Back to the Basics: Methyl-Seq 101
|
|
|
- Blaise Jennings
- 5 years ago
- Views:
Transcription
1 Back to the Basics: Methyl-Seq 101 Presented By: Alex Siebold, Ph.D. October 9, 2013 Field Applications Scientist Agilent Technologies Life Sciences & Diagnostics Group Life Sciences & Diagnostics Group CAG Agilent EMEAI Technologies Agilent Restricted Page 11
2 Back to the Basics: Agilent s Five Part 101 eseminar Series Event Date & Time Speaker Topics NGS Data Analysis 101 Thu, Oct 10 1 pm ET Jean Jasinski, PhD Field Application Scientist Analysis Workflows, File Formats, and Data Filtering DNA-Seq vs. RNA-Seq Considerations Integrating Disparate Data Sets to Create a More Complete Story NGS Panels 101 Fri, Oct 11 1 pm ET Adam Hauge, University of Minnesota Panel Design Process Quality at the Bench: Tips, Tricks, and Lessons Learned Considerations for Future Panels Life Sciences & Diagnostics Group CAG Agilent EMEAI Technologies Agilent Restricted Page 22
3 Topics for Today s Presentation 1 Epigenetics & DNA Methylation 2 Technology Behind SureSelect XT 3 SureSelect XT Human Methyl-seq 4 Comparing DNA Methylation Methods 5 GeneSpring & Additional TE Solutions 6 Summary & Upcoming 101 eseminars Not approved for use in diagnostic procedures Life Sciences & Diagnostics Group CAG Agilent EMEAI Technologies Agilent Restricted Page 33
4 Defining Epigenetics & Epigenetic Protein Functions Epigenetics: Studies changes in gene expression caused by mechanisms that do not effect the underlying DNA sequence - ex: DNA Methylation and Covalent Modification of Histone Tails DNMT1 (DNA Methyltransferse) MLL (Histone Methyltransferse) Methyl CpG Binding Proteins (MBD s) CBX7 (Chromodomain) BRD4 (Bromodomain) DNA Demethylation HDAC s (Histone deacetylases) UTX (Histone demethylase) Life Sciences & Diagnostics Group CAG Agilent EMEAI Technologies Agilent Restricted Page 44
5 DNA Methylation: An Epigenetic Modification Found in animals, plants, bacteria, fungi, etc Initially thought to be a static modification, but is dynamic Important in Development and Cellular Differentiation Promotes Gene Silencing Aberrant DNA methylation contributes to a host of diseases, including cancer Life Sciences & Diagnostics Group CAG Agilent EMEAI Technologies Agilent Restricted Page 55
6 CpG Dinucleotides & Their Genomic Locations CpG islands High frequency of CpG dinucleotides > 500bp & GC content >55% & observed/expected CpG ratio > 0.65 In or near about 40% of promoters of mammalian genes Promoters 75% of transcriptional start sites have CpG-rich regions 88% of active promoters are associated with CpG-rich sequences Life Sciences & Diagnostics Group CAG Agilent EMEAI Technologies Agilent Restricted Page 66
7 Differentially Methylated Regions (DMRs) CpG islands 4~8 % tissue-specific differentially methylated regions or T-DMR CpG island shores ~2kb away from islands, 76% of T-DMRs in shores CpG island shelves ~4 kb away from islands Irizarry RA et al. Nature Genetics 2009 HS3ST4 : heparan sulfate D- glucosaminyl 3-Osulfotransferase 4 Life Sciences & Diagnostics Group CAG Agilent EMEAI Technologies Agilent Restricted Page 77
8 The Study of Epigenetics & How it Relates to the Clinic DNA Methylation has a rapidly growing role in cancers and other diseases Pharma & Biotech are actively seeking new small molecules that inhibit certain classes of epigenetic enzymes FDA Approved Epigenetic Therapies Vidaza & Dacogen: Inhibit DNA Methyltransferases Vorinostat & Romidepsin: Inhibit Histone Deacetylases Life Sciences & Diagnostics Group CAG Agilent EMEAI Technologies Agilent Restricted Page 88
9 Impact of Adding Methylation Assays to Your Current Research Better understand the link between environment and genetics Obtain the complete picture of a gene and its impact on the pathogenesis of cancer or other disease state Not approved for Life Sciences & Diagnostics Group CAG Agilent EMEAI Technologies Agilent Restricted Page 99
10 Topics for Today s Presentation 1 Epigenetics & DNA Methylation 2 Technology Behind SureSelect XT 3 SureSelect XT Human Methyl-seq 4 Comparing DNA Methylation Methods 5 GeneSpring & Additional TE Solutions 6 Summary & Upcoming 101 eseminars Not approved for use in diagnostic procedures Life Sciences & Diagnostics Group CAG Agilent EMEAI Technologies Agilent Restricted Page 10 10
11 The Power Behind the Performance Agilent s Core Competency: Oligo Library Synthesis (OLS) HP Inkjet Printer Technology + Proprietary Chemistry = Long High-Quality Oligos (SurePrint Technology) Agilent s SureSelect Platform Utilizes 120bp Oligos Life Sciences & Diagnostics Group CAG Agilent EMEAI Technologies Agilent Restricted Page 11 11
12 Target Enrichment: It s just like fishing Why perform target enrichment? 1. Sequence only your desired regions of interest (Exons, gene panels, intergenic regions etc...)! 2. Sequence more samples per lane/run (i.e. Multiplex) 3. Save time and money 4. Faster time to results = Smaller datasets 5. Identify variants in samples with increased reliability and accuracy: More Reads in regions of interest = Higher Depth of Coverage Life Sciences & Diagnostics Group CAG Agilent EMEAI Technologies Agilent Restricted Page 12 12
13 SureSelect DNA SureSelect: In-Solution Target Enrichment Nat Biotechnol Feb;27(2): Life Sciences & Diagnostics Group CAG Agilent EMEAI Technologies Agilent Restricted Page 13 13
14 SureSelect DNA SureSelect: In-Solution Target Enrichment Nat Biotechnol Feb;27(2): Life Sciences & Diagnostics Group CAG Agilent EMEAI Technologies Agilent Restricted Page 14 14
15 Target Enrichment Maximizes Your Sequencing Efficiency Genome Size x Desired Depth of Coverage = Required Seq Depth/Sample Human Genome 3Gb x 30 = 90Gb Illumina HiSeq FlowCell Illumina HiSeq Gb/lane ~ 3 lanes per sample! $$$$$ Life Sciences & Diagnostics Group CAG Agilent EMEAI Technologies Agilent Restricted Page 15 15
