What#are#the#different#types#of#mutations#&#phenotypic#effects?#Give#an#example#of#a#disease#for#each.#

Transcription

1 Mutation#Classifications:# a. Location# #understand#the#differences#and#consequences.# # o Germinal* *gametes,*inherited* o Somatic* *other*cells,*not*generally*inherited* o Autosomal* *within*genes*on*autosomes* o XILinked* *within*genes*on*the*x*chromosomes* b.# Type#of#change#(Point#&#FrameLShift).# o o Point&Mutations:*Base*substitutions;*may*be*coding*or*nonIcoding.#! Eg.&SICKLE&CELL&ANAEMIA&=&glu158val*(Hb*variant)#! Eg.&FOP&(FIBRODYSPLASIA&OSSIFICANS&PROGRESSIVA)&=*most*cases*sue*to*point*mutation*in* a*bone*morphogenic*protein*(bmp)*type*i*receptor.#! Two*types*of*point*mutations:#! TRANSITION*=*Pyrimidine* *Pyrimidine*(C T;T C)*or*Purine* *Purine*(G A;A G)#! TRANSVERSION*=*Pyrimidine* *Purine*(or*vice*versa)#! Silent,*missense,*nonsense.# FrameDShift&Mutations:*Insertion*or*deletion*of*a*nucleotide,*change*the*reading*frame.*! Eg.*DUCHENNE&MUSCULAR&DYSTROPHY&(DMD)&=*Result*of*FS*mutation*in*the*dystrophin* gene*on*x*chromosome.*leads*to*nonifunctional*truncated*protein*involved*in*muscle* function.*! Eg.*ABO&BLOOD&GROUP S:&Based*on*antigenic*determinants*on*cells.*A*and*B*individuals*have* enzymes*which*add*specific*sugars*to*h*substance.*o*type*individuals*are*homozygous*io* allele;*lack*enzyme*activity.*io*allele*has*single*base*deletion*that*results*in*fs*mutation*and* truncated*protein.* * What#are#the#different#types#of#mutations#&#phenotypic#effects?#Give#an#example#of#a#disease#for#each.# * * * 1. SILENT* *no*change*to*aa*sequence* 2. MISSENSE* *substitution;*changes*aa*sequence.*achondroplasia* 3. NONSENSE* *substitution;*stop*codon.*marfan&syndrome* 4. ADDITION/DELECTION* *add*or*remove*one*or*more*bases.*cystic&fibrosis* 5. FRAMESHIFT* *addition/deletion*can*change*reading*frame.*dmd,&abo&blood&grouping* 6. TRANSPOSON*MUTATIONS* * Jumping*genes,*create*mutations*or*silence*genes.*A*lot*of*viruses*act* like*this.*retrotransposons*responsible*for*0.27%*human*disease.** 7. EXPANSION*OF*REPEAT*SEQUENCES* *Ie*Trinucleotide*repeats;*show*anticipation*with*generations.* Fragile&X,&Huntington s&disease*

2 GENETIC EPIDEMIOLOGY The study of occurrence and distribution of disease with relation to genetic influence (genes a constant). Exposure to an agent causing disease - X-Rays, Tobacco. John Snow - cholera experiment; started epidemiology. Types of epidemiological design studies: 1. DESCRIPTIVE: - Populations (correlational studies) - Individual - insifficient for genetics. - case report, case series, cross-sectional studies. 2. ANALYTICAL: - Observational: useful for genetic epidemiology. - case control, cohort - retrospectove & prospective - Interventional/experimental - randomised controlled trial, field trial, clinical trial. 2x2 contingency table for calculation of association: Outcome (disease) EXPOSURE Present Absent Total Present a b a + b Absent c d c + d Total a + c b + d a + b + c + d Relative Risk: Odds Ratio: When large numbers these are basically the same. Both measure the risk relative to exposure - exposure could be carrying a gene. Disease Complexity: Simple - predictable inheritance patterns (Mendelian) - usually single gene mutations - e.g. CF, sickle-cell anaemia. RARE!

