has been created as input for the upcoming target evaluation meeting with where this initial candidate list will be discussed. After the evaluation meeting Euretos will undertake
More informationMODULE NO.14: Y-Chromosome Testing
SUBJECT Paper No. and Title Module No. and Title Module Tag FORENSIC SIENCE PAPER No.13: DNA Forensics MODULE No.21: Y-Chromosome Testing FSC_P13_M21 TABLE OF CONTENTS 1. Learning Outcome 2. Introduction:
More informationCh. 23 The Evolution of Populations
Ch. 23 The Evolution of Populations 1 Essential question: Do populations evolve? 2 Mutation and Sexual reproduction produce genetic variation that makes evolution possible What is the smallest unit of
More informationWelcome to the Genetic Code: An Overview of Basic Genetics. October 24, :00pm 3:00pm
Welcome to the Genetic Code: An Overview of Basic Genetics October 24, 2016 12:00pm 3:00pm Course Schedule 12:00 pm 2:00 pm Principles of Mendelian Genetics Introduction to Genetics of Complex Disease
More informationChapter 11 Gene Expression
Chapter 11 Gene Expression 11-1 Control of Gene Expression Gene Expression- the activation of a gene to form a protein -a gene is on or expressed when it is transcribed. -cells do not always need to produce
More informationThe Meaning of Genetic Variation
Activity 2 The Meaning of Genetic Variation Focus: Students investigate variation in the beta globin gene by identifying base changes that do and do not alter function, and by using several CD-ROM-based
More informationCHROMOSOMAL MICROARRAY (CGH+SNP)
Chromosome imbalances are a significant cause of developmental delay, mental retardation, autism spectrum disorders, dysmorphic features and/or birth defects. The imbalance of genetic material may be due
More informationBio 312, Spring 2017 Exam 3 ( 1 ) Name:
Bio 312, Spring 2017 Exam 3 ( 1 ) Name: Please write the first letter of your last name in the box; 5 points will be deducted if your name is hard to read or the box does not contain the correct letter.
More informationExam #2 BSC Fall. NAME_Key correct answers in BOLD FORM A
Exam #2 BSC 2011 2004 Fall NAME_Key correct answers in BOLD FORM A Before you begin, please write your name and social security number on the computerized score sheet. Mark in the corresponding bubbles
More informationGenome-Wide Analysis of Copy Number Variations in Normal Population Identified by SNP Arrays
54 The Open Biology Journal, 2009, 2, 54-65 Open Access Genome-Wide Analysis of Copy Number Variations in Normal Population Identified by SNP Arrays Jian Wang 1,2, Tsz-Kwong Man 1,3,4, Kwong Kwok Wong
More informationStructural Variants and Susceptibility to Common Human Disorders Dr. Xavier Estivill
Structural Variants and Susceptibility Genetic Causes of Disease Lab Genes and Disease Program Center for Genomic Regulation (CRG) Barcelona 1 Complex genetic diseases Changes in prevalence (>10 fold)
More informationAgilent s Copy Number Variation (CNV) Portfolio
Technical Overview Agilent s Copy Number Variation (CNV) Portfolio Abstract Copy Number Variation (CNV) is now recognized as a prevalent form of structural variation in the genome contributing to human
More informationThe Role of Host: Genetic Variation
The Role of Host: Genetic Variation Patrick J. Stover, PhD The Janet and Gordon Lankton Professor of Nutrition Director, Division of Nutritional Sciences, Cornell University Dietary Requirements are Complex
More informationGenetics and Genomics in Medicine Chapter 6 Questions
Genetics and Genomics in Medicine Chapter 6 Questions Multiple Choice Questions Question 6.1 With respect to the interconversion between open and condensed chromatin shown below: Which of the directions
More informationScience. Webinar Series. CNVs vs SNPs: 16 July, Participating Experts: Understanding Human Structural Variation in Disease
Science Webinar Series CNVs vs SNPs: 16 July, 2008 Understanding Human Structural Variation in Disease Brought to you by the Science/AAAS Business Office Participating Experts: Charles Lee, Ph.D. Harvard
More informationTumor suppressor genes D R. S H O S S E I N I - A S L
Tumor suppressor genes 1 D R. S H O S S E I N I - A S L What is a Tumor Suppressor Gene? 2 A tumor suppressor gene is a type of cancer gene that is created by loss-of function mutations. In contrast to
More informationSALSA MLPA KIT P050-B2 CAH
SALSA MLPA KIT P050-B2 CAH Lot 0510, 0909, 0408: Compared to lot 0107, extra control fragments have been added at 88, 96, 100 and 105 nt. The 274 nt probe gives a higher signal in lot 0510 compared to
