NextGen Sequencing and Brain Diseases: a Pot Pourri. Guy A. Rouleau, MD, PhD, FRCP(C) University of McGill Montreal Neurological Institute
|
|
- Benjamin Holt
- 6 years ago
- Views:
Transcription
1
2 NextGen Sequencing and Brain Diseases: a Pot Pourri Guy A. Rouleau, MD, PhD, FRCP(C) University of McGill Montreal Neurological Institute
3 Disclamers I have no conflicts of interests in this work I have no financial interests in this work
4 Disclamers I did none of the work
5 Our approach Clinical collection Multicenter collaboration Uniform phenotypic assessment Web based database Sequencing approach depends on genetic architecture Recessive disease Dominant Sporadic Biological validation
6 CanHSP Project Multicenter multidisciplinary project that brings together Canadian experts in the fields of neurology, genetics and molecular biology to study spastic paraplegia Started in spring 2012 Funded for a duration 5 years
7 Steering Committee Kym Boycott, Pierre Drapeau, Guy Rouleau, Oksana Suchowersky Team Coordinator Anna Szuto (Patrick A. Dion) Team Leader Guy A. Rouleau Aim1 Clinical Oksana Suchowersky François Bolduc Jean-Pierre Bouchard Nicolas Dupré Guy Rouleau Grace Yoon Aim2 Genetics Kym Boycott Jillian Parboosingh Peter Ray Guy Rouleau Aim3 Functional Pierre Drapeau François Bolduc Alex Parker Guy Rouleau Christine Vande Velde
8 Goal 1 Clinical characterisation Create a network of clinical experts in spastic paraplegia Create a multicentric and national registry of clinical information associated with a genomic bank (DNA, lymphoblastoid cell lines and fibroblast) of spastic paraplegia cases Familial Cases Sporadic Cases Establish recommendations for patient management Clinical evaluation Molecular screening Treatment
9 Goal 1 Clinical characterisation 1. Determining the patients of interest Sporadic and familial cases of spastic paraplegia, including: Cases of spastic ataxia Cases spastic paraplegia with neuropathy Any case where spastic paraplegia is the primary symptom Any case with a known molecular diagnosis, even if DNA is not available 2. Phenotyping Meeting with the CanHSP team of clinical experts to determine Inclusion / exclusion criteria pertinent clinical findings to characterize Research of pre-existing phenotyping tools: Sickkids HSP clinical data sheet Spastic Paraplegia Rating Scale (SPRS) Diagnostic form for spinocerebellar degeneration (SPATAX network) Create a standardized clinical datasheet Soft launch: Retroactive review of HSP patients charts to test the CanHSP clinical questionnaire Gather and incorporate feedback
10 Clinical datasheet
11
12 Goal 1 Clinical characterisation Collecting and storing the data Secure web-based interface for one common database created by our bioinformatics team. It allows for: Effective way to curate a shared database Simultaneous access Tracking of recruitment Control of access privileges (Entering data, consulting local data, data mining) Efficient way to generate epidemiological data Access to data Each site has access to their own cohort Internal requests for data mining are submitted to the CanHSP clinical team to request access specific data from all sites External requests for data mining will be accepted at the end of the CanHSP project Recruiting sites and external collaborations At the moment, active sites include Montreal, Quebec, Ottawa, Toronto, and Edmonton/Calgary Possibility of inviting external PIs to collaborate to the CanHSP project
13 Web based interface of the CanHSP database
14 Where are we now and future directions: To date: 402 phenotyped patients entered into the CanHSP database Collection of over 182 individuals/families in the genomic bank In the next 4 years: Possibility of extending the network of recruiting sites Creation of a website for physicians and patients
15 Agenesis of Corpus Callosum: anatomically defined condition that results from disruption of the early stages of fetal callosal development Diagnosis: absence of callosal fibers, typically accompanied by a characteristic dilatation of posterior lateral ventricules (colpocephaly) Paul LK et al., 2007
16 Agenesis of Corpus Callosum Heterogeneous condition found usually as one manisfestation of a congenital syndrome and noccosionally as an isolated condition or ACC: between 1/4000 and 1/ to 5% of individuals w/ neurodevelopmental disorders Most frequent clinical findings in patients with ACC: Mental retardation (60%) Visual problemes (33%) Speech delay (29%) Seizures (25%) Feeding problems (20%)
17 Agenesis of Corpus Callosum: examples of syndromes associated with ACC Paul LK et al., 2007
18 Genetics of ACC Many different mechanisms: Mendelian, sporadic, complex Cases with isolated ACC and developmental delay with normal chromosomes have been published with apparent autosomal dominant, autosomal recessive or X-linked modes if inheritance but no causative genes identified to date
19 ACC: CCA1 pedigree - Normal mother and father with 3 affected children - Female 1: ACC confirmed by CT; normal development; IQ of Female 2: ACC by CT and MRI; normal development except for slow acquisition of walking. IQ of Male 3: ACC by MRI, respiratory problems at birth, prolonged enuresis, poor motor coordination and late language acquisition at 5. IQ of 77. I 1 2 I1: R (father unaffected) I2: R (mother unaffected) II1: R (daugther affected) II2: R (daugther affected) II II3: R (son affected) 1 2 3