3 Complex - interaction genes & many factors - e.g. some cancers, diabetes, schizophrenia, autism, alzheimers, asthma, hypertension, cleft lip/palate, rheumatoid arthritis. Genetic Epidemiology vs. Traditional - Take into account Mendelian segregation, genetic linkage, ID responsible sequence via pedigrees. - Familial aggregation - if NONE, unlikely to be a genetic component. - Also includes environmental interactions with genotype Genetic Epidemiology Molecular Epidemiology Traditional Epidemiology Study Designs Pedigree Based Cohort Case-Case Case-Control Cohort Case-Case Case-Control Approach Familial Aggregation? Mendelian Segregation? Genotype-Disease association? Risk Factor-Disease associations Genetic Linkage? ID Responsible DNA sequence (e.g. cloning). Genotype-environment interaction. Recurrence Risk Ratio (ƛR): Ratio of disease manifestation in other family members compared to disease prevalence in general population. ƛS: Sibling Recurrence Risk Ratio: most often used. e.g. 10 = sibling 10x more likely to get disease than someone else in general population. * CF: siblings risk = 0.25; population risk = ƛS = 500 * Huntington s: siblings = 0.5; population = ƛS = 5000 * Alzheimer s: siblings = ; pop = 0.1. ƛS = 3 to 4 Variance Components (V or!²): VP = VG + VE + VGE VP: total phenotypic variation of segregating population. VG: genetic variation contributing to total phenotypic variation. VE: environmental contribution to TPV. VGE: variation associated with the genetic + environmental interactions.

4 e.g. An example of a linkage study - stuttering. - Twin studies showed heritability 50-70% - Adoption studies found no evidence of stuttering being learned, i.e. not environmental - Family clusters of stuttering found many small and a few large families - Segregation analysis less successful Found 87 genes on chromosome 12 in a Pakistani family within the linkage interval - sequenced. GNPTAB: variant was an apparent mutation in this gene. The same mutation showed on both stutterers in Pakistan and India. However, the mutation was NOT observed in normal North American individuals. Perhaps an ancestral founder effect? Haplotype: specific combination of alleles occurring (cis) on the same chromosomal segment. Diplotype: Haplogenotype; i.e. pair of phased haplotypes - one maternally, one paternally inherited. Linkage/Linked Markers: Physical co-location of markers on the same chromosome. Linkage Disequilibrium: Non-random assortment of alleles at 2+ loci. The closer the markers, the stronger LD since recombination will have occurred at a low rate. Markers co-segregate within and between families. New markers (mutations) originated on a particular chromosome remain. Single Nucleotide Polymorphisms (SNP s): agcttctatct agcttctctct Simple Tandem Repeat Polymorphisms (STR s): agtctctctctctctctctctctctatacg (CT) 11 agtctctctctctctctctatacg (CT) 8 Insertions/Deletions: cattcaaaggagaggtctc cattca ggtctc Recombination Hotspots: recombination is not even along the DNA. Some sites are more likely to initiate and terminate recombination. Recombination hotspots alter the linkage map relative to the physical (sequence) map, since the linkage map depends on recombination and this is not exactly proportional to distance. Haplotype Blocks: N SNP s = 2ⁿ possible haplotypes; i.e. very large diversity possible. BUT, we don t see the full extent of haplotype diversity in human populations. Haplotypes are broken into blocks of markers with high mutual LD separated by recombination hotspots. Non-uniform LD across genome. e.g. Common and rare genetic variation in 10 individuals, carrying 20 distinct copies of the human genome. The amount of variation shown here is typical for a 5kb stretch of the genome and is gentled on a strong recombination hotspot. NB - this LD only focusses on a small part of the chromosome. LD means that markers are related to each other through time (generations).