16 Target Enrichment Maximizes Your Sequencing Efficiency Target Size x Desired Depth of Coverage = Required Seq Depth/Sample v Human Genome 3Gb x 30 = 90Gb Target = 50Mb x 100 = 5Gb Target = 5Mb x 100 = 500Mb Illumina HiSeq FlowCell Target = 500Kb x 100 = 50Mb Target = 50Kb x 100 = 5Mb Develop designs/panels for any sequencing capacity: - High Throughput or Desktop Illumina HiSeq Gb/lane Life Sciences & Diagnostics Group CAG Agilent EMEAI Technologies Agilent Restricted Page 16 16
17 Topics for Today s Presentation 1 Epigenetics & DNA Methylation 2 Technology Behind SureSelect XT 3 SureSelect XT Human Methyl-seq 4 Comparing DNA Methylation Methods 5 GeneSpring & Additional TE Solutions 6 Summary & Upcoming 101 eseminars Not approved for use in diagnostic procedures Life Sciences & Diagnostics Group CAG Agilent EMEAI Technologies Agilent Restricted Page 17 17
18 SureSelect XT Human Methyl-Seq DESIGN CONTENT - 84 Mb Design, Discovery Tool Not methylation-state dependent No prior knowledge needed Comprehensive design Not limited to CpG Islands Comprehensive Content CpG Islands, Promoters and DMRs 3.7M CpGs CpG islands Cancer, Tissue-specific DMRs GENCODe promoters DMRs or regulatory features in: CpG Islands, shores and shelves ±4kb DNAseI hypersensitive sites Refseq Genes Ensembl Regulatory Features Life Sciences & Diagnostics Group CAG Agilent EMEAI Technologies Agilent Restricted Page 18 18
19 SureSelect XT Human Methyl-Seq Bait design Life Sciences & Diagnostics Group CAG Agilent EMEAI Technologies Agilent Restricted Page 19 19
20 SureSelect XT Methyl-Seq Workflow me me A me me A me me me me DNA Shearing, End Repair & A addition madapter ligation SureSelect Hyb (24hr) Bisulfite treatment Library Quant and PCR Sequence No PCR before Bisulfite treatment to preserve the Methylation state Bisulfite treatment is performed after hybridization to maximize sample complexity Life Sciences & Diagnostics Group CAG Agilent EMEAI Technologies Agilent Restricted Page 20 20
21 Proof of Concept: HCT116 vs Methyltransferase DKO Highly sensitive and accurate methylation detection after SureSelect target enrichment demonstrated DNA methylation differences between HCT116 human colon cancer cells and its methyltransferase double-knockout (DNMT1-/- and DNMT3b-/-). Life Sciences & Diagnostics Group CAG Agilent EMEAI Technologies Agilent Restricted Page 21 21
22 Proof of Concept: Methylation of Metalloproteinase inhibitor 3 Life Sciences & Diagnostics Group CAG Agilent EMEAI Technologies Agilent Restricted Page 22 22
23 Proof of Concept: Identifying Tissue Specific DMRs Life Sciences & Diagnostics Group CAG Agilent EMEAI Technologies Agilent Restricted Page 23 23
24 SureSelect XT Methyl-Seq Capture Performance 10Gb Sequencing per Sample Percentage reads in targeted regions: 82.0% Percentage reads in regions +/- 100bp: 93.6% Percent of genome targeted: 2.7% Enrichment in targeted regions: Uniformity (3/4 mean with upper tail): 91.4% Number of bases in targeted regions: 84,367,621 Percentage of targeted bases covered by......at least 1 read: 98.7%...at least 10 reads: 91.4%...at least 20 reads: 78.9% Life Sciences & Diagnostics Group CAG Agilent EMEAI Technologies Agilent Restricted Page 24 24
25 Topics for Today s Presentation 1 Epigenetics & DNA Methylation 2 Technology Behind SureSelect XT 3 SureSelect XT Human Methyl-seq 4 Comparing DNA Methylation Methods 5 GeneSpring & Additional TE Solutions 6 Summary & Upcoming 101 eseminars Not approved for use in diagnostic procedures Life Sciences & Diagnostics Group CAG Agilent EMEAI Technologies Agilent Restricted Page 25 25
26 Comparative Publication Of Methyl Assays: Nature Biotech. (28), pp: : (2010) Life Sciences & Diagnostics Group CAG Agilent EMEAI Technologies Agilent Restricted Page 26 26
27 Whole Genome Bisulfite Sequencing (WGBS) Whole Genome Coverage But costly and time consuming Requires extensive bioinformatics Limited scalability per run Life Sciences & Diagnostics Group CAG Agilent EMEAI Technologies Agilent Restricted Page 27 27
28 MeDip-Seq & Reduced Representation BiSulfite Sequencing (RRBS) Limitations Difficult to target specific regions (i.e. DMRs in Shelf and Shore regions) Biased towards methylated regions, Repeat sequences & CpG-rich sequences Can miss under-methylated regions Difficult to design since knowledge of methylation state for the target region is needed Life Sciences & Diagnostics Group CAG Agilent EMEAI Technologies Agilent Restricted Page 28 28
29 Microarray-Based Method: Infinium 450K Array Improved cost and throughput vs. whole-genome bisulfite sequencing Not whole-genome (~480K Features) Does not cover shores and shelves known to house important DMRs CpG Rich Regions are hard to resolve at single base resolution What are you missing? Life Sciences & Diagnostics Group CAG Agilent EMEAI Technologies Agilent Restricted Page 29 29
30 SureSelect XT Methyl-Seq What if you could: reduce cost/sample Interrogate regions more efficiently than WGBS Confidently identify both Hyper & Hypo methylated regions in a single experiment Have increased scalability Achieve high depth of coverage to confidently make methyl calls Life Sciences & Diagnostics Group CAG Agilent EMEAI Technologies Agilent Restricted Page 30 30
31 Methyl-Seq Comparison with published WGBS data Cell line: IMR90 (female lung fibroblast) Life Sciences & Diagnostics Group CAG Agilent EMEAI Technologies Agilent Restricted Page 31 31
32 SureSelect Methyl-seq vs. Whole-Genome Bisulfite Sequencing Life Sciences & Diagnostics Group CAG Agilent EMEAI Technologies Agilent Restricted Page 32 32
33 Concordance between WGBS data & SureSelect Methyl-Seq R = Excellent concordance with whole genome bisulfite sequencing data. Life Sciences & Diagnostics Group CAG Agilent EMEAI Technologies Agilent Restricted Page 33 33
34 Excellent Reproducibility Excellent reproducibility for IMR90 Replicate 1 vs. 2 Life Sciences & Diagnostics Group CAG Agilent EMEAI Technologies Agilent Restricted Page 34 34
35 SureSelect XT Complete Workflow Solution Library Prep Target Enrich. Indexes SureSelect XT Human Methyl-Seq Life Sciences & Diagnostics Group CAG Agilent EMEAI Technologies Agilent Restricted Page 35 35
