Transcription

1

2

3

4

5

6 Supplementary Table 1. Annotated candidate SNV and indels in melanoma tumors. Patient C1 Patient C2 Patient C3 Patient C4 Patient C5 Patient C6 Patient C7 Patient C10 Chr Position Reference Allele Sample Allele Variation Type Gene Region Gene Symbol Transcript ID Protein Variant Pre Prog Pre* Prog Pre Prog Pre Prog Pre Prog Pre Prog Pre Prog Pre Prog PolyPhen- 2 Conservation Translation SIFT Function Function phylop p- Impact Prediction Prediction value Variant Findings dbsnp ID COSMIC ID RD AF RD AF RD AF RD AF RD AF RD AF RD AF RD AF RD AF RD AF RD AF RD AF RD AF RD AF RD AF RD AF G A SNV Exonic; ncrnacasp9 NM_ p.S270F missense Damaging Probably Dam 1.68E A C SNV Exonic; ncrnacasp9 NM_ p.L34R missense Damaging Probably Dam 2.70E G A SNV Exonic STMN1 NM_ p.P152S missense Tolerated Benign G A SNV Exonic SNRNP40; ZCCNM_ p.S20N missense C T SNV Exonic TIE1 NM_ p.S431F missense Damaging Probably Dam 4.55E C T SNV Exonic TIE1 NM_ p.A1060V missense Damaging Possibly Dama 1.42E G A SNV Exonic PRKAA2 NM_ p.E168K missense Damaging Probably Dam 1.57E G A SNV Exonic LPAR3 NM_ p.R105C missense Tolerated Probably Dam 6.86E C T SNV Exonic COL24A1 NM_ p.R1538Q missense Tolerated Possibly Dama 3.98E C T SNV Splice Site COL24A1 NM_ E G A SNV Exonic COL11A1 NM_ p.P1320S missense Damaging Probably Dam 2.37E G T SNV Exonic NRAS NM_ p.Q61K missense Damaging Possibly Dama 1.19E ; ; 580; C T SNV Exonic NRAS NM_ p.G12D missense Damaging Benign 8.17E ; G A SNV Exonic NGF NM_ p.R83C missense Damaging Benign 1.27E G A SNV Exonic ITGA10 NM_ p.D384N missense Damaging Probably Dam 5.36E GGGGGTGGGCGGGGG Deletion Exonic EFNA3 NM_ p.V71_G74del in- frame C T SNV Exonic INSRR NM_ p.R1157H missense Damaging Probably Dam 2.53E C A SNV Exonic INSRR NM_ p.G380C missense Damaging Probably Dam 3.03E G A SNV Exonic NTRK1 NM_ p.E193K missense Damaging Benign C T SNV Exonic TNN NM_ p.P31L missense Tolerated Benign G A SNV Exonic TNN NM_ p.G870E missense Damaging Probably Dam 1.86E C T SNV Exonic TNN NM_ p.P981S missense Tolerated Benign G A SNV Exonic TNN NM_ p.G1106R missense Damaging Probably Dam 1.67E G A SNV Exonic TNR NM_ p.P1342S missense Damaging Probably Dam 1.16E G A SNV Exonic TNR NM_ p.S1220F missense Damaging Possibly Dama 6.93E C T SNV Exonic TNR NM_ p.D743N missense Tolerated Benign 9.57E C T SNV Exonic CACNA1E NM_ p.S776F missense Damaging Probably Dam 9.14E C T SNV Exonic CACNA1E NM_ p.H1317Y missense Activating Benign 1.18E G A SNV Exonic CACNA1E NM_ p.G1373E missense Damaging Probably Dam 7.38E C A SNV Exonic CACNA1E NM_ p.H1446N missense Tolerated Benign 8.73E C T SNV Exonic CACNA1E NM_ p.S2007L missense Tolerated Benign 4.33E C T SNV Exonic LAMC1 NM_ p.R1087C missense Damaging Benign 1.34E G A SNV Exonic LAMC2 NM_ p.G998E missense Damaging Probably Dam 2.52E G A SNV Exonic CACNA1S NM_ p.S1854F missense Damaging Benign C T SNV Exonic CACNA1S NM_ p.G1724E missense Tolerated Benign A C SNV Exonic CACNA1S NM_ p.V1449G missense Damaging Possibly Dama 1.12E TGTCGTCGTCGTGTCGTCGTCGInsertion Exonic PPP2R5A NM_ p.S2_S3insP in- frame G A SNV Exonic PPP2R5A NM_ p.E69K missense Tolerated Possibly Dama 9.82E C T SNV Exonic AKT3 NM_ p.E17K missense Damaging Probably Dam 2.47E ; ; G A SNV Exonic SOS1 NM_ p.R826* stop gain C T SNV Exonic IL1R1 NM_ p.P85S missense Damaging Probably Dam 