A fully Bayesian approach for the analysis of Whole-Genome Bisulfite Sequencing Data
|
|
- Percival Hawkins
- 5 years ago
- Views:
Transcription
1 A fully Bayesian approach for the analysis of Whole-Genome Bisulfite Sequencing Data Leonardo Bottolo 1,2,3 1 Department of Medical Genetics, University of Cambridge, UK 2 The Alan Turing Institute, London, UK, 3 MRC Biostatistics Unit, University of Cambridge, UK Big Data and Medicine: Tools, Transformation and Translation - Tuesday 4th July 2017
2 A fully Bayesian approach for the analysis of Whole-Genome Bisulfite Sequencing Data Leonardo Bottolo 1,2,3 1 Department of Medical Genetics, University of Cambridge, UK 2 The Alan Turing Institute, London, UK, 3 MRC Biostatistics Unit, University of Cambridge, UK Big Data and Medicine: Tools, Transformation and Translation - Tuesday 4th July 2017
3 Collaborators Petros Dellaportas Enrico Petretto Owen Rackham
4 Epigenomics Genome-wide investigation of heritable phenotypes resulting from changes in a chromosome without alterations in the. DNA methylation is the most well-studied epigenetic mark.
5 Technologies overview Class Technique Assays CpG coverage Resolution Measurement HM450 2% single-base BV >90 % of Array BS HM450 EPIC CpGs + single-base BV 413,743 CpGs BS WGBS Oxidative >90% single-base PM OXBS-Seq BS-Seq BS Enzyme digestion + BS RRBS 10 20% single-base PM Enrichment MeDIP- Affinity 60 90% bp #reads per bin Seq enrichment MRE-Seq 1 6% single-base #reads per site
6 Technologies overview Class Technique Assays CpG coverage Resolution Measurement HM450 2% single-base BV >90 % of Array BS HM450 EPIC CpGs + single-base BV 413,743 CpGs BS WGBS Oxidative >90% single-base PM OXBS-Seq BS-Seq BS Enzyme digestion + BS RRBS 10 20% single-base PM Enrichment MeDIP- Affinity 60 90% bp #reads per bin Seq enrichment MRE-Seq 1 6% single-base #reads per site
7 Goal Detecting Differentially Methylated CpG sites (DMCs) or Regions (DMRs) is essential in comparative study (case/control) of diverse DNA methylation profiles.
8 Approximate Bayesian Bisulfite Analysis overview
9 ABBA overview
10 Replicates ABBA overview Cases Controls d
11 Replicates ABBA overview Cases Controls Average methylation level d
12 Replicates ABBA overview Cases Controls Average methylation level d Unobserved methylation profile
13 Replicates ABBA overview Cases Controls Average methylation level d Unobserved methylation profile
14 Replicates ABBA overview Cases Controls Average methylation level d Unobserved methylation profile
15 Replicates ABBA overview Cases Controls Average methylation level d Unobserved methylation profile Latent Gaussian Process
16 Replicates Methylation probability difference ABBA overview Cases Controls Average methylation level d Unobserved methylation profile
17 Replicates Methylation probability difference ABBA overview Cases Controls Differentially Methylated Region Average methylation level d Unobserved methylation profile
18 ABBA overview Cases Controls Differentially Methylated Region
19 Poster Approximate Bayesian Bisulfite Analysis Technical details about granularity of smoothing. FDR control for DMR calling. Extensions to include genetic/non-genetic confounding effects. Extensions to perform methylation Quantitative Trait Loci.
20 References Rackham, O.J.L., Langley, Oates, T., Vradi, E., S.R., Harmston, N., Srivastava, P.K., Behmoaras, J., Dellaportas, P., Bottolo, L. and Petretto, E.G. (2017). A Bayesian approach for analysis of wholegenome bisulfite sequencing data identifies disease-associated changes in DNA methylation. Genetics, 205, Mingas, G., Bottolo, L. and Bouganis, C.-S. (2017). Algorithms and architectures for large scale inference in state-space models. Int. J. Approx. Reason., 83, Owen, R., Dellaportas, P., Petretto, E., Bottolo, L. (2015). WGBS- Suite: a simulator for DNA methylation data and benchmarking of differential-methylation tools. Bioinformatics, 31,