36 Topics for Today s Presentation 1 Epigenetics & DNA Methylation 2 Technology Behind SureSelect XT 3 SureSelect XT Human Methyl-seq 4 Comparing DNA Methylation Methods 5 GeneSpring & Additional TE Solutions 6 Summary & Upcoming 101 eseminars Not approved for use in diagnostic procedures Life Sciences & Diagnostics Group CAG Agilent EMEAI Technologies Agilent Restricted Page 36 36
37 Integrated Biology Applications in GeneSpring Including Methyl-Seq Analysis! Life Sciences & Diagnostics Group CAG Agilent EMEAI Technologies Agilent Restricted Page 37 37
38 Integrated Biology Applications in GeneSpring Including Methyl-Seq Analysis! Life Sciences & Diagnostics Group CAG Agilent EMEAI Technologies Agilent Restricted Page 38 38
39 SureSelect DNA & RNA Additional Target Enrichment Solutions: SureSelect XT Targets Kits Species Capture Exomes DNA Methylation 50Mb (V3) V4, V4+UTR V5, V5+UTR (NEW!) Human Methyl-Seq (84Mb) Mouse Methyl-Seq (100Mb) Human, Mouse, Zebrafish, bovine, dog Human Mouse (EA) Each Kit has a unique ELID identifying number DNA-Seq DNA-Seq Kinome DNA or RNA ~3 Mb Human DNA or RNA-Seq Custom Regions Focused Panels >0.2 Mb to 34 Mb Any DNA or RNA-Seq >0.2 Mb to 34 Mb Any DNA or RNA-Seq All kit design files can be easily retrieved from Agilent SureDesign Access SureDesign to create your own custom captures for FREE! Life Sciences & Diagnostics Group CAG Agilent EMEAI Technologies Agilent Restricted Page 39 39
40 Topics for Today s Presentation 1 Epigenetics & DNA Methylation 2 Technology Behind SureSelect XT 3 SureSelect XT Human Methyl-seq 4 Comparing DNA Methylation Methods 5 GeneSpring & Additional TE Solutions 6 Summary & Upcoming 101 eseminars Not approved for use in diagnostic procedures Life Sciences & Diagnostics Group CAG Agilent EMEAI Technologies Agilent Restricted Page 40 40
41 SureSelect XT Human Methyl-Seq Summary Covers more individual relevant CpGs compared to Methylation microarrays Reveals methylated regions undetected by RRBS and Me-Dip Increases throughput, reduces costs compared to WGBS and allows better usage of sequence capacity Produces higher quality data than WGBS, deeper reads, faster analysis Identification of DMR in relevant genes can lead to discovery of useful biomarkers Life Sciences & Diagnostics Group CAG Agilent EMEAI Technologies Agilent Restricted Page 41 41
42 A Beginner s Glossary for Methyl-seq: Walk the walk, talk the talk 1. Epigenetics The study of changes in gene expression that are caused by mechanisms that do not effect the underlying DNA sequence. Examples include covalent modification to histones tails and the methylation of DNA. 2. Epigenetics Writers Individual enzymes or protein complexes that facilitate the establishment of covalent modifications to DNA or histones. Examples include DNA methyltransferase and histone methyltransferase. 3. Epigenetic Readers - Proteins that identify specific epigenetic marks and either directly bind to or recruit proteins to bind to them in order to modulate gene expression. Examples include methyl CpG binding proteins or members of the Polycomb and Trithorax group proteins. 4. Epigenetic Erasers Proteins that can remove covalent modifications to DNA and histones. 5. CpGs Regions of the genome where cytosines precede guanines along the linear DNA sequence. The p in the CpG annotation stands for phosphate which means the cytosine nucleotide occurs 5 of the guanine nucleotide. This nomenclature is used to prevent confusion since cytosines form Watson-Crick base pairing with guanines, which are not sites for DNA methylation. 6. CpG Islands Regions of the genome, typically >500bp, that contain a high density of CpG dinucleotide sequences. 7. CpG Island Shores Term that describing the regions of differentially methylated CpG dinucleotides which occur approximately 2 kb away from annotated CpG islands. 8. CpG Island Shelves Similar to CpG shores, however these regions are found even further from annotated CpG islands in the genome, approximately 4 kb away from annotated CpG islands. 9. DMRs Referring to Differentially Methylated Regions of the genome. Not approved for use in diagnostic procedures Life Sciences & Diagnostics Group CAG Agilent EMEAI Technologies Agilent Restricted Page 42 42
43 Agilent Technologies Knows NGS 101 & More Offering Complete Solutions for NGS Workflows The Gold Standard for Sample QC The Leader in NGS Target Enrichment 2100 Bioanalyzer Instrument & Kits 2200 TapeStation Instrument & Kits SureDesign SureSelect HaloPlex Bravo Automation NGS Analysis Software GeneSpring NGS SureCall Validation Technologies qpcr- Mx system & Brilliant reagents Microarrays- CGH, CGH+SNP, Gene Expression & mirna Life Sciences & Diagnostics Group CAG Agilent EMEAI Technologies Agilent Restricted Page 43 43
44 Back to the Basics: Agilent s Five Part 101 eseminar Series Continues Event Date & Time Speaker Topics NGS Data Analysis 101 Thu, Oct 10 1 pm ET Jean Jasinski, PhD Field Application Scientist Analysis Workflows, File Formats, and Data Filtering DNA-Seq vs. RNA-Seq Considerations Integrating Disparate Data Sets to Create a More Complete Story NGS Panels 101 Fri, Oct 11 1 pm ET Adam Hauge, University of Minnesota Panel Design Process Quality at the Bench: Tips, Tricks, and Lessons Learned Considerations for Future Panels Life Sciences & Diagnostics Group CAG Agilent EMEAI Technologies Agilent Restricted Page 44 44
45 Contact Us Life Sciences & Diagnostics Group CAG Agilent EMEAI Technologies Agilent Restricted Page 45 45
Cytogenetics 101: Clinical Research and Molecular Genetic Technologies
Cytogenetics 101: Clinical Research and Molecular Genetic Technologies Topics for Today s Presentation 1 Classical vs Molecular Cytogenetics 2 What acgh? 3 What is FISH? 4 What is NGS? 5 How can these
Advance Your Genomic Research Using Targeted Resequencing with SeqCap EZ Library
Advance Your Genomic Research Using Targeted Resequencing with SeqCap EZ Library Marilou Wijdicks International Product Manager Research For Life Science Research Only. Not for Use in Diagnostic Procedures.