More informationChapter 11. Chromosomes and Human Inheritance
Chapter 11 Chromosomes and Human Inheritance Human Chromosomes Human body cells have 23 pairs of homologous chromosomes 22 pairs of autosomes 1 pair of sex chromosomes Autosomesand Sex Chromosomes Paired
More informationMuscular Dystrophy. Biol 405 Molecular Medicine
Muscular Dystrophy Biol 405 Molecular Medicine Duchenne muscular dystrophy Duchenne muscular dystrophy is a neuromuscular disease that occurs in ~ 1/3,500 male births. The disease causes developmental
More informationIdentification of regions with common copy-number variations using SNP array
Identification of regions with common copy-number variations using SNP array Agus Salim Epidemiology and Public Health National University of Singapore Copy Number Variation (CNV) Copy number alteration
More informationUnderstanding DNA Copy Number Data
Understanding DNA Copy Number Data Adam B. Olshen Department of Epidemiology and Biostatistics Helen Diller Family Comprehensive Cancer Center University of California, San Francisco http://cc.ucsf.edu/people/olshena_adam.php
More informationGenetics and Genomics in Medicine Chapter 8 Questions
Genetics and Genomics in Medicine Chapter 8 Questions Linkage Analysis Question Question 8.1 Affected members of the pedigree above have an autosomal dominant disorder, and cytogenetic analyses using conventional
More informationLecture 20. Disease Genetics
Lecture 20. Disease Genetics Michael Schatz April 12 2018 JHU 600.749: Applied Comparative Genomics Part 1: Pre-genome Era Sickle Cell Anaemia Sickle-cell anaemia (SCA) is an abnormality in the oxygen-carrying
More informationStatistical Analysis of Single Nucleotide Polymorphism Microarrays in Cancer Studies
Statistical Analysis of Single Nucleotide Polymorphism Microarrays in Cancer Studies Stanford Biostatistics Workshop Pierre Neuvial with Henrik Bengtsson and Terry Speed Department of Statistics, UC Berkeley
More information1042SCG Genetics & Evolutionary Biology Semester Summary
1042SCG Genetics & Evolutionary Biology Semester Summary Griffith University, Nathan Campus Semester 1, 2014 Topics include: - Mendelian Genetics - Eukaryotic & Prokaryotic Genes - Sex Chromosomes - Variations
More informationChromosomal Mutations
Notes 2/17 Chromosomal Mutations A chromosome mutation is an unpredictable change that occurs in a chromosome. These changes are most often brought on by problems that occur during meiosis or by mutagens
More informationName: PS#: Biol 3301 Midterm 1 Spring 2012
Name: PS#: Biol 3301 Midterm 1 Spring 2012 Multiple Choice. Circle the single best answer. (4 pts each) 1. Which of the following changes in the DNA sequence of a gene will produce a new allele? a) base
More informationOverview: Conducting the Genetic Orchestra Prokaryotes and eukaryotes alter gene expression in response to their changing environment
Overview: Conducting the Genetic Orchestra Prokaryotes and eukaryotes alter gene expression in response to their changing environment In multicellular eukaryotes, gene expression regulates development
More informationIntroduction. Cancer Biology. Tumor-suppressor genes. Proto-oncogenes. DNA stability genes. Mechanisms of carcinogenesis.
Cancer Biology Chapter 18 Eric J. Hall., Amato Giaccia, Radiobiology for the Radiologist Introduction Tissue homeostasis depends on the regulated cell division and self-elimination (programmed cell death)
More informationStudy the Evolution of the Avian Influenza Virus
Designing an Algorithm to Study the Evolution of the Avian Influenza Virus Arti Khana Mentor: Takis Benos Rachel Brower-Sinning Department of Computational Biology University of Pittsburgh Overview Introduction
More informationApplications of Chromosomal Microarray Analysis (CMA) in pre- and postnatal Diagnostic: advantages, limitations and concerns
Applications of Chromosomal Microarray Analysis (CMA) in pre- and postnatal Diagnostic: advantages, limitations and concerns جواد کریمزاد حق PhD of Medical Genetics آزمايشگاه پاتوبيولوژي و ژنتيك پارسه
More informationGenome Structural Variation
Genome Structural Variation Evan Eichler Howard Hughes Medical Institute University of Washington January 18 th, 2013, Comparative Genomics, Český Krumlov Disclosure: EEE was a member of the Pacific Biosciences
More informationDr Rick Tearle Senior Applications Specialist, EMEA Complete Genomics Complete Genomics, Inc.