2.25E C A SNV Exonic IL1R1 NM_ p.Q125K missense Tolerated Benign G A SNV Exonic G6PC2 NM_ p.D139N missense Tolerated Benign 3.91E G A SNV Exonic G6PC2 NM_ p.G186S missense Damaging Probably Dam 1.11E A G SNV Exonic ITGAV NM_ p.E763G missense Tolerated Benign 4.43E G A SNV Exonic COL3A1 NM_ p.G483R missense Damaging Possibly Dama 4.20E C T SNV Exonic COL3A1 NM_ p.P830L missense Tolerated Benign 5.60E G A SNV Exonic COL3A1 NM_ p.E1096K missense Tolerated Probably Dam 1.12E C A SNV Exonic COL3A1 NM_ p.L1265M missense Damaging Probably Dam 7.28E G A SNV Exonic COL5A2 NM_ p.R1060W missense Damaging Probably Damaging C T SNV Exonic COL5A2 NM_ p.G135E missense Damaging Probably Dam 1.68E G A SNV Exonic IDH1 NM_ p.R132C missense Damaging Benign 1.61E ; C T SNV Exonic FN1 NM_ p.G966R missense Tolerated Benign 5.12E G T SNV Exonic IRS1 NM_ p.S1213R missense Tolerated Benign G A SNV Exonic COL4A3 NM_ p.G366E missense Damaging Probably Dam 4.01E G A SNV Exonic COL4A3 NM_ p.G449E missense Damaging Probably Dam 4.93E G GA Insertion Exonic RAF1 NM_ p.Q601fs* frameshift 6.19E C T SNV Exonic TGFBR2 NM_ p.L386F missense Damaging Probably Dam 4.10E G A SNV Exonic LAMB2 NM_ p.R1626W missense Tolerated Benign G A SNV Exonic CACNA1D NM_ p.V236I missense Damaging Possibly Dama 1.05E T C SNV Exonic CACNA1D NM_ p.C494R missense Tolerated Benign 6.38E G A SNV Exonic; ncrnacacna2d3 NR_ p.a754t missense Tolerated Benign 3.32E C T SNV Exonic; ncrnacacna2d3 NR_ p.p786s missense Tolerated Benign 3.93E C T SNV Exonic; ncrnacacna2d3 NR_ p.p786l missense Damaging Possibly Dama 3.93E C T SNV Exonic FLNB NM_ p.T1193I missense Damaging Probably Dam 5.19E G A SNV Exonic COL6A6 NM_ p.E555K missense Tolerated Benign 8.55E C T SNV Exonic MECOM NM_ p.E104K missense Tolerated Probably Dam 1.77E C T SNV Exonic MECOM NM_ p.E101K missense Tolerated Benign C T SNV Exonic PIK3CA NM_ p.R230* stop gain G A SNV Exonic FGF12 NM_ p.S76L missense Damaging Possibly Dama 2.81E G GA Insertion Exonic PAK2 NM_ p.E146Gfs* unknown 6.25E G A SNV Exonic PDGFRA NM_ p.E34K missense Tolerated Benign 1.47E C T SNV Exonic PDGFRA NM_ p.S942F missense Damaging Possibly Dama 3.18E T C SNV Exonic KDR NM_ p.M1285V missense Tolerated Benign T G SNV Exonic KDR NM_ p.I256L missense Tolerated Benign GAGCAGC GAGCAGCAGCInsertion Exonic FGF5 NM_ p.Q224dup in- frame G A SNV Exonic IBSP NM_ p.G159E missense Activating Benign G A SNV Exonic FGF2; NUDT6 NM_ p.P5S; p.p174s missense Damaging Probably Dam 4.12E G A SNV Exonic; ncrnapdgfc NM_ p.R253C missense Damaging Probably Dam 3.63E A C SNV Exonic RAPGEF2 NM_ p.T1119P missense Tolerated Benign 5.22E C T SNV Exonic RAPGEF2 NM_ p.T1366M missense Tolerated Benign 1.77E C T SNV Exonic SPOCK3 NM_ p.G366E missense Damaging Probably Dam 1.98E CTCATCAT CTCAT Deletion Exonic VEGFC NM_ p.M419del unknown G A SNV Exonic CASP3 NM_ p.R64W missense Damaging Probably Dam 1.47E T C SNV Exonic ADAMTS12 NM_ p.Y1305C missense Tolerated Probably Dam 5.48E G A SNV Exonic PRLR NM_ p.P500L missense Tolerated Benign C T SNV Exonic IL7R NM_ p.L421F missense Tolerated Benign G A SNV Exonic FYB NM_ p.P137L missense Activating Benign G A SNV Exonic GHR NM_ p.E519K missense Tolerated Possibly Dama 1.46E A T SNV Exonic ITGA1 NM_ p.N780I missense Damaging Benign 6.79E G A SNV Exonic ITGA2 NM_ p.G370R missense Tolerated Possibly Dama 6.12E