EPIGENOMICS PROFILING SERVICES
EPIGENOMICS PROFILING SERVICES Chromatin analysis DNA methylation analysis RNA-seq analysis Diagenode helps you uncover the mysteries of epigenetics PAGE 3 Integrative epigenomics analysis DNA methylation
AVENIO family of NGS oncology assays ctdna and Tumor Tissue Analysis Kits
AVENIO family of NGS oncology assays ctdna and Tumor Tissue Analysis Kits Accelerating clinical research Next-generation sequencing (NGS) has the ability to interrogate many different genes and detect
Investigating rare diseases with Agilent NGS solutions
Investigating rare diseases with Agilent NGS solutions Chitra Kotwaliwale, Ph.D. 1 Rare diseases affect 350 million people worldwide 7,000 rare diseases 80% are genetic 60 million affected in the US, Europe
Not IN Our Genes - A Different Kind of Inheritance.! Christopher Phiel, Ph.D. University of Colorado Denver Mini-STEM School February 4, 2014
Not IN Our Genes - A Different Kind of Inheritance! Christopher Phiel, Ph.D. University of Colorado Denver Mini-STEM School February 4, 2014 Epigenetics in Mainstream Media Epigenetics *Current definition:
Results. Abstract. Introduc4on. Conclusions. Methods. Funding
. expression that plays a role in many cellular processes affecting a variety of traits. In this study DNA methylation was assessed in neuronal tissue from three pigs (frontal lobe) and one great tit (whole
Simple, rapid, and reliable RNA sequencing
Simple, rapid, and reliable RNA sequencing RNA sequencing applications RNA sequencing provides fundamental insights into how genomes are organized and regulated, giving us valuable information about the
Multiplex target enrichment using DNA indexing for ultra-high throughput variant detection
Multiplex target enrichment using DNA indexing for ultra-high throughput variant detection Dr Elaine Kenny Neuropsychiatric Genetics Research Group Institute of Molecular Medicine Trinity College Dublin
Analysis of shotgun bisulfite sequencing of cancer samples
Analysis of shotgun bisulfite sequencing of cancer samples Kasper Daniel Hansen Postdoc with Rafael Irizarry Johns Hopkins Bloomberg School of Public Health Brixen, July 1st, 2011 The
AVENIO ctdna Analysis Kits The complete NGS liquid biopsy solution EMPOWER YOUR LAB
Analysis Kits The complete NGS liquid biopsy solution EMPOWER YOUR LAB Analysis Kits Next-generation performance in liquid biopsies 2 Accelerating clinical research From liquid biopsy to next-generation
R. Piazza (MD, PhD), Dept. of Medicine and Surgery, University of Milano-Bicocca EPIGENETICS
R. Piazza (MD, PhD), Dept. of Medicine and Surgery, University of Milano-Bicocca EPIGENETICS EPIGENETICS THE STUDY OF CHANGES IN GENE EXPRESSION THAT ARE POTENTIALLY HERITABLE AND THAT DO NOT ENTAIL A
Computational Analysis of UHT Sequences Histone modifications, CAGE, RNA-Seq
Computational Analysis of UHT Sequences Histone modifications, CAGE, RNA-Seq Philipp Bucher Wednesday January 21, 2009 SIB graduate school course EPFL, Lausanne ChIP-seq against histone variants: Biological
Small RNA Sequencing. Project Workflow. Service Description. Sequencing Service Specification BGISEQ-500 SERVICE OVERVIEW SAMPLE PREPARATION
BGISEQ-500 SERVICE OVERVIEW Small RNA Sequencing Service Description Small RNAs are a type of non-coding RNA (ncrna) molecules that are less than 200nt in length. They are often involved in gene silencing
Chromatin-Based Regulation of Gene Expression
Chromatin-Based Regulation of Gene Expression.George J. Quellhorst, Jr., PhD.Associate Director, R&D.Biological Content Development Topics to be Discussed Importance of Chromatin-Based Regulation Mechanism
Analysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers
Analysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers Gordon Blackshields Senior Bioinformatician Source BioScience 1 To Cancer Genetics Studies
Transcriptional control in Eukaryotes: (chapter 13 pp276) Chromatin structure affects gene expression. Chromatin Array of nuc
Transcriptional control in Eukaryotes: (chapter 13 pp276) Chromatin structure affects gene expression Chromatin Array of nuc 1 Transcriptional control in Eukaryotes: Chromatin undergoes structural changes
SureSelect Cancer All-In-One Custom and Catalog NGS Assays
SureSelect Cancer All-In-One Custom and Catalog NGS Assays Detect all cancer-relevant variants in a single SureSelect assay SNV Indel TL SNV Indel TL Single DNA input Single AIO assay Single data analysis
Analysis with SureCall 2.1
Analysis with SureCall 2.1 Danielle Fletcher Field Application Scientist July 2014 1 Stages of NGS Analysis Primary analysis, base calling Control Software FASTQ file reads + quality 2 Stages of NGS Analysis
Using the Bravo Liquid-Handling System for Next Generation Sequencing Sample Prep
Using the Bravo Liquid-Handling System for Next Generation Sequencing Sample Prep Tom Walsh, PhD Division of Medical Genetics University of Washington Next generation sequencing Sanger sequencing gold
Epigenomics. Ivana de la Serna Block Health Science
Epigenomics Ivana de la Serna Block Health Science 388 383-4111 ivana.delaserna@utoledo.edu Outline 1. Epigenetics-definition and overview 2. DNA methylation/hydroxymethylation 3. Histone modifications
Use Case 9: Coordinated Changes of Epigenomic Marks Across Tissue Types. Epigenome Informatics Workshop Bioinformatics Research Laboratory
Use Case 9: Coordinated Changes of Epigenomic Marks Across Tissue Types Epigenome Informatics Workshop Bioinformatics Research Laboratory 1 Introduction Active or inactive states of transcription factor
Jayanti Tokas 1, Puneet Tokas 2, Shailini Jain 3 and Hariom Yadav 3