21 Thank you!
Results. Abstract. Introduc4on. Conclusions. Methods. Funding
. expression that plays a role in many cellular processes affecting a variety of traits. In this study DNA methylation was assessed in neuronal tissue from three pigs (frontal lobe) and one great tit (whole
More informationAnalysis of shotgun bisulfite sequencing of cancer samples
Analysis of shotgun bisulfite sequencing of cancer samples Kasper Daniel Hansen Postdoc with Rafael Irizarry Johns Hopkins Bloomberg School of Public Health Brixen, July 1st, 2011 The
More informationModern Epigenomics. DNA Methylomics
Modern Epigenomics DNA Methylomics Ting Wang Department of Genetics Center for Genome Sciences and Systems Biology Washington University Dragon Star 2012 Changchun, China July 2, 2012 Informa(on Email:
More informationEPIGENOMICS PROFILING SERVICES
EPIGENOMICS PROFILING SERVICES Chromatin analysis DNA methylation analysis RNA-seq analysis Diagenode helps you uncover the mysteries of epigenetics PAGE 3 Integrative epigenomics analysis DNA methylation
More informationEpigenetics. Jenny van Dongen Vrije Universiteit (VU) Amsterdam Boulder, Friday march 10, 2017
Epigenetics Jenny van Dongen Vrije Universiteit (VU) Amsterdam j.van.dongen@vu.nl Boulder, Friday march 10, 2017 Epigenetics Epigenetics= The study of molecular mechanisms that influence the activity of
More informationAssignment 5: Integrative epigenomics analysis
Assignment 5: Integrative epigenomics analysis Due date: Friday, 2/24 10am. Note: no late assignments will be accepted. Introduction CpG islands (CGIs) are important regulatory regions in the genome. What
More informationIntegrated analysis of sequencing data
Integrated analysis of sequencing data How to combine *-seq data M. Defrance, M. Thomas-Chollier, C. Herrmann, D. Puthier, J. van Helden *ChIP-seq, RNA-seq, MeDIP-seq, Transcription factor binding ChIP-seq
More informationBiostatistical modelling in genomics for clinical cancer studies
This work was supported by Entente Cordiale Cancer Research Bursaries Biostatistical modelling in genomics for clinical cancer studies Philippe Broët JE 2492 Faculté de Médecine Paris-Sud In collaboration
More informationNature Methods: doi: /nmeth.3115
Supplementary Figure 1 Analysis of DNA methylation in a cancer cohort based on Infinium 450K data. RnBeads was used to rediscover a clinically distinct subgroup of glioblastoma patients characterized by
More informationDNA methylation & demethylation
DNA methylation & demethylation Lars Schomacher (Group Christof Niehrs) What is Epigenetics? Epigenetics is the study of heritable changes in gene expression (active versus inactive genes) that do not
More informationUse Case 9: Coordinated Changes of Epigenomic Marks Across Tissue Types. Epigenome Informatics Workshop Bioinformatics Research Laboratory
Use Case 9: Coordinated Changes of Epigenomic Marks Across Tissue Types Epigenome Informatics Workshop Bioinformatics Research Laboratory 1 Introduction Active or inactive states of transcription factor
More informationCanadian Bioinforma1cs Workshops
5/12/16 Canadian Bioinforma1cs Workshops www.bioinforma1cs.ca Module #: Title of Module 2 1 Module 3 Introduc1on to WGBS and analysis Guillaume Bourque Learning Objec/ves of Module Know the different technologies
More informationComputational Analysis of UHT Sequences Histone modifications, CAGE, RNA-Seq
Computational Analysis of UHT Sequences Histone modifications, CAGE, RNA-Seq Philipp Bucher Wednesday January 21, 2009 SIB graduate school course EPFL, Lausanne ChIP-seq against histone variants: Biological
More informationGraphical Modeling Approaches for Estimating Brain Networks
Graphical Modeling Approaches for Estimating Brain Networks BIOS 516 Suprateek Kundu Department of Biostatistics Emory University. September 28, 2017 Introduction My research focuses on understanding how
More informationBack to the Basics: Methyl-Seq 101
Back to the Basics: Methyl-Seq 101 Presented By: Alex Siebold, Ph.D. October 9, 2013 Field Applications Scientist Agilent Technologies Life Sciences & Diagnostics Group Life Sciences & Diagnostics Group
More informationPeak-calling for ChIP-seq and ATAC-seq
Peak-calling for ChIP-seq and ATAC-seq Shamith Samarajiwa CRUK Autumn School in Bioinformatics 2017 University of Cambridge Overview Peak-calling: identify enriched (signal) regions in ChIP-seq or ATAC-seq
More informationEpigenetics: Basic Principals and role in health and disease
Epigenetics: Basic Principals and role in health and disease Cambridge Masterclass Workshop on Epigenetics in GI Health and Disease 3 rd September 2013 Matt Zilbauer Overview Basic principals of Epigenetics
More informationTitle: Pinpointing resilience in Bipolar Disorder
Title: Pinpointing resilience in Bipolar Disorder 1. AIM OF THE RESEARCH AND BRIEF BACKGROUND Bipolar disorder (BD) is a mood disorder characterised by episodes of depression and mania. It ranks as one
More informationEarly-life nutrition modulates the epigenetic state of specific rdna genetic variants in mice.