5 What are copy number variants (CNV s)? CNV s are a form of structural variation - alterations of the DNA of a genome which results in the cell having an abnormal (or for certain cells, normal!) variation in the number of copies of one or more sections of the DNA. CNV s include deletions and duplications. A recent study showed that de novo CNV s were 3 to 4 times more frequent in schizophrenics. Other subsequent studies showed that CNV s distributed in other regions of the genome are disproportionately represented in schizophrenia (an inverse outcome in autism suggests a relationship). Compare and contrast Autism/Autism Spectrum Disorder with William s Syndrome as almost opposites in social behaviour. Autism: absent verbal communication, ritualistic behaviours (OCD), socially absent. Many have extremely high IQ s (genius). ASD: a broader category of milder forms of autism. 66% mental retardation. William s Syndrome: extremely extraverted. Very low IQ s (70 avg.) but extraordinary language and speech capabilities. Hyper-social, empathetic, total lack of social inhibition, very friendly and cheerful. Complete opposite of autism. Explain how genes for intellectual ability are candidates for intelligence and intellectual disability, and do we know if these compare to our ancestors? Genes for intellectual ability are simultaneous candidates for both intelligence and disability. For example, AUTS2 is an autism susceptibility candidate (Chr7q11). Comparison of modern humans and Neanderthals show a strong evolutionary difference with this gene, with 293 SNP s different. It is suggested that AUTS2 is related to intelligence. Human GWAS detected SNP s in AUTS2 are related to alcohol intake - in Drosophilia, knockout of AUTS2 reduced alcohol sensitivity, suggesting an effect on behaviour related to alcohol. Gross new mutations are related to intellectual disability.

6 BIOTECHNOLOGY, CANCER, ETHICS & PHARMACOGENETICS OPTIMISING DRUG THERAPIES Pharmacogenetics: study of how an individual s entire genetic makeup determines the body s response to drugs. Because there are so many interactions occurring between an drug and a patient s proteins, many genes and polymorphisms can affect a persons response to a drug. - Average, drugs only effective in 50% patients - Trial and error used until correct drug found - dangerous & time wasteful. Pharmacogentics increases drug efficiency by matching drugs to subpopulations of patients who will benefit. Personalised pharmacogenomics widely practiced in diagnosis and treatment of cancer. eg. HER-2 gene Personalised medicine successfully used in HER-2 gene and the use of the drug herceptin in breast cancer. Human epidermal growth factor receptor 2 (HER-2) gene located on chr 17 & codes for transmembrane tyrosine kinase receptor protein called HER-2. 25% invasive cancers see HER-2 gene amplification and protein expressed all over cell surface. Some breast cancers may have 100 copies per cell. Amplification associated with increased tumour invasiveness, metastasis and cell proliferation, as well as poorer prognosis. Using recombinant DNA technology, a mouse monoclonal antibody was humanised - Herceptin. Herceptin causes sell-cycle arrests in cancer cells over-expressing HER-2, and in some cases even causes death of cancer cells. Herceptin ONLY works in breast caver cells with amplified HER-2 genes, therefore important to know HER-2 phenotype of each cancer. Herceptin potentially serious side effects; therefore use must be limited to only those who benefit from the treatment. Immunohistochemistry (IHC) & FISH are molecular assays that can be used to determine the gene and protein status of breast cancer cells. Herceptin used in combo with chemotherapy increases survival by 25-50% vs chemo alone. REDUCING ADVERSE DRUG REACTIONS ~100,000 people die annually in the US from adverse reactions to medicines. Costs associated are estimated to be $136 billion. Sequence variations in a large number of genes can affect drug responsiveness. eg. Cytochrome P450 family of proteins particularly significant and is encoded by 57 different genes. The products of the genes such as CYP2A6, CYP2B6 and CYPC19 are responsible for metabolising the most important pharmaceutical drugs. A microarray gene test (AmpliChip) detects 29 genetic variants of CYP2D6 and CYP2C19. Detects SNP s, deletions and duplications. COMT gene is another example of a pharmacogenomic target.