20 Hypothesis: ACC: CCA1 pedigree recessive: homozygous mutations, compound heterozygous de novo Methodology: Whole-exome sequencing on DNA extracted from patient blood sample Targeted capture: SureSelect v4xt 51MB (Agilent) Sequencing: Illumina HiSeq 2000 v3 (3 individuals/lane) Bioinformatics analysis: sequence reads trimming and QC using FastX, mapping and alignment using BWA In-house data pipeline based on GATK for realignment around indels, duplicates removal and base quality recalibration. GATK also used for SNP/INDEL calling and finally Annovar for variant annotation Segregation: 3 probands Non-family controls: in-house exomes, public databases (Exome Variant server, )
21 Exome sequencing quality obtained per sample name sample info Alignment stats variant stats PED.id capture kit project % target >=10x % target >=20x average calls total calls coverage >=20x S12959 CCA1 V4 ACC 97,8% 93,0% 100, S12960 CCA1 V4 ACC 98,4% 95,1% 126, S12961 CCA1 V4 ACC 98,9% 96,2% 134, Average 98,4% 94,8% 120,
22 Compound heterozygous analysis Average number of variants obtained per patient after successive filtering steps initial number of variants fam aff w/variant (3) non fam CTR w/variant (10/965) public databases (<0.01) variant function variant type several hits in same gene Series
23 Validation step (Sanger sequencing) Eight variants in 4 different genes; ONE gene with compound heterozygous mutations Chr Position Ref Mut Var Gene Variant Type Detailed Annotation Mutation confirmed in: T C SNP CDK5RAP2 nonsyn CDK5RAP2:NM_018249:exon24:c.A3695G:p.N1232S R , R , R , R (Father) C G SNP CDK5RAP2 nonsyn CDK5RAP2:NM_018249:exon4:c.G280C:p.G94R R , R , R , R (Mother) C T SNP ADAMTS14 nonsyn ADAMTS14:NM_080722:exon6:c.C988T:p.R330C R , R , R , R (Father) G A SNP ADAMTS14 nonsyn ADAMTS14:NM_080722:exon21:c.G3097A:p.D1033N R , R , R , R (Father) G C SNP IFIH1 nonsyn IFIH1:NM_022168:exon15:c.C2863G:p.Q955E R , R , R , R (Mother) A C SNP IFIH1 nonsyn IFIH1:NM_022168:exon12:c.T2414G:p.I805S R , R , R , R (Mother) C G SNP OR5K1 nonsyn OR5K1:NM_ :exon1:c.C753G:p.F251L R , R , R , R (Father) G T SNP OR5K1 nonsyn OR5K1:NM_ :exon1:c.G774T:p.M258I R , R , R , R (Father)
24 Segregation analysis of CDK5RAP2 variants CDK5RAP2:NM_ exon24:c.a3695g p.n1232s I 1 2 Wt/N1232S Wt/G94R CDK5RAP2:NM_ exon4:c.g280c p.g94r II Wt/N1232S Wt/G94R Wt/N1232S Wt/G94R Wt/N1232S Wt/G94R I1: R (father unaffected) I2: R (mother unaffected) II1: R (daugther affected) II2: R (daugther affected) II3: R (son affected)
25 Bioinformatic analysis N1232S SIFT: Tolerated Polyphen: possibly damaging G4R SIFT: damaging Polyphen: probably damaging
26 CDK5RAP2= MCPH3 (Autosomal recessive primary microcephaly) MCPH Protein Gene Chromosome Ref. MCPH1 Microcephalin MCPH1 8p23 [28, 29] MCPH2 WD-repeat containing protein 62 WDR62 19q13.12 [30 32] MCPH3 Cyclin dependent kinase 5 regulatory subunit-associated protein 2 CDK5RAP2 9q33.3 [17, 27] MCPH4 MCPH5 MCPH6 Centrosomal protein of 152 kda Abnormal spindlelike, microcephaly associated Centromeric protein J CEP152 15q21.1 [33, 34] ASPM 1q31 [35, 36] CENPJ 13q12.2 [17, 37] MCPH7 SCL/TAL1 interrupting locus STIL 1p32 [38] Kraemer N., 2011 MCPH is a rare autosomal recessive neurodevelopmental disorder reduced brain size and mental retardation The reduced brain size is believed to result from assymmetric division of neuronal progenitor cells, causing reduced number of neurons Only 2 mutations reported in 2 Pakistani microcephaly pedigrees: Y82X and R1334SfsX5
27 CDK5RAP2 Gene Hypothesis that these are hypomorphic alleles that lead to a milder neurodevelopmental disease Need to demonstrate the functional effects of our compound het mutations
28 RNA Stability and Splicing RNA extraction on patients cells, cdna synthesis and sequencing
29 Sequencing results of exons 1 to 6 in cdna from patients lymphoblastoid cells Mutations are detected in patients cdna (G94R)
30 Sequencing results of exons 22 to 25 in cdna from patients lymphoblastoid cells Mutations are detected in patients cdna (N1232S)
31 ACC project: next steps Genetics: We have in the lab: 649 ACC patients (191 affected), however, most have ACCPN with loss of KCC3 function ± 15 cases which are KCC3- but only 3-4 cases that have no major neuropathic symptomes, only colpocephalia Possible collaboration with Dr Sherr for screening of CDK5RAP2 in additional patients with the same phenotype Additional collaboration??? Molecular characterization of the mutations Cell biology and binding experiments based on know protein functions Animal model: rescue experiments in zebrafish
32 Essential Tremor (ET) ET is one of the commonest neurological disorders. It is characterized by postural tremor that worsens with movement. Mainly affects the upper limbs, and less commonly affects the head, voice, face, tongue, trunk and lower limbs. The condition may cause a functional disability or even incapacitation. Thought to involve cerebellar degeneration
33 Genetics of Essential Tremor (ET) Linkage studies identified three loci, but no causative genes Hereditary essential tremor-1 (ETM1) 3q13.3 (1997) 16 Icelandic families Parametric LOD score (assuming an autosomal dominant model) = 3.71 ETM2-2p25-p22 Large American family of Czech descent A maximum lod score of 5.92 was obtained for the locus D2S272. ETM3-6p23. Two unrelated North American families. First family: a maximal nonparametric lod score of 3.28 Second family showed a maximal score of Together, maximal lod score of at D6S1630 and D6S1605 Recently, common LINGO1 variants have been associated with ET but the significance remains unclear.