Dr Rick Tearle Senior Applications Specialist, EMEA Complete Genomics Topics Overview of Data Processing Pipeline Overview of Data Files 2 DNA Nano-Ball (DNB) Read Structure Genome : acgtacatgcattcacacatgcttagctatctctcgccag
More informationGenome Structural Variation
Genome Structural Variation Evan Eichler Howard Hughes Medical Institute University of Washington January 11 th, 2016, Genomics Workshop, Český Krumlov Genetic Variation Types Sequence Single base-pair
More informationand SNPs: Understanding Human Structural Variation in Disease. My
CNVs vs. SNPs: Understanding Human Structural Variation in Disease [0:00:00] Hello and welcome to today s Science/AAAS live webinar entitled, CNVs and SNPs: Understanding Human Structural Variation in
More informationCh 4: Mendel and Modern evolutionary theory
Ch 4: Mendel and Modern evolutionary theory 1 Mendelian principles of inheritance Mendel's principles explain how traits are transmitted from generation to generation Background: eight years breeding pea
More informationGenetic Variation Junior Science
2018 Version Genetic Variation Junior Science http://img.publishthis.com/images/bookmarkimages/2015/05/d/5/c/d5cf017fb4f7e46e1c21b874472ea7d1_bookmarkimage_620x480_xlarge_original_1.jpg Sexual Reproduction
More informationBIOLOGY - CLUTCH CH.15 - CHROMOSOMAL THEORY OF INHERITANCE
!! www.clutchprep.com Chromosomal theory of inheritance: chromosomes are the carriers of genetic material. Independent Assortment alleles for different characters sort independently of each other during
More informationThalassemias. Emanuela Veras, M.D. 01/08/2006
Thalassemias Emanuela Veras, M.D. 01/08/2006 Structure and Function of normal Hemoglobin molecules: 2/3 1/3 β: increases from 6 th week of fetal life to 12 months of age At birth: HbF: 75-90% HbA: 10-25%
More informationChallenges of CGH array testing in children with developmental delay. Dr Sally Davies 17 th September 2014
Challenges of CGH array testing in children with developmental delay Dr Sally Davies 17 th September 2014 CGH array What is CGH array? Understanding the test Benefits Results to expect Consent issues Ethical
More informationBIO360 Fall 2013 Quiz 1
BIO360 Fall 2013 Quiz 1 1. Examine the diagram below. There are two homologous copies of chromosome one and the allele of YFG carried on the light gray chromosome has undergone a loss-of-function mutation.
More informationThe Molecular Evolution of Gene Birth and Death. Author: Ann Brokaw AP Biology Teacher Rocky River High School Rocky River, Ohio
The Molecular Evolution of Gene Birth and Death Author: Ann Brokaw AP Biology Teacher Rocky River High School Rocky River, Ohio The Birth and Death of Genes To the student: The following slides provide
More informationJULY 21, Genetics 101: SCN1A. Katie Angione, MS CGC Certified Genetic Counselor CHCO Neurology
JULY 21, 2018 Genetics 101: SCN1A Katie Angione, MS CGC Certified Genetic Counselor CHCO Neurology Disclosures: I have no financial interests or relationships to disclose. Objectives 1. Review genetic
More informationBeta Thalassemia Case Study Introduction to Bioinformatics
Beta Thalassemia Case Study Sami Khuri Department of Computer Science San José State University San José, California, USA sami.khuri@sjsu.edu www.cs.sjsu.edu/faculty/khuri Outline v Hemoglobin v Alpha
More information1) DNA unzips - hydrogen bonds between base pairs are broken by special enzymes.
Biology 12 Cell Cycle To divide, a cell must complete several important tasks: it must grow, during which it performs protein synthesis (G1 phase) replicate its genetic material /DNA (S phase), and physically
More informationAnnotation of Chimp Chunk 2-10 Jerome M Molleston 5/4/2009
Annotation of Chimp Chunk 2-10 Jerome M Molleston 5/4/2009 1 Abstract A stretch of chimpanzee DNA was annotated using tools including BLAST, BLAT, and Genscan. Analysis of Genscan predicted genes revealed
More informationSNP Array NOTE: THIS IS A SAMPLE REPORT AND MAY NOT REFLECT ACTUAL PATIENT DATA. FORMAT AND/OR CONTENT MAY BE UPDATED PERIODICALLY.