Early-life nutrition modulates the epigenetic state of specific rdna genetic variants in mice. Holland, ML; Lowe, R; Caton, PW; Gemma, C; Carbajosa, G; Danson, AF; Carpenter, AA; Loche, E; Ozanne, SE;
More informationIntroduction to the Genetics of Complex Disease
Introduction to the Genetics of Complex Disease Jeremiah M. Scharf, MD, PhD Departments of Neurology, Psychiatry and Center for Human Genetic Research Massachusetts General Hospital Breakthroughs in Genome
More informationSUPPLEMENTARY FIGURES: Supplementary Figure 1
SUPPLEMENTARY FIGURES: Supplementary Figure 1 Supplementary Figure 1. Glioblastoma 5hmC quantified by paired BS and oxbs treated DNA hybridized to Infinium DNA methylation arrays. Workflow depicts analytic
More informationMeasuring DNA Methylation with the MinION
Measuring DNA Methylation with the MinION Winston Timp Department of Biomedical Engineering Johns Hopkins University Epigenetics: Modern Modern Definition of epigenetics involves heritable changes other
More informationAn epigenetic approach to understanding (and predicting?) environmental effects on gene expression
www.collaslab.com An epigenetic approach to understanding (and predicting?) environmental effects on gene expression Philippe Collas University of Oslo Institute of Basic Medical Sciences Stem Cell Epigenetics
More informationMeasuring DNA Methylation with the MinION. Winston Timp Department of Biomedical Engineering Johns Hopkins University 12/1/16
Measuring DNA Methylation with the MinION Winston Timp Department of Biomedical Engineering Johns Hopkins University 12/1/16 Epigenetics: Modern Modern Definition of epigenetics involves heritable changes
More informationNature Immunology: doi: /ni Supplementary Figure 1. DNA-methylation machinery is essential for silencing of Cd4 in cytotoxic T cells.
Supplementary Figure 1 DNA-methylation machinery is essential for silencing of Cd4 in cytotoxic T cells. (a) Scheme for the retroviral shrna screen. (b) Histogram showing CD4 expression (MFI) in WT cytotoxic
More informationBST227: Introduction to Statistical Genetics
BST227: Introduction to Statistical Genetics Lecture 11: Heritability from summary statistics & epigenetic enrichments Guest Lecturer: Caleb Lareau Success of GWAS EBI Human GWAS Catalog As of this morning
More informationFunctional annotation of farm animal genomes: ChIP-seq.
Functional annotation of farm animal genomes: ChIP-seq Richard Crooijmans 2018, PAGXXVI Richard.Crooijmans@wur.nl Why FAANG is important Understanding the genotype to phenotype link This needs: - genomic
More informationEpigenetics of discordant monozygotic twins: implications for disease
Castillo-Fernandez et al. Genome Medicine 2014, 6:60 REVIEW Epigenetics of discordant monozygotic twins: implications for disease Juan E Castillo-Fernandez, Tim D Spector and Jordana T Bell * Abstract
More informationThe Cancer Genome Atlas & International Cancer Genome Consortium
The Cancer Genome Atlas & International Cancer Genome Consortium Session 3 Dr Jason Wong Prince of Wales Clinical School Introductory bioinformatics for human genomics workshop, UNSW 31 st July 2014 1
More information저작권법에따른이용자의권리는위의내용에의하여영향을받지않습니다.