Jayanti Tokas 1, Puneet Tokas 2, Shailini Jain 3 and Hariom Yadav 3 1 Department of Biotechnology, JMIT, Radaur, Haryana, India 2 KITM, Kurukshetra, Haryana, India 3 NIDDK, National Institute of Health,
DNA methylation & demethylation
DNA methylation & demethylation Lars Schomacher (Group Christof Niehrs) What is Epigenetics? Epigenetics is the study of heritable changes in gene expression (active versus inactive genes) that do not
ACE ImmunoID Biomarker Discovery Solutions ACE ImmunoID Platform for Tumor Immunogenomics
ACE ImmunoID Biomarker Discovery Solutions ACE ImmunoID Platform for Tumor Immunogenomics Precision Genomics for Immuno-Oncology Personalis, Inc. ACE ImmunoID When one biomarker doesn t tell the whole
NGS in Cancer Pathology After the Microscope: From Nucleic Acid to Interpretation
NGS in Cancer Pathology After the Microscope: From Nucleic Acid to Interpretation Michael R. Rossi, PhD, FACMG Assistant Professor Division of Cancer Biology, Department of Radiation Oncology Department
DNA-seq Bioinformatics Analysis: Copy Number Variation
DNA-seq Bioinformatics Analysis: Copy Number Variation Elodie Girard elodie.girard@curie.fr U900 institut Curie, INSERM, Mines ParisTech, PSL Research University Paris, France NGS Applications 5C HiC DNA-seq
What are the determinants of DNA demethylation following treatment of AML cell lines and patient samples with decitabine?
What are the determinants of DNA demethylation following treatment of AML cell lines and patient samples with decitabine? by Robert John Hollows This project is submitted in partial fulfilment of the requirements
Golden Helix s End-to-End Solution for Clinical Labs
Golden Helix s End-to-End Solution for Clinical Labs Steven Hystad - Field Application Scientist Nathan Fortier Senior Software Engineer 20 most promising Biotech Technology Providers Top 10 Analytics
Epigenetics. Jenny van Dongen Vrije Universiteit (VU) Amsterdam Boulder, Friday march 10, 2017
Epigenetics Jenny van Dongen Vrije Universiteit (VU) Amsterdam j.van.dongen@vu.nl Boulder, Friday march 10, 2017 Epigenetics Epigenetics= The study of molecular mechanisms that influence the activity of
The Epigenome Tools 2: ChIP-Seq and Data Analysis
The Epigenome Tools 2: ChIP-Seq and Data Analysis Chongzhi Zang zang@virginia.edu http://zanglab.com PHS5705: Public Health Genomics March 20, 2017 1 Outline Epigenome: basics review ChIP-seq overview
Integrated analysis of sequencing data
Integrated analysis of sequencing data How to combine *-seq data M. Defrance, M. Thomas-Chollier, C. Herrmann, D. Puthier, J. van Helden *ChIP-seq, RNA-seq, MeDIP-seq, Transcription factor binding ChIP-seq
A fully Bayesian approach for the analysis of Whole-Genome Bisulfite Sequencing Data
A fully Bayesian approach for the analysis of Whole-Genome Bisulfite Sequencing Data Leonardo Bottolo 1,2,3 1 Department of Medical Genetics, University of Cambridge, UK 2 The Alan Turing Institute, London,
NGS in tissue and liquid biopsy
NGS in tissue and liquid biopsy Ana Vivancos, PhD Referencias So, why NGS in the clinics? 2000 Sanger Sequencing (1977-) 2016 NGS (2006-) ABIPrism (Applied Biosystems) Up to 2304 per day (96 sequences
CRISPR/Cas9 Enrichment and Long-read WGS for Structural Variant Discovery
CRISPR/Cas9 Enrichment and Long-read WGS for Structural Variant Discovery PacBio CoLab Session October 20, 2017 For Research Use Only. Not for use in diagnostics procedures. Copyright 2017 by Pacific Biosciences
Measuring DNA Methylation with the MinION
Measuring DNA Methylation with the MinION Winston Timp Department of Biomedical Engineering Johns Hopkins University Epigenetics: Modern Modern Definition of epigenetics involves heritable changes other
Epigenetic Mechanisms
RCPA Lecture Epigenetic chanisms Jeff Craig Early Life Epigenetics Group, MCRI Dept. of Paediatrics Overview What is epigenetics? Chromatin The epigenetic code What is epigenetics? the interactions of
Genetics and Genomics in Medicine Chapter 6 Questions
Genetics and Genomics in Medicine Chapter 6 Questions Multiple Choice Questions Question 6.1 With respect to the interconversion between open and condensed chromatin shown below: Which of the directions
Measuring DNA Methylation with the MinION. Winston Timp Department of Biomedical Engineering Johns Hopkins University 12/1/16
Measuring DNA Methylation with the MinION Winston Timp Department of Biomedical Engineering Johns Hopkins University 12/1/16 Epigenetics: Modern Modern Definition of epigenetics involves heritable changes
Assignment 5: Integrative epigenomics analysis
Assignment 5: Integrative epigenomics analysis Due date: Friday, 2/24 10am. Note: no late assignments will be accepted. Introduction CpG islands (CGIs) are important regulatory regions in the genome. What
DNA methylation: a potential clinical biomarker for the detection of human cancers
DNA methylation: a potential clinical biomarker for the detection of human cancers Name: Tong Samuel Supervisor: Zigui CHEN Date: 1 st December 2016 Department: Microbiology Source: cited from Jakubowski,
High Throughput TruSeq Stranded mrna Library Construction on the Biomek FX P
High Throughput TruSeq Stranded mrna Library Construction on the Biomek FX P Zach Smith and Scott D. Michaels The Center for Genomics and Bioinformatics Indiana University Bloomington, IN USA Mary Blair
Iso-Seq Method Updates and Target Enrichment Without Amplification for SMRT Sequencing
Iso-Seq Method Updates and Target Enrichment Without Amplification for SMRT Sequencing PacBio Americas User Group Meeting Sample Prep Workshop June.27.2017 Tyson Clark, Ph.D. For Research Use Only. Not