34 Essential Tremor (ET) Our lab recruited ~80 French Canadian families with ET. Linkage studies have been performed on large families but results are inconclusive. Likely because of diagnostic uncertainties. To overcome the diagnostic barrier we carried out exome sequencing using only individuals with: a definite ET diagnosis An age of onset under 40
35 FET1 family Individuals with a definite diagnosis are represented by symbols filled completely black. Individuals with a probable diagnosis of ET have symbols with a small black square in the bottom left corner. Individuals with a possible diagnosis of ET have symbols with a small black square in the top right corner.
36 FET1 Exome analysis -CCDS bp covered by Aligent exome probe kit = 28,845,296 -Bp covered greater than or equal to 1X = 21,469,388 (74% of Aligent kit) -Bp covered greater than or equal to 20X = 14,145,512 (49% of Aligent kit) -Total number of reads = 26,023,097 -Looked for variants shared by all affected individuals. -Mutation frequency needs to be above the threshold followed for segregation analysis. -This project, 20X coverage and 20% MF ).
37 FET1 Exome analysis Individual FET1 Clinical Status Number of CCDS base pairs actually covered with the A gilent exome probe kit Base pairs covered greater than or equal to 1X Number Percentage in Aligent probe kit Base pairs covered greater than or equal to 20X Number Percentage in Aligent probe kit Number of uniquely mapped reads IV:6 affected 21,357,223 74% 13,577,170 47% 25,563,340 III:9 affected 21,178,474 73% 13,493,797 47% 28,622,732 II:13 affected 28,845,296 21,255,995 74% 13,590,471 47% 26,741,248 II:6 affected 21,653,639 75% 14,417,379 50% 22,655,426 II:5 control 21,901,610 76% 15,648,745 54% 26,532,741 Average - 28,845,296 21,469,388 74% 14,145,512 49% 26,023,097
38 Diagnosis of ET in FET1 and FUS mutation status Diagnosis Under 40 yrs Over 40 yrs Unknown age Total Mutation Carriers Percentage Definite % Probable % Possible % Clinically unaffected %
39 Schematic of ET sequencing variants within the FUS protein
40 ET and ALS truncating FUS mutations In ALS mutations are clustered to nuclear localization signal (NLS) in C-terminal. The mutations may gain an aberrant function or toxic property, or lose a particular function. In ET p.q290x is located in the predicted nuclear export signal (NES) in the middle of the protein. No ALS mutations have been reported in the NES. Likely leads to complete loss of function and no residual fuction Hypothesis: ET results from a LOF while ALS results from a GOF Predicts that ALS truncating mutations, but not ET truncating mutations, should give a protein
41
42 Protein expression of ET and ALS FUS truncating mutants -150 FUS β-tubulin truncated FUS
43 Acknowledgements Rouleau lab : Patrick A Dion Loubna Jouan Nancy Merner Anne Noreau Anna Szuto Alexandre Dionne- Laporte Dan Spiegelman Edouard Henrion Ousmane Diallo Clinical Collaborators: François Bolduc Jean-Pierre Bouchard Kym Boycott Sylvain Chouinard Nicolas Dupre Oksana Suchowersky Grace Yoon
44 Questions?
Identifying Mutations Responsible for Rare Disorders Using New Technologies
Identifying Mutations Responsible for Rare Disorders Using New Technologies Jacek Majewski, Department of Human Genetics, McGill University, Montreal, QC Canada Mendelian Diseases Clear mode of inheritance
More informationCHAPTER IV RESULTS Microcephaly General description
47 CHAPTER IV RESULTS 4.1. Microcephaly 4.1.1. General description This study found that from a previous study of 527 individuals with MR, 48 (23 female and 25 male) unrelated individuals were identified
More informationVariant Detection & Interpretation in a diagnostic context. Christian Gilissen
Variant Detection & Interpretation in a diagnostic context Christian Gilissen c.gilissen@gen.umcn.nl 28-05-2013 So far Sequencing Johan den Dunnen Marja Jakobs Ewart de Bruijn Mapping Victor Guryev Variant
More informationCentoXome FUTURE'S KNOWLEDGE APPLIED TODAY
CentoXome FUTURE'S KNOWLEDGE APPLIED TODAY More genetic information requires cutting-edge interpretation techniques Whole Exome Sequencing For certain patients the combination of symptoms does not allow
More informationCentoXome FUTURE'S KNOWLEDGE APPLIED TODAY
CentoXome FUTURE'S KNOWLEDGE APPLIED TODAY More genetic information requires cutting-edge interpretation techniques Whole Exome Sequencing For some patients, the combination of symptoms does not allow
More informationCITATION FILE CONTENT/FORMAT
CITATION For any resultant publications using please cite: Matthew A. Field, Vicky Cho, T. Daniel Andrews, and Chris C. Goodnow (2015). "Reliably detecting clinically important variants requires both combined
More informationGenome 371, Autumn 2018 Quiz Section 9: Genetics of Cancer Worksheet
Genome 371, Autumn 2018 Quiz Section 9: Genetics of Cancer Worksheet All cancer is due to genetic mutations. However, in cancer that clusters in families (familial cancer) at least one of these mutations
More informationMEDICAL GENOMICS LABORATORY. Next-Gen Sequencing and Deletion/Duplication Analysis of NF1 Only (NF1-NG)
Next-Gen Sequencing and Deletion/Duplication Analysis of NF1 Only (NF1-NG) Ordering Information Acceptable specimen types: Fresh blood sample (3-6 ml EDTA; no time limitations associated with receipt)
More informationLab Activity 36. Principles of Heredity. Portland Community College BI 233
Lab Activity 36 Principles of Heredity Portland Community College BI 233 Terminology of Chromosomes Homologous chromosomes: A pair, of which you get one from mom, and one from dad. Example: the pair of
More informationPedigree Analysis Why do Pedigrees? Goals of Pedigree Analysis Basic Symbols More Symbols Y-Linked Inheritance
Pedigree Analysis Why do Pedigrees? Punnett squares and chi-square tests work well for organisms that have large numbers of offspring and controlled mating, but humans are quite different: Small families.