저작자표시 - 비영리 - 변경금지 2.0 대한민국 이용자는아래의조건을따르는경우에한하여자유롭게 이저작물을복제, 배포, 전송, 전시, 공연및방송할수있습니다. 다음과같은조건을따라야합니다 : 저작자표시. 귀하는원저작자를표시하여야합니다. 비영리. 귀하는이저작물을영리목적으로이용할수없습니다. 변경금지. 귀하는이저작물을개작, 변형또는가공할수없습니다. 귀하는, 이저작물의재이용이나배포의경우,
More informationMRC Integrative Epidemiology Unit (IEU) at the University of Bristol. George Davey Smith
MRC Integrative Epidemiology Unit (IEU) at the University of Bristol George Davey Smith The making of a University Unit MRC Centre for Causal Analyses in Translational Epidemiology 2007 to 2013 Interdisciplinary
More informationLarge conserved domains of low DNA methylation maintained by Dnmt3a
Supplementary information Large conserved domains of low DNA methylation maintained by Dnmt3a Mira Jeong# 1, Deqiang Sun # 2, Min Luo# 1, Yun Huang 3, Grant A. Challen %1, Benjamin Rodriguez 2, Xiaotian
More informationA full Bayesian partition model for identifying hypo- and hyper-methylated loci from single nucleotide resolution sequencing data
Wang et al. BMC Bioinformatics 2015, 17Suppl 1):7 DOI 10.1186/s12859-015-0850-3 PROCEEDINGS Open Access A full Bayesian partition model for identifying hypo- and hyper-methylated loci from single nucleotide
More informationPREDICTION AND ANALYSIS OF THE METHYLATION STATUS OF CPG ISLANDS IN HUMAN GENOME
PREDICTION AND ANALYSIS OF THE METHYLATION STATUS OF CPG ISLANDS IN HUMAN GENOME A Thesis Presented to The Academic Faculty by Hao Zheng In Partial Fulfillment of the Requirements for the Degree Doctor
More informationSession 4 Rebecca Poulos
The Cancer Genome Atlas (TCGA) & International Cancer Genome Consortium (ICGC) Session 4 Rebecca Poulos Prince of Wales Clinical School Introductory bioinformatics for human genomics workshop, UNSW 20
More informationRisk-prediction modelling in cancer with multiple genomic data sets: a Bayesian variable selection approach
Risk-prediction modelling in cancer with multiple genomic data sets: a Bayesian variable selection approach Manuela Zucknick Division of Biostatistics, German Cancer Research Center Biometry Workshop,
More informationComputational aspects of ChIP-seq. John Marioni Research Group Leader European Bioinformatics Institute European Molecular Biology Laboratory
Computational aspects of ChIP-seq John Marioni Research Group Leader European Bioinformatics Institute European Molecular Biology Laboratory ChIP-seq Using highthroughput sequencing to investigate DNA
More informationCARISMA-LMS Workshop on Statistics for Risk Analysis
Department of Mathematics CARISMA-LMS Workshop on Statistics for Risk Analysis Thursday 28 th May 2015 Location: Department of Mathematics, John Crank Building, Room JNCK128 (Campus map can be found at
More informationAnalyzing the Loss of Allele-Specific Methylation in Human Colorectal Adenoma with Bisulfite Sequencing
Research Collection Master Thesis Analyzing the Loss of Allele-Specific Methylation in Human Colorectal Adenoma with Bisulfite Sequencing Author(s): Machlab, Dania Publication Date: 2015 Permanent Link:
More informationPailin Group Executive Search Assistant Investigator: Cancer Genetics, Epigenetics and Biomarkers Dallas, TX
Pailin Group Executive Search Assistant Investigator: Cancer Genetics, Epigenetics and Biomarkers Dallas, TX An Assistant Investigator position is available for immediate recruitment for a highly motivated
More informationGCATCCATCTTGGGGCGTCCCAATTGCTGAGTAACAAATGAGACGC TGTGGCCAAACTCAGTCATAACTAATGACATTTCTAGACAAAGTGAC TTCAGATTTTCAAAGCGTACCCTGTTTACATCATTTTGCCAATTTCG
Lecture 6 GCATCCATCTTGGGGCGTCCCAATTGCTGAGTAACAAATGAGACGC TGTGGCCAAACTCAGTCATAACTAATGACATTTCTAGACAAAGTGAC TTCAGATTTTCAAAGCGTACCCTGTTTACATCATTTTGCCAATTTCG CGTACTGCAACCGGCGGGCCACGCCCCCGTGAAAAGAAGGTTGTT TTCTCCACATTTCGGGGTTCTGGACGTTTCCCGGCTGCGGGGCGG
More informationSUPPLEMENTAL INFORMATION
SUPPLEMENTAL INFORMATION GO term analysis of differentially methylated SUMIs. GO term analysis of the 458 SUMIs with the largest differential methylation between human and chimp shows that they are more
More informationDiscovery of Novel Human Gene Regulatory Modules from Gene Co-expression and