Mutation Detection and CNV Analysis for Illumina Sequencing data from HaloPlex Target Enrichment Panels using NextGENe Software for Clinical Research
Mutation Detection and CNV Analysis for Illumina Sequencing data from HaloPlex Target Enrichment Panels using NextGENe Software for Clinical Research Application Note Authors John McGuigan, Megan Manion,
A complete next-generation sequencing workfl ow for circulating cell-free DNA isolation and analysis
APPLICATION NOTE Cell-Free DNA Isolation Kit A complete next-generation sequencing workfl ow for circulating cell-free DNA isolation and analysis Abstract Circulating cell-free DNA (cfdna) has been shown
Generating Spontaneous Copy Number Variants (CNVs) Jennifer Freeman Assistant Professor of Toxicology School of Health Sciences Purdue University
Role of Chemical lexposure in Generating Spontaneous Copy Number Variants (CNVs) Jennifer Freeman Assistant Professor of Toxicology School of Health Sciences Purdue University CNV Discovery Reference Genetic
Gene Expression DNA RNA. Protein. Metabolites, stress, environment
Gene Expression DNA RNA Protein Metabolites, stress, environment 1 EPIGENETICS The study of alterations in gene function that cannot be explained by changes in DNA sequence. Epigenetic gene regulatory
Epigenetics and Autoimmune Disease
Epigenetics and Autoimmune Disease Lisa F. Barcellos, PhD, MPH Associate Professor UC Berkeley School of Public Health QB3 Genetic Epidemiology and Genomics Laboratory ACTRIMS, May 30, 2014 Dallas, TX
SUPPLEMENTARY FIGURES: Supplementary Figure 1
SUPPLEMENTARY FIGURES: Supplementary Figure 1 Supplementary Figure 1. Glioblastoma 5hmC quantified by paired BS and oxbs treated DNA hybridized to Infinium DNA methylation arrays. Workflow depicts analytic
Evaluation of MIA FORA NGS HLA test and software. Lisa Creary, PhD Department of Pathology Stanford Blood Center Research & Development Group
Evaluation of MIA FORA NGS HLA test and software Lisa Creary, PhD Department of Pathology Stanford Blood Center Research & Development Group Disclosure Alpha and Beta Studies Sirona Genomics Reagents,
2/10/2016. Evaluation of MIA FORA NGS HLA test and software. Disclosure. NGS-HLA typing requirements for the Stanford Blood Center
Evaluation of MIA FORA NGS HLA test and software Lisa Creary, PhD Department of Pathology Stanford Blood Center Research & Development Group Disclosure Alpha and Beta Studies Sirona Genomics Reagents,
Performance Characteristics BRCA MASTR Plus Dx
Performance Characteristics BRCA MASTR Plus Dx with drmid Dx for Illumina NGS systems Manufacturer Multiplicom N.V. Galileïlaan 18 2845 Niel Belgium Table of Contents 1. Workflow... 4 2. Performance Characteristics
Selective depletion of abundant RNAs to enable transcriptome analysis of lowinput and highly-degraded RNA from FFPE breast cancer samples
DNA CLONING DNA AMPLIFICATION & PCR EPIGENETICS RNA ANALYSIS Selective depletion of abundant RNAs to enable transcriptome analysis of lowinput and highly-degraded RNA from FFPE breast cancer samples LIBRARY
TITLE: Total RNA Sequencing Analysis of DCIS Progressing to Invasive Breast Cancer.
AWARD NUMBER: W81XWH-14-1-0080 TITLE: Total RNA Sequencing Analysis of DCIS Progressing to Invasive Breast Cancer. PRINCIPAL INVESTIGATOR: Christopher B. Umbricht, MD, PhD CONTRACTING ORGANIZATION: Johns
Histones modifications and variants
Histones modifications and variants Dr. Institute of Molecular Biology, Johannes Gutenberg University, Mainz www.imb.de Lecture Objectives 1. Chromatin structure and function Chromatin and cell state Nucleosome
Epigenetics DNA methylation. Biosciences 741: Genomics Fall, 2013 Week 13. DNA Methylation
Epigenetics DNA methylation Biosciences 741: Genomics Fall, 2013 Week 13 DNA Methylation Most methylated cytosines are found in the dinucleotide sequence CG, denoted mcpg. The restriction enzyme HpaII
Identification of endometrial cancer methylation features using a combined. methylation analysis method DISSERTATION
Identification of endometrial cancer methylation features using a combined methylation analysis method DISSERTATION Presented in Partial Fulfillment of the Requirements for the Degree Doctor of Philosophy
Canadian Bioinforma1cs Workshops
5/12/16 Canadian Bioinforma1cs Workshops www.bioinforma1cs.ca Module #: Title of Module 2 1 Module 3 Introduc1on to WGBS and analysis Guillaume Bourque Learning Objec/ves of Module Know the different technologies
Genomic structural variation
Genomic structural variation Mario Cáceres The new genomic variation DNA sequence differs across individuals much more than researchers had suspected through structural changes A huge amount of structural
Introduction to Systems Biology of Cancer Lecture 2
Introduction to Systems Biology of Cancer Lecture 2 Gustavo Stolovitzky IBM Research Icahn School of Medicine at Mt Sinai DREAM Challenges High throughput measurements: The age of omics Systems Biology
Predictive Blood DNA Markers for Breast Cancer Xiang Zhang, Ph.D.
Predictive Blood DNA Markers for Breast Cancer Xiang Zhang, Ph.D. Department of Environmental Health University of Cincinnati Background Breast cancer (BCa) The second most common cancer among women in
Epigenetics. Lyle Armstrong. UJ Taylor & Francis Group. f'ci Garland Science NEW YORK AND LONDON
... Epigenetics Lyle Armstrong f'ci Garland Science UJ Taylor & Francis Group NEW YORK AND LONDON Contents CHAPTER 1 INTRODUCTION TO 3.2 CHROMATIN ARCHITECTURE 21 THE STUDY OF EPIGENETICS 1.1 THE CORE
Nature Immunology: doi: /ni Supplementary Figure 1. DNA-methylation machinery is essential for silencing of Cd4 in cytotoxic T cells.