7 G A SNV Exonic ITGA2 NM_ p.G370E missense Tolerated Possibly Dama 2.62E TCAACAACAACTCAACAACAACDeletion Exonic MAP3K1 NM_ p.T949del in- frame 1.11E G A SNV Exonic THBS4 NM_ p.D739N missense Damaging Probably Dam 8.22E G A SNV Exonic THBS4 NM_ p.D869N missense Damaging Probably Dam 4.51E G A SNV Exonic RASGRF2 NM_ p.W225* stop gain 8.65E A C SNV Exonic RASGRF2 NM_ p.K311Q missense Tolerated Benign 7.46E T A SNV Splice Site TGFBI NM_ E G A SNV Exonic; ncrnacsf1r NM_ p.P347L missense Tolerated Possibly Damaging C T SNV Exonic PDGFRB NM_ p.E141K missense Tolerated Benign C T SNV Exonic COL11A2 NM_ p.G1063E missense Damaging Probably Dam 1.87E G A SNV Exonic LAMA4 NM_ p.R1073* stop gain 6.86E G A SNV Exonic MAP3K5 NM_ p.R1370* stop gain 7.78E C T SNV Exonic TAB2 NM_ p.S588F missense Damaging Probably Dam 2.98E C T SNV Exonic RAC1 NM_ p.P29S missense Damaging Possibly Dama 5.32E ; C T SNV Exonic RAC1 NM_ p.P29L missense Damaging Possibly Dama 5.32E G A SNV Exonic EGFR NM_ p.E967K missense Damaging Probably Dam 1.24E G A SNV Exonic NCF1 NM_ p.S99G missense C T SNV Exonic GNGT1 NM_ p.S34F missense Damaging Probably Dam 2.99E G A SNV Exonic COL1A2 NM_ p.G538D missense Damaging Probably Dam 5.51E C T SNV Exonic GNB2 NM_ p.S97F missense Damaging Possibly Dama 1.57E C T SNV Exonic RELN NM_ p.R3458Q missense Damaging Benign 5.15E G A SNV Exonic RELN NM_ p.P2620L missense Damaging Probably Dam 1.41E A T SNV Exonic LAMB1 NM_ p.V1451D missense Damaging Benign 2.47E C A SNV Exonic LAMB4 NM_ p.G1195V missense Tolerated Benign 5.55E C G SNV Exonic MET NM_ p.F931L missense Tolerated Benign A G SNV Exonic MET NM_ p.N1288S missense Damaging Possibly Dama 8.47E C T SNV Exonic FLNC NM_ p.L50F missense Damaging Probably Dam 4.63E G A SNV Exonic FLNC NM_ p.V978M missense Tolerated Possibly Dama 6.10E CTGGTGGT CTGGT Deletion Exonic CREB3L2 NM_ p.T100del in- frame A T SNV Exonic BRAF NM_ p.V600E missense Damaging Probably Dam 7.87E ; 476; AC TT SNV Exonic BRAF NM_ p.V600K missense Damaging Possibly Dama 6.62E ; C T SNV Exonic NOS3 NM_ p.S260F missense Damaging Probably Dam 3.03E G A SNV Exonic NOS3 NM_ p.E901K missense Tolerated Possibly Dama 4.40E CACAAC CAC Deletion Exonic PPP2CB NM_ p.C269del in- frame 4.07E G A SNV Exonic EIF4EBP1 NM_ p.R73K missense Tolerated Benign G A SNV Exonic NSMAF NM_ p.S484F missense Damaging Possibly Dama 4.15E C T SNV Exonic SNX31 NM_ p.E132K missense Tolerated Benign