Discovery of Novel Human Gene Regulatory Modules from Gene Co-expression and Promoter Motif Analysis Shisong Ma 1,2*, Michael Snyder 3, and Savithramma P Dinesh-Kumar 2* 1 School of Life Sciences, University
More informationSupplementary Figures
Supplementary Figures Supplementary Figure 1. Pan-cancer analysis of global and local DNA methylation variation a) Variations in global DNA methylation are shown as measured by averaging the genome-wide
More informationEnvironmental programming of respiratory allergy in childhood: the applicability of saliva
Environmental programming of respiratory allergy in childhood: the applicability of saliva 10/12/2013 to study the effect of environmental exposures on DNA methylation Dr. Sabine A.S. Langie Flemish Institute
More informationEpigenetics: The Future of Psychology & Neuroscience. Richard E. Brown Psychology Department Dalhousie University Halifax, NS, B3H 4J1
Epigenetics: The Future of Psychology & Neuroscience Richard E. Brown Psychology Department Dalhousie University Halifax, NS, B3H 4J1 Nature versus Nurture Despite the belief that the Nature vs. Nurture
More informationDiscordance for exposures and disease phenotypes
Discordance for exposures and disease phenotypes To what extent can easilyaccessible peripheral tissues/cells (e.g. whole blood, saliva, buccal) be used as a proxy for inaccessible tissues/cells? UK Brain
More informationIso-Seq Method Updates and Target Enrichment Without Amplification for SMRT Sequencing
Iso-Seq Method Updates and Target Enrichment Without Amplification for SMRT Sequencing PacBio Americas User Group Meeting Sample Prep Workshop June.27.2017 Tyson Clark, Ph.D. For Research Use Only. Not
More informationStem Cell Epigenetics
Stem Cell Epigenetics Philippe Collas University of Oslo Institute of Basic Medical Sciences Norwegian Center for Stem Cell Research www.collaslab.com Source of stem cells in the body Somatic ( adult )
More informationSession 4 Rebecca Poulos
The Cancer Genome Atlas (TCGA) & International Cancer Genome Consortium (ICGC) Session 4 Rebecca Poulos Prince of Wales Clinical School Introductory bioinformatics for human genomics workshop, UNSW 28
More information2009 LANDES BIOSCIENCE. DO NOT DISTRIBUTE.
[Epigenetics 4:2, 1-6; 16 February 2009]; 2009 Landes Bioscience Research Paper Determining the conservation of DNA methylation in Arabidopsis This manuscript has been published online, prior to printing.once
More informationVariation in 5-hydroxymethylcytosine across human cortex and cerebellum
Cover art produced by Helen Spiers (www.helenspiers.com) Variation in 5-hydroxymethylcytosine across human cortex and cerebellum Lunnon et al. Lunnon et al. Genome Biology (2016) 17:27 DOI 10.1186/s13059-016-0871-x
More informationCopyright 2014 The Authors.
n Lund, K., Cole, J., VanderKraats, N. D., McBryan, T., Pchelintsev, N. A., Clark, W., Copland, M., Edwards, J. R., and Adams, P.(214) DNMT inhibitors reverse a specific signature of aberrant promoter
More informationNot IN Our Genes - A Different Kind of Inheritance.! Christopher Phiel, Ph.D. University of Colorado Denver Mini-STEM School February 4, 2014
Not IN Our Genes - A Different Kind of Inheritance! Christopher Phiel, Ph.D. University of Colorado Denver Mini-STEM School February 4, 2014 Epigenetics in Mainstream Media Epigenetics *Current definition:
More informationIdentification of endometrial cancer methylation features using a combined. methylation analysis method DISSERTATION
Identification of endometrial cancer methylation features using a combined methylation analysis method DISSERTATION Presented in Partial Fulfillment of the Requirements for the Degree Doctor of Philosophy
More informationVega: Variational Segmentation for Copy Number Detection
Vega: Variational Segmentation for Copy Number Detection Sandro Morganella Luigi Cerulo Giuseppe Viglietto Michele Ceccarelli Contents 1 Overview 1 2 Installation 1 3 Vega.RData Description 2 4 Run Vega
More informationBST227 Introduction to Statistical Genetics. Lecture 4: Introduction to linkage and association analysis