7 What is genetic imprinting? What are some of the consequences of it? For most genes, we inherit two copies (one from each parent). With imprinted genes, only one functional copy is inherited. Depending on the gene, one of the copies is epigenetically silenced, usually by the addition of methyl groups during gametogenesis. The epigenetic tags on imprinted genes are usually maintained for the life of the organism, but are reset during egg and sperm formation. Regardless of which parent they came from, certain different genes are always silenced in gametes. Most human disorders associated with imprinting originate during foetal development and growth. -Prader-Willi -Angelman -Beckwith-Wiedman These syndromes occur because most imprinted genes encode growth factors or other growthregulating genes. Define uni-parental disomy, and explain how it may result in certain syndromes? Uni-parental disomy occurs where both copies of a chromosomal pair have originated from one parent. This can cause serious problems in regions where genes are imprinted. Imprinted genes show expression of one ONE of the parents alleles. This parent-specific pattern of allele expression happens during gamete formation. Differential methylation of CpG rich regions produces allele-specific imprinting and subsequent gene silencing. Prader-Willi Syndrome (15q11-13): 25% from uniparental disomy of MATERNAL chromosome. - Deletion of a paternal chromosome, but maternal gives 2 chromosomes (turned off), a PWS embryo will develop. This is because these is still a balanced chromosome count - it is only unbalanced in the locus where imprinting is occurring. Angelman Syndrome (15q11-13): 15% uni-parental disomy PATERNAL chromosome. - Deletion of a maternal chromosome, but paternal gives 2 (turned off), an AS embryo will develop. Describe the role of epigenetics in cancer? Hypomethylation is a property of all cancers examined to date. Epigenetic states of normal cells are greatly altered in cancer cells, and other epigenetic changes including selective hypermethylation and gene silencing are also present in cancer cells.

8 GENETICS Revision Lecture - Questions in lecture notes - Leesch-Nyan Syndrome (from lab!) - Imprinting - Angelmans, Prader-Willi - Founder Effect & Genetic Drift!! - Assumptions of the Hardy-Weinberg Equilibrium - Random mating? - LD drawing to explain (pedigree with dots showing emergence of variations over time, resulting in variations of chromosomes within a population - show disease mutation!). - Strategies to find genes - large pedigree, linkage analysis (~57 mins) e.g. the schizophrenia study was a waste of time and money because didn t pick up anything - NEW MUTATIONS with no association! Only ancient inherited traits will be picked up by GWA - sequencing the exome (limited approach b/c sequencing expensive) - Copy number variation - GWA - what and how does it work? Limitations? *Uses case-control study format. - Chron s Disease - Phenocopy (1hr 25 min) - Know the schematic diagram (1 hr 26 min) - DEFINE: Recurrence risk ratio, variance components, segregation analysis, linkage analysis, linkage disequilibrium mapping, association analysis. - DEFINE: Functional DNA variants - Changes in: AA sequence, gene promotor, mrna splicing, mrna stability (3 UTR) (1hr 33min) - Histone acetylation!! (Other modifications methylation and phosphorylation, don t need to know). - Learn diagram about CpG methylation - Remember random inactivation/barr Bodies/Tortoiseshell cats as example - XIST - diagram and explain the mechanism! Chromosome location, etc - HDAC/HAT - Differential regulation in a locus - diagram (2hrs 15min) - Draw in differential methylation region! (missing) LINKAGE DISEQUILIBRIUM - Haplotype: a predictable array or markers on a chromosome with a non-random relationship to each other. Represent the history of the DNA (genetics all about transmission of information through generations). - Specific combination (phasing) of alleles occurring (cis) on the same chromosomal segment. - Linkage/Linked Markers: Physical co-location of markers on the same chromosome. - Diplotype: Haplogenotype i.e. pair of phased haplotypes, one maternally and one paternally inherited. - Linkage disequilibrium is a very strong phenomenon, stronger than would be expected in a population as large as human population now. Probably due to ancestors from very small amount of people (genetic bottleneck) Disease Gene Mapping & human history. - Non-random assortment of alleles at 2 or more loci. The closer the markers, the stronger the LD since recombination will have occurred at a low rate. - Markers co-segregate within and between families. - GWA studies a very good example of LD! e.g. How it did and didn t work. - (Mathematics of LD not examinable, just appreciate that it is involved and why etc!) - n number of SNP s; how many haplotypes possible? = 2ⁿ