Supplementary Figure 1 DNA-methylation machinery is essential for silencing of Cd4 in cytotoxic T cells. (a) Scheme for the retroviral shrna screen. (b) Histogram showing CD4 expression (MFI) in WT cytotoxic
Epigenetics q&more 01.11
Laurie. Knight, istockphoto.com Epigenetics 6 Bookmarks About the reading of genes in the Book of Life Prof. Dr. Manfred Jung, Julia M. Wagner, Institute for Pharmaceutical Sciences, Albert-Ludwig-University
Abstract. Optimization strategy of Copy Number Variant calling using Multiplicom solutions APPLICATION NOTE. Introduction
Optimization strategy of Copy Number Variant calling using Multiplicom solutions Michael Vyverman, PhD; Laura Standaert, PhD and Wouter Bossuyt, PhD Abstract Copy number variations (CNVs) represent a significant
저작권법에따른이용자의권리는위의내용에의하여영향을받지않습니다.
저작자표시 - 비영리 - 변경금지 2.0 대한민국 이용자는아래의조건을따르는경우에한하여자유롭게 이저작물을복제, 배포, 전송, 전시, 공연및방송할수있습니다. 다음과같은조건을따라야합니다 : 저작자표시. 귀하는원저작자를표시하여야합니다. 비영리. 귀하는이저작물을영리목적으로이용할수없습니다. 변경금지. 귀하는이저작물을개작, 변형또는가공할수없습니다. 귀하는, 이저작물의재이용이나배포의경우,
GCATCCATCTTGGGGCGTCCCAATTGCTGAGTAACAAATGAGACGC TGTGGCCAAACTCAGTCATAACTAATGACATTTCTAGACAAAGTGAC TTCAGATTTTCAAAGCGTACCCTGTTTACATCATTTTGCCAATTTCG
Lecture 6 GCATCCATCTTGGGGCGTCCCAATTGCTGAGTAACAAATGAGACGC TGTGGCCAAACTCAGTCATAACTAATGACATTTCTAGACAAAGTGAC TTCAGATTTTCAAAGCGTACCCTGTTTACATCATTTTGCCAATTTCG CGTACTGCAACCGGCGGGCCACGCCCCCGTGAAAAGAAGGTTGTT TTCTCCACATTTCGGGGTTCTGGACGTTTCCCGGCTGCGGGGCGG
Development of 5 LTR DNA methylation of latent HIV-1 provirus in cell line models and in long-term-infected individuals
Trejbalová et al. Clinical Epigenetics (2016) 8:19 DOI 10.1186/s13148-016-0185-6 RESEARCH Development of 5 LTR DNA methylation of latent HIV-1 provirus in cell line models and in long-term-infected individuals
Peak-calling for ChIP-seq and ATAC-seq
Peak-calling for ChIP-seq and ATAC-seq Shamith Samarajiwa CRUK Autumn School in Bioinformatics 2017 University of Cambridge Overview Peak-calling: identify enriched (signal) regions in ChIP-seq or ATAC-seq
ACE ImmunoID. ACE ImmunoID. Precision immunogenomics. Precision Genomics for Immuno-Oncology
ACE ImmunoID ACE ImmunoID Precision immunogenomics Precision Genomics for Immuno-Oncology Personalis, Inc. A universal biomarker platform for immuno-oncology Patient response to cancer immunotherapies
Upcoming Webinars. Profiling genes by pathways and diseases. Sample & Assay Technologies -1-
Upcoming Webinars -1- Keep up to date: Follow Pathway focused biology on Facebook www.facebook.com/pathwaycentral Latest information on, pathway focused research and demos. -2- Understanding Gene Expression
Methylation patterns in ejaculated sperm from Nellore-Angus crossbred bulls
Methylation patterns in ejaculated sperm from Nellore-Angus crossbred bulls M. R. Prause 1, G. Wang 1, & C. A. Gill 1 1 Texas A&M University, Department of Animal Science, College Station, TX 77843, USA
FOLLICULAR LYMPHOMA- ILLUMINA METHYLATION. Jude Fitzgibbon
FOLLICULAR LYMPHOMA- ILLUMINA METHYLATION Jude Fitzgibbon j.fitzgibbon@qmul.ac.uk Molecular Predictors of Clinical outcome Responders Alive Non-responders Dead TUMOUR GENETICS Targeted therapy, Prognostic
Integrated genomic analysis of human osteosarcomas
Integrated genomic analysis of human osteosarcomas Leonardo A. Meza-Zepeda Project Leader Genomic Section Department of Tumor Biology The Norwegian Radium Hospital Head Microarray Core Facility Norwegian
RNA-seq Introduction
RNA-seq Introduction DNA is the same in all cells but which RNAs that is present is different in all cells There is a wide variety of different functional RNAs Which RNAs (and sometimes then translated
Best practice DNA prep for SMRT. Olga Vinnere Pettersson, PhD Project coordinator NGI-Sweden / SciLifeLab (UU)
Best practice DNA prep for SMRT Olga Vinnere Pettersson, PhD Project coordinator NGI-Sweden / SciLifeLab (UU) National Genomics Infrastructure - Sweden NGI Stockholm NGI Uppsala NGI staff: 60-70 FTE, including
genomics for systems biology / ISB2020 RNA sequencing (RNA-seq)
RNA sequencing (RNA-seq) Module Outline MO 13-Mar-2017 RNA sequencing: Introduction 1 WE 15-Mar-2017 RNA sequencing: Introduction 2 MO 20-Mar-2017 Paper: PMID 25954002: Human genomics. The human transcriptome
Variation in 5-hydroxymethylcytosine across human cortex and cerebellum
Cover art produced by Helen Spiers (www.helenspiers.com) Variation in 5-hydroxymethylcytosine across human cortex and cerebellum Lunnon et al. Lunnon et al. Genome Biology (2016) 17:27 DOI 10.1186/s13059-016-0871-x
Single-strand DNA library preparation improves sequencing of formalin-fixed and paraffin-embedded (FFPE) cancer DNA
www.impactjournals.com/oncotarget/ Oncotarget, Supplementary Materials 2016 Single-strand DNA library preparation improves sequencing of formalin-fixed and paraffin-embedded (FFPE) DNA Supplementary Materials
Introduction of an NGS gene panel into the Haemato-Oncology MPN service
Introduction of an NGS gene panel into the Haemato-Oncology MPN service Dr. Anna Skowronska, Dr Jane Bryon, Dr Samuel Clokie, Dr Yvonne Wallis and Professor Mike Griffiths West Midlands Regional Genetics
EpiQuik Circulating Acetyl Histone H3K18 ELISA Kit (Colorimetric)
EpiQuik Circulating Acetyl Histone H3K18 ELISA Kit (Colorimetric) Base Catalog # PLEASE READ THIS ENTIRE USER GUIDE BEFORE USE Uses: The EpiQuik Circulating Acetyl Histone H3K18 ELISA Kit (Colorimetric)