BST227 Introduction to Statistical Genetics Lecture 4: Introduction to linkage and association analysis 1 Housekeeping Homework #1 due today Homework #2 posted (due Monday) Lab at 5:30PM today (FXB G13)
More informationFragile X Syndrome. Genetics, Epigenetics & the Role of Unprogrammed Events in the expression of a Phenotype
Fragile X Syndrome Genetics, Epigenetics & the Role of Unprogrammed Events in the expression of a Phenotype A loss of function of the FMR-1 gene results in severe learning problems, intellectual disability
More informationDominic J Smiraglia, PhD Department of Cancer Genetics. DNA methylation in prostate cancer
Dominic J Smiraglia, PhD Department of Cancer Genetics DNA methylation in prostate cancer Overarching theme Epigenetic regulation allows the genome to be responsive to the environment Sets the tone for
More informationDissecting gene regulation network in human early embryos. at single-cell and single-base resolution
Dissecting gene regulation network in human early embryos at single-cell and single-base resolution Fuchou Tang BIOPIC, College of Life Sciences Peking University 07/10/2015 Cockburn and Rossant, 2010
More informationEpigenetic programming in chronic lymphocytic leukemia
Epigenetic programming in chronic lymphocytic leukemia Christopher Oakes 10 th Canadian CLL Research Meeting September 18-19 th, 2014 Epigenetics and DNA methylation programming in normal and tumor cells:
More informationAN INTRODUCTION TO EPIGENETICS DR CHLOE WONG
AN INTRODUCTION TO EPIGENETICS DR CHLOE WONG MRC SGDP CENTRE, INSTITUTE OF PSYCHIATRY KING S COLLEGE LONDON Oct 2015 Lecture Overview WHY WHAT EPIGENETICS IN PSYCHIARTY Technology-driven genomics research
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nature19360 Supplementary Tables Supplementary Table 1. Number of monoclonal reads in each sample Sample Number of cells Total reads Aligned reads Monoclonal reads
More informationNature Structural & Molecular Biology: doi: /nsmb.2419
Supplementary Figure 1 Mapped sequence reads and nucleosome occupancies. (a) Distribution of sequencing reads on the mouse reference genome for chromosome 14 as an example. The number of reads in a 1 Mb
More informationIntroduction of Genome wide Complex Trait Analysis (GCTA) Presenter: Yue Ming Chen Location: Stat Gen Workshop Date: 6/7/2013
Introduction of Genome wide Complex Trait Analysis (GCTA) resenter: ue Ming Chen Location: Stat Gen Workshop Date: 6/7/013 Outline Brief review of quantitative genetics Overview of GCTA Ideas Main functions
More informationPREPARED FOR: U.S. Army Medical Research and Materiel Command Fort Detrick, Maryland
AD Award Number: W81XWH-12-1-0298 TITLE: MTHFR Functional Polymorphism C677T and Genomic Instability in the Etiology of Idiopathic Autism in Simplex Families PRINCIPAL INVESTIGATOR: Xudong Liu, PhD CONTRACTING
More informationChromHMM Tutorial. Jason Ernst Assistant Professor University of California, Los Angeles
ChromHMM Tutorial Jason Ernst Assistant Professor University of California, Los Angeles Talk Outline Chromatin states analysis and ChromHMM Accessing chromatin state annotations for ENCODE2 and Roadmap
More informationSession 6: Integration of epigenetic data. Peter J Park Department of Biomedical Informatics Harvard Medical School July 18-19, 2016
Session 6: Integration of epigenetic data Peter J Park Department of Biomedical Informatics Harvard Medical School July 18-19, 2016 Utilizing complimentary datasets Frequent mutations in chromatin regulators
More informationSupervised Learner for the Prediction of Hi-C Interaction Counts and Determination of Influential Features. Tyler Yue Lab
Supervised Learner for the Prediction of Hi-C Interaction Counts and Determination of Influential Features Tyler Derr @ Yue Lab tsd5037@psu.edu Background Hi-C is a chromosome conformation capture (3C)
More informationQIAGEN's Growing Immuno-Oncology Testing Portfolio
QIAGEN's Growing Immuno-Oncology Testing Portfolio QIAGEN Your Partner in Translational Medicine Current Biomarkers of Immuno-Oncology Focus: Immuno-Oncology Testing Portfolio Tumor mutation burden (TMB)