More informationA. Incorrect! Cells contain the units of genetic they are not the unit of heredity.
MCAT Biology Problem Drill PS07: Mendelian Genetics Question No. 1 of 10 Question 1. The smallest unit of heredity is. Question #01 (A) Cell (B) Gene (C) Chromosome (D) Allele Cells contain the units of
More informationWelcome to the Genetic Code: An Overview of Basic Genetics. October 24, :00pm 3:00pm
Welcome to the Genetic Code: An Overview of Basic Genetics October 24, 2016 12:00pm 3:00pm Course Schedule 12:00 pm 2:00 pm Principles of Mendelian Genetics Introduction to Genetics of Complex Disease
More informationNon-Mendelian inheritance
Non-Mendelian inheritance Focus on Human Disorders Peter K. Rogan, Ph.D. Laboratory of Human Molecular Genetics Children s Mercy Hospital Schools of Medicine & Computer Science and Engineering University
More informationPedigree Analysis. A = the trait (a genetic disease or abnormality, dominant) a = normal (recessive)
Pedigree Analysis Introduction A pedigree is a diagram of family relationships that uses symbols to represent people and lines to represent genetic relationships. These diagrams make it easier to visualize
More informationMutation Detection and CNV Analysis for Illumina Sequencing data from HaloPlex Target Enrichment Panels using NextGENe Software for Clinical Research
Mutation Detection and CNV Analysis for Illumina Sequencing data from HaloPlex Target Enrichment Panels using NextGENe Software for Clinical Research Application Note Authors John McGuigan, Megan Manion,
More informationInvestigating rare diseases with Agilent NGS solutions
Investigating rare diseases with Agilent NGS solutions Chitra Kotwaliwale, Ph.D. 1 Rare diseases affect 350 million people worldwide 7,000 rare diseases 80% are genetic 60 million affected in the US, Europe
More informationPedigree Construction Notes
Name Date Pedigree Construction Notes GO TO à Mendelian Inheritance (http://www.uic.edu/classes/bms/bms655/lesson3.html) When human geneticists first began to publish family studies, they used a variety
More informationLecture 17: Human Genetics. I. Types of Genetic Disorders. A. Single gene disorders
Lecture 17: Human Genetics I. Types of Genetic Disorders A. Single gene disorders B. Multifactorial traits 1. Mutant alleles at several loci acting in concert C. Chromosomal abnormalities 1. Physical changes
More informationvariant led to a premature stop codon p.k316* which resulted in nonsense-mediated mrna decay. Although the exact function of the C19L1 is still
157 Neurological disorders primarily affect and impair the functioning of the brain and/or neurological system. Structural, electrical or metabolic abnormalities in the brain or neurological system can
More informationMultiple Copy Number Variations in a Patient with Developmental Delay ASCLS- March 31, 2016
Multiple Copy Number Variations in a Patient with Developmental Delay ASCLS- March 31, 2016 Marwan Tayeh, PhD, FACMG Director, MMGL Molecular Genetics Assistant Professor of Pediatrics Department of Pediatrics
More informationB-4.7 Summarize the chromosome theory of inheritance and relate that theory to Gregor Mendel s principles of genetics
B-4.7 Summarize the chromosome theory of inheritance and relate that theory to Gregor Mendel s principles of genetics The Chromosome theory of inheritance is a basic principle in biology that states genes
More informationDeciphering Developmental Disorders (DDD) DDG2P
Deciphering Developmental Disorders (DDD) DDG2P David FitzPatrick MRC Human Genetics Unit, University of Edinburgh Deciphering Developmental Disorders objectives research understand genetics of DD translation
More informationLab Activity Report: Mendelian Genetics - Genetic Disorders
Name Date Period Lab Activity Report: Mendelian Genetics - Genetic Disorders Background: Sometimes genetic disorders are caused by mutations to normal genes. When the mutation has been in the population
More informationWhole Genome and Transcriptome Analysis of Anaplastic Meningioma. Patrick Tarpey Cancer Genome Project Wellcome Trust Sanger Institute
Whole Genome and Transcriptome Analysis of Anaplastic Meningioma Patrick Tarpey Cancer Genome Project Wellcome Trust Sanger Institute Outline Anaplastic meningioma compared to other cancers Whole genomes
More informationFORGE Canada: A nation-wide effort to identify genes for rare childhood disorders Kym Boycott, PhD, MD, FRCPC, FCCMG
FORGE Canada: A nation-wide effort to identify genes for rare childhood disorders Kym Boycott, PhD, MD, FRCPC, FCCMG Children s Hospital of Eastern Ontario Research Institute University of Ottawa, Canada
More informationGolden Helix s End-to-End Solution for Clinical Labs
Golden Helix s End-to-End Solution for Clinical Labs Steven Hystad - Field Application Scientist Nathan Fortier Senior Software Engineer 20 most promising Biotech Technology Providers Top 10 Analytics
More informationSEX-LINKED INHERITANCE. Dr Rasime Kalkan
SEX-LINKED INHERITANCE Dr Rasime Kalkan Human Karyotype Picture of Human Chromosomes 22 Autosomes and 2 Sex Chromosomes Autosomal vs. Sex-Linked Traits can be either: Autosomal: traits (genes) are located
More informationPsych 3102 Lecture 3. Mendelian Genetics
Psych 3102 Lecture 3 Mendelian Genetics Gregor Mendel 1822 1884, paper read 1865-66 Augustinian monk genotype alleles present at a locus can we identify this? phenotype expressed trait/characteristic can
More informationCorporate Medical Policy
Corporate Medical Policy Invasive Prenatal (Fetal) Diagnostic Testing File Name: Origination: Last CAP Review: Next CAP Review: Last Review: invasive_prenatal_(fetal)_diagnostic_testing 12/2014 3/2018
More informationWhat favorite organism of geneticists is described in the right-hand column?