Nature Methods: doi: /nmeth.3115
Supplementary Figure 1 Analysis of DNA methylation in a cancer cohort based on Infinium 450K data. RnBeads was used to rediscover a clinically distinct subgroup of glioblastoma patients characterized by
Raymond Auerbach PhD Candidate, Yale University Gerstein and Snyder Labs August 30, 2012
Elucidating Transcriptional Regulation at Multiple Scales Using High-Throughput Sequencing, Data Integration, and Computational Methods Raymond Auerbach PhD Candidate, Yale University Gerstein and Snyder
Please Silence Your Cell Phones. Thank You
Please Silence Your Cell Phones Thank You Utility of NGS and Comprehensive Genomic Profiling in Hematopathology Practice Maria E. Arcila M.D. Memorial Sloan Kettering Cancer Center New York, NY Disclosure
Tissue of origin determines cancer-associated CpG island promoter hypermethylation patterns
RESEARCH Open Access Tissue of origin determines cancer-associated CpG island promoter hypermethylation patterns Duncan Sproul 1,2, Robert R Kitchen 1,3, Colm E Nestor 1,2, J Michael Dixon 1, Andrew H
UKnowledge. University of Kentucky. Matthew Rea University of Kentucky, Meredith Eckstein University of Kentucky,
University of Kentucky UKnowledge Molecular and Cellular Biochemistry Faculty Publications Molecular and Cellular Biochemistry 2-2-2017 Genome-Wide DNA Methylation Reprogramming in Response to Inorganic
Analysis of small RNAs from Drosophila Schneider cells using the Small RNA assay on the Agilent 2100 bioanalyzer. Application Note
Analysis of small RNAs from Drosophila Schneider cells using the Small RNA assay on the Agilent 2100 bioanalyzer Application Note Odile Sismeiro, Jean-Yves Coppée, Christophe Antoniewski, and Hélène Thomassin
PG-Seq NGS Kit for Preimplantation Genetic Screening
Application Note: PG-Seq Validation Study PG-Seq NGS Kit for Preimplantation Genetic Screening Validation using Multi (5-10) Cells and Single Cells from euploid and aneuploid cell lines Introduction Advances
Molecular Markers. Marcie Riches, MD, MS Associate Professor University of North Carolina Scientific Director, Infection and Immune Reconstitution WC
Molecular Markers Marcie Riches, MD, MS Associate Professor University of North Carolina Scientific Director, Infection and Immune Reconstitution WC Overview Testing methods Rationale for molecular testing
Metabolomic and Proteomics Solutions for Integrated Biology. Christine Miller Omics Market Manager ASMS 2015
Metabolomic and Proteomics Solutions for Integrated Biology Christine Miller Omics Market Manager ASMS 2015 Integrating Biological Analysis Using Pathways Protein A R HO R Protein B Protein X Identifies
A Practical Guide to Integrative Genomics by RNA-seq and ChIP-seq Analysis
A Practical Guide to Integrative Genomics by RNA-seq and ChIP-seq Analysis Jian Xu, Ph.D. Children s Research Institute, UTSW Introduction Outline Overview of genomic and next-gen sequencing technologies
Genetic Counselling in relation to genetic testing
Genetic Counselling in relation to genetic testing Dr Julie Vogt Consultant Geneticist West Midlands Regional Genetics Service September 2016 Disclosures for Research Support/P.I. Employee Consultant Major
ncounter TM Analysis System
ncounter TM Analysis System Molecules That Count TM www.nanostring.com Agenda NanoString Technologies History Introduction to the ncounter Analysis System CodeSet Design and Assay Principals System Performance
Lecture 8. Eukaryotic gene regulation: post translational modifications of histones
Lecture 8 Eukaryotic gene regulation: post translational modifications of histones Recap.. Eukaryotic RNA polymerases Core promoter elements General transcription factors Enhancers and upstream activation
Comparative DNA methylome analysis of endometrial carcinoma reveals complex and distinct deregulation of cancer promoters and enhancers
Zhang et al. BMC Genomics 2014, 15:868 RESEARCH ARTICLE Open Access Comparative DNA methylome analysis of endometrial carcinoma reveals complex and distinct deregulation of cancer promoters and enhancers
Identifying Mutations Responsible for Rare Disorders Using New Technologies
Identifying Mutations Responsible for Rare Disorders Using New Technologies Jacek Majewski, Department of Human Genetics, McGill University, Montreal, QC Canada Mendelian Diseases Clear mode of inheritance
Analyzing the Loss of Allele-Specific Methylation in Human Colorectal Adenoma with Bisulfite Sequencing
Research Collection Master Thesis Analyzing the Loss of Allele-Specific Methylation in Human Colorectal Adenoma with Bisulfite Sequencing Author(s): Machlab, Dania Publication Date: 2015 Permanent Link:
Screening for novel oncology biomarker panels using both DNA and protein microarrays. John Anson, PhD VP Biomarker Discovery
Screening for novel oncology biomarker panels using both DNA and protein microarrays John Anson, PhD VP Biomarker Discovery Outline of presentation Introduction to OGT and our approach to biomarker studies
Circulating Cell-Free DNA Pre-analytics: Importance of ccfdna Stabilization and Extraction for Liquid Biopsy Applications
Circulating Cell-Free DNA Pre-analytics: Importance of ccfdna Stabilization and Extraction for Liquid Biopsy Applications Martin Schlumpberger, Ass.Director R&D, QIAGEN GmbH IQNpath 2017 - Circulating