More informationsirna count per 50 kb small RNAs matching the direct strand Repeat length (bp) per 50 kb repeats in the chromosome
Qi et al. 26-3-2564C Qi et al., Figure S1 sirna count per 5 kb small RNAs matching the direct strand sirna count per 5 kb small RNAs matching the complementary strand Repeat length (bp) per 5 kb repeats
More informationResearch Article Power Estimation for Gene-Longevity Association Analysis Using Concordant Twins
Genetics Research International, Article ID 154204, 8 pages http://dx.doi.org/10.1155/2014/154204 Research Article Power Estimation for Gene-Longevity Association Analysis Using Concordant Twins Qihua
More informationRare Variant Burden Tests. Biostatistics 666
Rare Variant Burden Tests Biostatistics 666 Last Lecture Analysis of Short Read Sequence Data Low pass sequencing approaches Modeling haplotype sharing between individuals allows accurate variant calls
More informationThe Epigenome Tools 2: ChIP-Seq and Data Analysis
The Epigenome Tools 2: ChIP-Seq and Data Analysis Chongzhi Zang zang@virginia.edu http://zanglab.com PHS5705: Public Health Genomics March 20, 2017 1 Outline Epigenome: basics review ChIP-seq overview
More informationRole of CpG deserts in the epigenetic transgenerational inheritance of differential DNA methylation regions
Skinner and Guerrero-Bosagna BMC Genomics 2014, 15:692 RESEARCH ARTICLE Open Access Role of CpG deserts in the epigenetic transgenerational inheritance of differential DNA methylation regions Michael K
More informationEuropean Educational Programme in Epidemiology
European Educational Programme in Epidemiology 32 nd RESIDENTIAL SUMMER COURSE FLORENCE, ITALY Specialized Courses 8 12 JULY 2019 1/15 European Educational Programme in Epidemiology Specialized Courses:
More informationReference-free deconvolution of DNA methylation data and mediation by cell composition effects
Houseman et al. BMC Bioinformatics (2016) 17:259 DOI 10.1186/s12859-016-1140-4 METHODOLOGY ARTICLE Open Access Reference-free deconvolution of DNA methylation data and mediation by cell composition effects
More information1/19/18. Questions to you by Alfredo & Bart. Epigenetic mechanisms regulate gene expression. Epigenetics & environmental exposures
Questions to you by Alfredo & Bart Epigenetics in Neurodegeneration: Contributor or Bystander? Prof. dr. Bart Rutten Neuroscience of Mental Illness Chair Department Psychiatry and Neuropsychology b.rutten@maastrichtuniversity.nl
More informationBig Data in Cancer: Curse or Cure? Roland Eils
Big Data in Cancer: Curse or Cure? Roland Eils 28.06.2016 Roland Eils 28.06.2016 Roland Eils ICGC Goal: To obtain a comprehensive description of genomic, transcriptomic and epigenomic changes in 50 different
More informationSUPPLEMENTARY FIGURE 1: f-i
SUPPLEMENTARY FIGURE 1: Comparisons of the biological replicates of ChIP-seq, Input and Bisulfite-seq. (a) Density plot of MeCP2 ChIP-seq genome coverage (calculated using tiled 15 bp windows) shows high
More informationPatterns of Histone Methylation and Chromatin Organization in Grapevine Leaf. Rachel Schwope EPIGEN May 24-27, 2016
Patterns of Histone Methylation and Chromatin Organization in Grapevine Leaf Rachel Schwope EPIGEN May 24-27, 2016 What does H3K4 methylation do? Plant of interest: Vitis vinifera Culturally important
More informationExercises: Differential Methylation
Exercises: Differential Methylation Version 2018-04 Exercises: Differential Methylation 2 Licence This manual is 2014-18, Simon Andrews. This manual is distributed under the creative commons Attribution-Non-Commercial-Share
More informationIntroduction to Cancer Bioinformatics and cancer biology. Anthony Gitter Cancer Bioinformatics (BMI 826/CS 838) January 20, 2015
Introduction to Cancer Bioinformatics and cancer biology Anthony Gitter Cancer Bioinformatics (BMI 826/CS 838) January 20, 2015 Why cancer bioinformatics? Devastating disease, no cure on the horizon Major
More informationWorkgroup Webinar Tuesday, May 26, :00 p.m.