What favorite organism of geneticists is described in the right-hand column? Model Organism fruit fly?? Generation time 12 days ~ 5000 days Size 2 mm 1500-1800mm Brood size hundreds a couple dozen would
More informationSCALPEL MICRO-ASSEMBLY APPROACH TO DETECT INDELS WITHIN EXOME-CAPTURE DATA. Giuseppe Narzisi, PhD Schatz Lab
SCALPEL MICRO-ASSEMBLY APPROACH TO DETECT INDELS WITHIN EXOME-CAPTURE DATA Giuseppe Narzisi, PhD Schatz Lab November 14, 2013 Micro-Assembly Approach to detect INDELs 2 Outline Scalpel micro-assembly pipeline
More informationBenefits and pitfalls of new genetic tests
Benefits and pitfalls of new genetic tests Amanda Krause Division of Human Genetics, NHLS and University of the Witwatersrand Definition of Genetic Testing the analysis of human DNA, RNA, chromosomes,
More informationChapter 7: Pedigree Analysis B I O L O G Y
Name Date Period Chapter 7: Pedigree Analysis B I O L O G Y Introduction: A pedigree is a diagram of family relationships that uses symbols to represent people and lines to represent genetic relationships.
More informationHuman inherited diseases
Human inherited diseases A genetic disorder that is caused by abnormality in an individual's DNA. Abnormalities can range from small mutation in a single gene to the addition or subtraction of a whole
More informationAdvances in genetic diagnosis of neurological disorders
Acta Neurol Scand 2014: 129 (Suppl. 198): 20 25 DOI: 10.1111/ane.12232 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd ACTA NEUROLOGICA SCANDINAVICA Review Article Advances in genetic diagnosis
More informationSupplemental Data. De Novo Truncating Mutations in WASF1. Cause Intellectual Disability with Seizures
The American Journal of Human Genetics, Volume 13 Supplemental Data De Novo Truncating Mutations in WASF1 Cause Intellectual Disability with Seizures Yoko Ito, Keren J. Carss, Sofia T. Duarte, Taila Hartley,
More informationProblem set questions from Final Exam Human Genetics, Nondisjunction, and Cancer
Problem set questions from Final Exam Human Genetics, Nondisjunction, and ancer Mapping in humans using SSRs and LOD scores 1. You set out to genetically map the locus for color blindness with respect
More informationDan Koller, Ph.D. Medical and Molecular Genetics
Design of Genetic Studies Dan Koller, Ph.D. Research Assistant Professor Medical and Molecular Genetics Genetics and Medicine Over the past decade, advances from genetics have permeated medicine Identification
More informationChapter 1 : Genetics 101
Chapter 1 : Genetics 101 Understanding the underlying concepts of human genetics and the role of genes, behavior, and the environment will be important to appropriately collecting and applying genetic
More informationSee pedigree info on extra sheet 1. ( 6 pts)
Biol 321 Quiz #2 Spring 2010 40 pts NAME See pedigree info on extra sheet 1. ( 6 pts) Examine the pedigree shown above. For each mode of inheritance listed below indicate: E = this mode of inheritance
More informationNature Genetics: doi: /ng Supplementary Figure 1
Supplementary Figure 1 Illustrative example of ptdt using height The expected value of a child s polygenic risk score (PRS) for a trait is the average of maternal and paternal PRS values. For example,
More informationDr Rick Tearle Senior Applications Specialist, EMEA Complete Genomics Complete Genomics, Inc.