SAMPLE REPORT SNP Array NOTE: THIS IS A SAMPLE REPORT AND MAY NOT REFLECT ACTUAL PATIENT DATA. FORMAT AND/OR CONTENT MAY BE UPDATED PERIODICALLY. RESULTS SNP Array Copy Number Variations Result: LOSS,
More informationIntroduction to Genetics and Genomics
2016 Introduction to enetics and enomics 3. ssociation Studies ggibson.gt@gmail.com http://www.cig.gatech.edu Outline eneral overview of association studies Sample results hree steps to WS: primary scan,
More informationTHE GENETICAL THEORY OF NATURAL SELECTION
Chapter 12 THE GENETICAL THEORY OF NATURAL SELECTION Important points to remember about natural selection: 1. Natural selection is not the same as evolution. Evolution requires the origin of variation
More informationToll-like Receptors (TLRs): Biology, Pathology and Therapeutics
Toll-like Receptors (TLRs): Biology, Pathology and Therapeutics Dr Sarah Sasson SydPATH Registrar 23 rd June 2014 TLRs: Introduction Discovered in 1990s Recognise conserved structures in pathogens Rely
More information2015 AP Biology Unit #4 Test Cell Communication, Cancer, Heredity and The Cell Cycle Week of 30 November
Class: Date: 2015 AP Biology Unit #4 Test Cell Communication, Cancer, Heredity and The Cell Cycle Week of 30 November Multiple Choice 1 point each Identify the choice that best completes the statement
More informationChromosomes. Bacterial chromosomes are circular. Most higher organisms have linear chromosomes with a centromere that attaches them to the spindle
1 Chromosomes Bacterial chromosomes are circular Most higher organisms have linear chromosomes with a centromere that attaches them to the spindle Centromere can be in the center (metacentric), off-center
More informationVariant Classification. Author: Mike Thiesen, Golden Helix, Inc.
Variant Classification Author: Mike Thiesen, Golden Helix, Inc. Overview Sequencing pipelines are able to identify rare variants not found in catalogs such as dbsnp. As a result, variants in these datasets
More informationChemistry 107 Exam 4 Study Guide
Chemistry 107 Exam 4 Study Guide Chapter 10 10.1 Recognize that enzyme catalyze reactions by lowering activation energies. Know the definition of a catalyst. Differentiate between absolute, relative and
More informationPhenylketonuria (PKU) the Biochemical Basis. Biol 405 Molecular Medicine
Phenylketonuria (PKU) the Biochemical Basis Biol 405 Molecular Medicine PKU a history In 1934 Følling identified a clinical condition - imbecillitas phenylpyruvica. Mental retardation associated with this
More informationChapter 15: The Chromosomal Basis of Inheritance
Name Period Chapter 15: The Chromosomal Basis of Inheritance Concept 15.1 Mendelian inheritance has its physical basis in the behavior of chromosomes 1. What is the chromosome theory of inheritance? 2.
More informationThe Chromosomal Basis of Inheritance
The Chromosomal Basis of Inheritance Factors and Genes Mendel s model of inheritance was based on the idea of factors that were independently assorted and segregated into gametes We now know that these
More informationof TERT, MLL4, CCNE1, SENP5, and ROCK1 on tumor development were discussed.
Supplementary Note The potential association and implications of HBV integration at known and putative cancer genes of TERT, MLL4, CCNE1, SENP5, and ROCK1 on tumor development were discussed. Human telomerase
More informationGenetics Review. Alleles. The Punnett Square. Genotype and Phenotype. Codominance. Incomplete Dominance
Genetics Review Alleles These two different versions of gene A create a condition known as heterozygous. Only the dominant allele (A) will be expressed. When both chromosomes have identical copies of the
More informationProteins. Length of protein varies from thousands of amino acids to only a few insulin only 51 amino acids
Proteins Protein carbon, hydrogen, oxygen, nitrogen and often sulphur Length of protein varies from thousands of amino acids to only a few insulin only 51 amino acids During protein synthesis, amino acids
More informationUnit 5 Review Name: Period:
Unit 5 Review Name: Period: 1 4 5 6 7 & give an example of the following. Be able to apply their meanings: Homozygous Heterozygous Dominant Recessive Genotype Phenotype Haploid Diploid Sex chromosomes
More informationGenetics 1. Down s syndrome is caused by an extra copy of cshromosome no 21. What percentage of
Genetics 1. Down s syndrome is caused by an extra copy of cshromosome no 21. What percentage of offspring produced by an affected mother and a normal father would be affected by this disorder? (2003) 1)
More informationMultiple Copy Number Variations in a Patient with Developmental Delay ASCLS- March 31, 2016
Multiple Copy Number Variations in a Patient with Developmental Delay ASCLS- March 31, 2016 Marwan Tayeh, PhD, FACMG Director, MMGL Molecular Genetics Assistant Professor of Pediatrics Department of Pediatrics
More informationReview. Ageing 2: Cancer! Review: Mutations. Mutations 2/14/11. The Raw Material for Evolution. The Double Edged Sword
Ageing 2: Cancer! Review: The force of natural selection declines with ageing due to increase in extrinsic mortality (= weakening of natural selection) and reduction in reproduction with age (selection
More information