NIDA Strategic Planning Gene x Environment x Development Interactions (GEDI) Co-Chairs: Naimah Weinberg and Jonathan Pollock SPB Coordinator: Michele Rankin Workgroup Webinar Tuesday, May 26, 2015 3:00
More informationMATERNAL INFLUENCES ON OFFSPRING S EPIGENETIC AND LATER BODY COMPOSITION
Institute of Medicine & National Research Council Food and Nutrition Board & Board on Children, Youth & Families Examining a Developmental Approach to Childhood Obesity: The Fetal & Early Childhood Years
More informationAn introduction to Epigenetics and Psychology
An introduction to Epigenetics and Psychology Dr Emma Meaburn e.meaburn@bbk.ac.uk Centre for Brain and Cognitive Development Department of Psychological Sciences Birkbeck, University of London Learning
More informationEpigenetics and Chromatin Remodeling
Epigenetics and Chromatin Remodeling Bradford Coffee, PhD, FACMG Emory University Atlanta, GA Speaker Disclosure Information Grant/Research Support: none Salary/Consultant Fees: none Board/Committee/Advisory
More informationGenome-Wide Localization of Protein-DNA Binding and Histone Modification by a Bayesian Change-Point Method with ChIP-seq Data
Genome-Wide Localization of Protein-DNA Binding and Histone Modification by a Bayesian Change-Point Method with ChIP-seq Data Haipeng Xing, Yifan Mo, Will Liao, Michael Q. Zhang Clayton Davis and Geoffrey
More informationBenefits and pitfalls of new genetic tests
Benefits and pitfalls of new genetic tests Amanda Krause Division of Human Genetics, NHLS and University of the Witwatersrand Definition of Genetic Testing the analysis of human DNA, RNA, chromosomes,
More informationUKnowledge. University of Kentucky. Matthew Rea University of Kentucky, Meredith Eckstein University of Kentucky,
University of Kentucky UKnowledge Molecular and Cellular Biochemistry Faculty Publications Molecular and Cellular Biochemistry 2-2-2017 Genome-Wide DNA Methylation Reprogramming in Response to Inorganic
More informationSupplementary Fig.S1. MeDIP RPKM distribution of 5kb windows. Relative expression of DNMT. Percentage of genome. (fold change)
Supplementary Fig.S1 Percentage of genome 10% 8% 6% 4% 2% 0 MeDIP RPKM distribution of 5kb windows 0 0. 0.5 0.75 >1 MeDIP RPKM value EC Relative expression of DNMT (fold change) 12 6 4 3 2 1 EC DNMT1 DNMT2
More informationIncreased methylation variation in epigenetic domains across cancer types
Increased methylation variation in epigenetic domains across cancer types Kasper Daniel Hansen 1,2,1, Winston Timp 2 4,1, Héctor Corrada Bravo 2,5,1, Sarven Sabunciyan 2,6,1, Benjamin Langmead 1,2,1, Oliver
More informationSupplementary Information
Supplementary Information 5-hydroxymethylcytosine-mediated epigenetic dynamics during postnatal neurodevelopment and aging By Keith E. Szulwach 1,8, Xuekun Li 1,8, Yujing Li 1, Chun-Xiao Song 2, Hao Wu
More informationIntrauterine calorie restriction affects placental DNA methylation and gene expression
Physiol Genomics 45: 565 576, 2013. First published May 21, 2013; doi:10.1152/physiolgenomics.00034.2013. CALL FOR PAPERS of Physiological Systems NextGen Sequencing Technology-based Dissection Intrauterine
More informationLocally Disordered Methylation Forms the Basis of Intratumor Methylome Variation in Chronic Lymphocytic Leukemia
Article Locally Disordered Methylation Forms the Basis of Intratumor Methylome Variation in Chronic Lymphocytic Leukemia Dan A. Landau, 1,2,3,13 Kendell Clement, 3,4,5,13 Michael J. Ziller, 3,4 Patrick
More informationPerinatal maternal alcohol consumption and methylation of the dopamine receptor DRD4 in the offspring: The Triple B study
Perinatal maternal alcohol consumption and methylation of the dopamine receptor DRD4 in the offspring: The Triple B study Elizabeth Elliott for the Triple B Research Consortium NSW, Australia: Peter Fransquet,
More informationSession 2: Biomarkers of epigenetic changes and their applicability to genetic toxicology
Session 2: Biomarkers of epigenetic changes and their applicability to genetic toxicology Bhaskar Gollapudi, Ph.D The Dow Chemical Company Workshop: Genetic Toxicology: Opportunities to Integrate New Approaches
More informationGenome-wide analysis of the DNA methylation landscape in human tissues
Genome-wide analysis of the DNA methylation landscape in human tissues Volkov, Petr Published: 2016-01-01 Document Version Publisher's PDF, also known as Version of record Link to publication Citation
More informationStatistical Analysis of Single Nucleotide Polymorphism Microarrays in Cancer Studies
Statistical Analysis of Single Nucleotide Polymorphism Microarrays in Cancer Studies Stanford Biostatistics Workshop Pierre Neuvial with Henrik Bengtsson and Terry Speed Department of Statistics, UC Berkeley
More information