Dr Rick Tearle Senior Applications Specialist, EMEA Complete Genomics Topics Overview of Data Processing Pipeline Overview of Data Files 2 DNA Nano-Ball (DNB) Read Structure Genome : acgtacatgcattcacacatgcttagctatctctcgccag
More informationProposal form for the evaluation of a genetic test for NHS Service Gene Dossier
Proposal form for the evaluation of a genetic test for NHS Service Gene Dossier Test Disease Population Triad Disease name Leber congenital amaurosis OMIM number for disease 204000 Disease alternative
More informationHow many disease-causing variants in a normal person? Matthew Hurles
How many disease-causing variants in a normal person? Matthew Hurles Summary What is in a genome? What is normal? Depends on age What is a disease-causing variant? Different classes of variation Final
More informationAnalysis with SureCall 2.1
Analysis with SureCall 2.1 Danielle Fletcher Field Application Scientist July 2014 1 Stages of NGS Analysis Primary analysis, base calling Control Software FASTQ file reads + quality 2 Stages of NGS Analysis
More informationGenetics Review. Alleles. The Punnett Square. Genotype and Phenotype. Codominance. Incomplete Dominance
Genetics Review Alleles These two different versions of gene A create a condition known as heterozygous. Only the dominant allele (A) will be expressed. When both chromosomes have identical copies of the
More informationMolecular Diagnostic Laboratory 18 Sequencing St, Gene Town, ZY Tel: Fax:
Molecular Diagnostic Laboratory 18 Sequencing St, Gene Town, ZY 01234 Tel: 555-920-3333 Fax: 555-920-3334 www.moldxlaboratory.com Patient Name: Jane Doe Specimen type: Blood, peripheral DOB: 04/05/1990
More informationNGS in neurodegenerative disorders - our experience
Neurology Clinic, Clinical Center of Serbia Faculty of Medicine, University of Belgrade Belgrade, Serbia NGS in neurodegenerative disorders - our experience Marija Branković, MSc Belgrade, 2018 Next Generation
More informationClinical Spectrum and Genetic Mechanism of GLUT1-DS. Yasushi ITO (Tokyo Women s Medical University, Japan)
Clinical Spectrum and Genetic Mechanism of GLUT1-DS Yasushi ITO (Tokyo Women s Medical University, Japan) Glucose transporter type 1 (GLUT1) deficiency syndrome Mutation in the SLC2A1 / GLUT1 gene Deficiency
More informationMEDICAL GENOMICS LABORATORY. Peripheral Nerve Sheath Tumor Panel by Next-Gen Sequencing (PNT-NG)
Peripheral Nerve Sheath Tumor Panel by Next-Gen Sequencing (PNT-NG) Ordering Information Acceptable specimen types: Blood (3-6ml EDTA; no time limitations associated with receipt) Saliva (OGR-575 DNA Genotek;
More informationPedigree. Tracking Genetic Traits: How it s done!
Pedigree Tracking Genetic Traits: How it s done! REVIEW Many traits in humans are controlled by genes. Some of these traits are common features like eye color, straight or curly hair, baldness, attached
More informationIdentification of a novel in-frame de novo mutation in SPTAN1 in intellectual disability and pontocerebellar atrophy
Hamdan et al., Identification of a novel in-frame de novo mutation in SPTAN1 in intellectual disability and pontocerebellar atrophy Supplementary Information Gene screening and bioinformatics PCR primers
More informationSingle Gene (Monogenic) Disorders. Mendelian Inheritance: Definitions. Mendelian Inheritance: Definitions
Single Gene (Monogenic) Disorders Mendelian Inheritance: Definitions A genetic locus is a specific position or location on a chromosome. Frequently, locus is used to refer to a specific gene. Alleles are
More informationGenetics of Hereditary Spastic Paraplegia Dr. Arianna Tucci
Genetics of Hereditary Spastic Paraplegia 1 Clinical Research Fellow Institute of Neurology University College London Hereditary spastic paraplegia: definition Clinical designation for neurologic syndromes
More informationCURRENT GENETIC TESTING TOOLS IN NEONATAL MEDICINE. Dr. Bahar Naghavi
2 CURRENT GENETIC TESTING TOOLS IN NEONATAL MEDICINE Dr. Bahar Naghavi Assistant professor of Basic Science Department, Shahid Beheshti University of Medical Sciences, Tehran,Iran 3 Introduction Over 4000
More informationMEDICAL GENOMICS LABORATORY. Non-NF1 RASopathy panel by Next-Gen Sequencing and Deletion/Duplication Analysis of SPRED1 (NNP-NG)
Non-NF1 RASopathy panel by Next-Gen Sequencing and Deletion/Duplication Analysis of SPRED1 (NNP-NG) Ordering Information Acceptable specimen types: Blood (3-6ml EDTA; no time limitations associated with
More informationTOWARDS ACCURATE GERMLINE AND SOMATIC INDEL DISCOVERY WITH MICRO-ASSEMBLY. Giuseppe Narzisi, PhD Bioinformatics Scientist
TOWARDS ACCURATE GERMLINE AND SOMATIC INDEL DISCOVERY WITH MICRO-ASSEMBLY Giuseppe Narzisi, PhD Bioinformatics Scientist July 29, 2014 Micro-Assembly Approach to detect INDELs 2 Outline 1 Detecting INDELs:
More informationIntroduction to linkage and family based designs to study the genetic epidemiology of complex traits. Harold Snieder
Introduction to linkage and family based designs to study the genetic epidemiology of complex traits Harold Snieder Overview of presentation Designs: population vs. family based Mendelian vs. complex diseases/traits
More informationVan test naar diagnose naar
Van test naar diagnose naar V therapie op maat Marjolein Kriek, LUMC Joris Veltman, RUNMC Exome diagnostics in genetically heterogeneous disease Joris Veltman, PhD Department of Human Genetics Radboud
More informationHome Brewed Personalized Genomics
Home Brewed Personalized Genomics The Quest for Meaningful Analysis Results of a 23andMe Exome Pilot Trio of Myself, Wife, and Son February 22, 2013 Gabe Rudy, Vice President of Product Development Exome
More information2. A normal human germ cell before meiosis has how many nuclear chromosomes?
1 Lesson 5 Transmission/Heredity 1. Each of the following pedigrees represent one of the major modes of inheritance that we learned about for a dominant trait: (1) Autosomal, (2) Sex linked, or (3) Maternal.
More informationAgro/Ansc/Bio/Gene/Hort 305 Fall, 2017 MEDICAL GENETICS AND CANCER Chpt 24, Genetics by Brooker (lecture outline) #17
Agro/Ansc/Bio/Gene/Hort 305 Fall, 2017 MEDICAL GENETICS AND CANCER Chpt 24, Genetics by Brooker (lecture outline) #17 INTRODUCTION - Our genes underlie every aspect of human health, both in function and
More informationChapter 4 PEDIGREE ANALYSIS IN HUMAN GENETICS
Chapter 4 PEDIGREE ANALYSIS IN HUMAN GENETICS Chapter Summary In order to study the transmission of human genetic traits to the next generation, a different method of operation had to be adopted. Instead
More informationConcurrent Practical Session ACMG Classification
Variant Effect Prediction Training Course 6-8 November 2017 Prague, Czech Republic Concurrent Practical Session ACMG Classification Andreas Laner / Anna Benet-Pagès 1 Content 1. Background... 3 2. Aim
More informationNature Genetics: doi: /ng Supplementary Figure 1. PCA for ancestry in SNV data.
Supplementary Figure 1 PCA for ancestry in SNV data. (a) EIGENSTRAT principal-component analysis (PCA) of SNV genotype data on all samples. (b) PCA of only proband SNV genotype data. (c) PCA of SNV genotype
More informationMendelian Genetics. Gregor Mendel. Father of modern genetics
Mendelian Genetics Gregor Mendel Father of modern genetics Objectives I can compare and contrast mitosis & meiosis. I can properly use the genetic vocabulary presented. I can differentiate and gather data
More informationBIOL2005 WORKSHEET 2008
BIOL2005 WORKSHEET 2008 Answer all 6 questions in the space provided using additional sheets where necessary. Hand your completed answers in to the Biology office by 3 p.m. Friday 8th February. 1. Your
More informationGenome - Wide Linkage Mapping
Biological Sciences Initiative HHMI Genome - Wide Linkage Mapping Introduction This activity is based on the work of Dr. Christine Seidman et al that was published in Circulation, 1998, vol 97, pgs 2043-2048.
More informationGenetics and Genomics in Medicine Chapter 8 Questions
Genetics and Genomics in Medicine Chapter 8 Questions Linkage Analysis Question Question 8.1 Affected members of the pedigree above have an autosomal dominant disorder, and cytogenetic analyses using conventional
More informationRiunione Regionale SIN Campania
Riunione Regionale SIN Campania Dott.ssa Maria Lieto Dipartimento di Neuroscienze, Università Federico II Napoli Salerno, 14 dicembre 2018 HEREDITARY ATAXIAS SCAs (35 genes) ARCAs (94 genes) Diagnosis?
More informationAdvance Your Genomic Research Using Targeted Resequencing with SeqCap EZ Library
Advance Your Genomic Research Using Targeted Resequencing with SeqCap EZ Library Marilou Wijdicks International Product Manager Research For Life Science Research Only. Not for Use in Diagnostic Procedures.
More informationHuman Genetics of Tuberculosis. Laurent Abel Laboratory of Human Genetics of Infectious Diseases University Paris Descartes/INSERM U980
Human Genetics of Tuberculosis Laurent Abel Laboratory of Human Genetics of Infectious Diseases University Paris Descartes/INSERM U980 Human genetics in tuberculosis? Concept Epidemiological/familial
More informationIlluminating the genetics of complex human diseases
Illuminating the genetics of complex human diseases Michael Schatz Sept 27, 2012 Beyond the Genome @mike_schatz / #BTG2012 Outline 1. De novo mutations in human diseases 1. Autism Spectrum Disorder 2.
More informationBiology 2C03: Genetics What is a Gene?
Biology 2C03: Genetics What is a Gene? September 9 th, 2013 Model Organisms - E. coli - Yeast - Worms - Arabodopsis - Fruitflie - Mouse What is a Gene? - Define, recognize, describe and apply Mendel s
More informationHands-On Ten The BRCA1 Gene and Protein
Hands-On Ten The BRCA1 Gene and Protein Objective: To review transcription, translation, reading frames, mutations, and reading files from GenBank, and to review some of the bioinformatics tools, such
More informationExploding Genetic Knowledge in Developmental Disabilities. Disclosures. The Genetic Principle
Exploding Genetic Knowledge in Developmental Disabilities How to acquire the data and how to make use of it Elliott H. Sherr MD PhD Professor of Neurology & Pediatrics UCSF Disclosures InVitae: clinical
More informationMendelian Genetics and Beyond Chapter 4 Study Prompts
Mendelian Genetics and Beyond Chapter 4 Study Prompts 1. What is a mode of inheritance? 2. Can you define the following? a. Autosomal dominant b. Autosomal recessive 3. Who was Gregor Mendel? 4. What did
More informationMultiplex target enrichment using DNA indexing for ultra-high throughput variant detection
Multiplex target enrichment using DNA indexing for ultra-high throughput variant detection Dr Elaine Kenny Neuropsychiatric Genetics Research Group Institute of Molecular Medicine Trinity College Dublin
More information22q11.2 DELETION SYNDROME. Anna Mª Cueto González Clinical Geneticist Programa de Medicina Molecular y Genética Hospital Vall d Hebrón (Barcelona)
22q11.2 DELETION SYNDROME Anna Mª Cueto González Clinical Geneticist Programa de Medicina Molecular y Genética Hospital Vall d Hebrón (Barcelona) Genomic disorders GENOMICS DISORDERS refers to those diseases
More informationGENOTYPE-PHENOTYPE CORRELATIONS IN GALACTOSEMIA COMPLICATIONS COMPLICATIONS COMPLICATIONS LONG-TERM CHRONIC COMPLICATIONS WITH NO CLEAR CAUSE
Galactosemia Deficiency: galactose-1-phosphate-uridyltransferase(galt) GENOTYPE-PHENOTYPE CORRELATIONS IN GALACTOSEMIA GALT D-galactose-1-phosphate UDPgalactose + + UDPglucose D-glucose-1-phosphate DIVISION
More informationHuman Chromosomes. Lesson Overview. Lesson Overview Human Chromosomes
Lesson Overview 14.1 THINK ABOUT IT If you had to pick an ideal organism for the study of genetics, would you choose one that produced lots of offspring, was easy to grow in the lab, and had a short life
More informationUnifactorial or Single Gene Disorders. Hanan Hamamy Department of Genetic Medicine and Development Geneva University Hospital
Unifactorial or Single Gene Disorders Hanan Hamamy Department of Genetic Medicine and Development Geneva University Hospital Training Course in Sexual and Reproductive Health Research Geneva 2011 Single
More informationHuman Genetic Diseases (non mutation)
mutation) Pedigrees mutation) 1. Autosomal recessive inheritance: this is the inheritance of a disease through a recessive allele. In order for the person to have the condition they would have to be homozygous
More informationGENETICS - NOTES-
GENETICS - NOTES- Warm Up Exercise Using your previous knowledge of genetics, determine what maternal genotype would most likely yield offspring with such characteristics. Use the genotype that you came
More informationEgypt 90 Million People Power Seven Thousands Year Culture 29 Governorates
Egypt 90 Million People Power Seven Thousands Year Culture 29 Governorates Recent advances in Molecular Medicine: Changing the practice of neurology Presentation by Nagwa Meguid, Prof. of Human Genetics
More informationBasic Definitions. Dr. Mohammed Hussein Assi MBChB MSc DCH (UK) MRCPCH
Basic Definitions Chromosomes There are two types of chromosomes: autosomes (1-22) and sex chromosomes (X & Y). Humans are composed of two groups of cells: Gametes. Ova and sperm cells, which are haploid,
More informationNGS panels in clinical diagnostics: Utrecht experience. Van Gijn ME PhD Genome Diagnostics UMCUtrecht
NGS panels in clinical diagnostics: Utrecht experience Van Gijn ME PhD Genome Diagnostics UMCUtrecht 93 Gene panels UMC Utrecht Cardiovascular disease (CAR) (5 panels) Epilepsy (EPI) (11 panels) Hereditary
More informationImplementation of the DDD/ClinGen OGT (CytoSure v3) Microarray
Implementation of the DDD/ClinGen OGT (CytoSure v3) Microarray OGT UGM Birmingham 08/09/2016 Dom McMullan Birmingham Women's NHS Trust WM chromosomal microarray (CMA) testing Population of ~6 million (10%)
More informationExam #2 BSC Fall. NAME_Key correct answers in BOLD FORM A
Exam #2 BSC 2011 2004 Fall NAME_Key correct answers in BOLD FORM A Before you begin, please write your name and social security number on the computerized score sheet. Mark in the corresponding bubbles
More informationName: PS#: Biol 3301 Midterm 1 Spring 2012
Name: PS#: Biol 3301 Midterm 1 Spring 2012 Multiple Choice. Circle the single best answer. (4 pts each) 1. Which of the following changes in the DNA sequence of a gene will produce a new allele? a) base
More informationNonparametric Linkage Analysis. Nonparametric Linkage Analysis
Limitations of Parametric Linkage Analysis We previously discued parametric linkage analysis Genetic model for the disease must be specified: allele frequency parameters and penetrance parameters Lod scores
More informationCorporate Medical Policy
Corporate Medical Policy File Name: Origination: Last CAP Review: Next CAP Review: Last Review: genetic_testing_for_rett_syndrome 7/2012 3/2017 3/2018 5/2017 Description of Procedure or Service Rett syndrome
More informationNature Genetics: doi: /ng Supplementary Figure 1. Brain magnetic resonance imaging in patient 9 at age 3.6 years.
Supplementary Figure 1 Brain magnetic resonance imaging in patient 9 at age 3.6 years. (a d) Axial T2-weighted images show a marked degree of ventriculomegaly. Note the diencephalic mesencephalic junction
More informationClinical evaluation of microarray data
Clinical evaluation of microarray data David Amor 19 th June 2011 Single base change Microarrays 3-4Mb What is a microarray? Up to 10 6 bits of Information!! Highly multiplexed FISH hybridisations. Microarray
More informationGenes and Inheritance
Genes and Inheritance Variation Causes of Variation Variation No two people are exactly the same The differences between people is called VARIATION. This variation comes from two sources: Genetic cause
More informationAssessing Laboratory Performance for Next Generation Sequencing Based Detection of Germline Variants through Proficiency Testing
Assessing Laboratory Performance for Next Generation Sequencing Based Detection of Germline Variants through Proficiency Testing Karl V. Voelkerding, MD Professor of Pathology University of Utah Medical
More informationIntroduction to genetic variation. He Zhang Bioinformatics Core Facility 6/22/2016
Introduction to genetic variation He Zhang Bioinformatics Core Facility 6/22/2016 Outline Basic concepts of genetic variation Genetic variation in human populations Variation and genetic disorders Databases
More informationUAB P30 CORE A: The Hepato-Renal Fibrocystic Diseases Translational Resource
PKD Foundation UAB P30 CORE A: The Hepato-Renal Fibrocystic Diseases Translational Resource http://www.arpkdstudies.uab.edu/ Director: Co-Director: Lisa M. Guay-Woodford, MD William E. Grizzle, MD, PhD
More informationAlzheimer Disease and Complex Segregation Analysis p.1/29
Alzheimer Disease and Complex Segregation Analysis Amanda Halladay Dalhousie University Alzheimer Disease and Complex Segregation Analysis p.1/29 Outline Background Information on Alzheimer Disease Alzheimer
More informationDNA-seq Bioinformatics Analysis: Copy Number Variation
DNA-seq Bioinformatics Analysis: Copy Number Variation Elodie Girard elodie.girard@curie.fr U900 institut Curie, INSERM, Mines ParisTech, PSL Research University Paris, France NGS Applications 5C HiC DNA-seq
More information