C T SNV Exonic ANGPT1 NM_ p.D77N missense Damaging Benign 1.13E G A SNV Exonic PTK2 NM_ p.P469S missense Tolerated Benign 1.54E C T SNV Exonic IFNA17 NM_ p.E106K missense Damaging Benign AT ATT Insertion Exonic IFNA17 NM_ p.H57Qfs* frameshift G A SNV Exonic CDKN2A (p16i NM_ p.P114L synonymous; mdamaging Probably Dam 1.99E ; 12476; ; 53077; G A SNV Exonic CDKN2A (p16i NM_ p.P81L synonymous; mdamaging Probably Dam 2.01E ; C T SNV Exonic CDKN2A (p14anm_ p.v51m missense Damaging Probably Dam 2.34E ; T C SNV Exonic PRKACG NM_ p.Y123C missense Damaging Probably Damaging C T SNV Exonic NTRK2 NM_ p.R691C missense Damaging Probably Dam 2.95E G A SNV Exonic SYK NM_ p.G514R missense Damaging Probably Dam 1.34E TAAAA TAAAAAA Insertion Exonic TNC NM_ p.I1505fs* frameshift G A SNV Exonic TLR4 NM_ p.G111E missense Damaging Probably Dam 1.21E C T SNV Exonic TLR4 NM_ p.H256Y missense Activating Benign G A SNV Exonic TLR4 NM_ p.E445K missense Tolerated Benign G A SNV Exonic PPP6C NM_ p.P168S missense Damaging Probably Dam 1.14E C T SNV Exonic TSC1 NM_ p.V127I missense Tolerated Benign G A SNV Exonic COL5A1 NM_ p.G54R missense Damaging Probably Dam 2.05E G A SNV Exonic COL5A1 NM_ p.D854N missense Damaging Probably Dam 8.95E G A SNV Exonic CACNA1B NM_ p.G633R missense Damaging Probably Dam 2.49E C T SNV Exonic CACNA1B NM_ p.P2143S missense Tolerated C T SNV Exonic IL2RA NM_ p.G155R missense Damaging Probably Dam 4.13E T A SNV Exonic ITGA8 NM_ p.I921L missense Tolerated Benign C T SNV Exonic ITGA8 NM_ p.A149T missense Damaging Probably Dam 4.45E G A SNV Splice Site CACNB2 NM_ E CATTATT CATT Deletion Exonic PTEN NM_ p.I33del in- frame 4.66E ; 4972; CAAAAA CAAAAAA Insertion Exonic PTEN NM_ p.V166fs* frameshift 3.00E C T SNV Exonic PTEN NM_ p.P169S missense Damaging Probably Dam 1.64E C T SNV Exonic NFKB2 NM_ p.P430S missense Tolerated Benign C T SNV Exonic; ncrnafgfr2 NM_ p.R626Q missense Damaging Probably Dam 7.80E C T SNV Exonic; ncrnafgfr2 NM_ p.G489E missense Damaging Probably Dam 5.98E T C SNV Exonic RRAS2 NM_ p.Y105C missense Tolerated Possibly Damaging C T SNV Exonic PTPN5 NM_ p.D534N missense Damaging Probably Dam 9.98E C T SNV 5'UTR; Exonic BDNF NM_ p.R13K missense Tolerated Benign 2.40E G A SNV Exonic TRAF6 NM_ p.P183L missense Tolerated Benign AGG AGGG Insertion Exonic CREB3L1 NM_ p.D509fs frameshift 3.08E G A SNV Exonic TNKS1BP1 NM_ p.P1386S missense Tolerated Benign G A SNV Splice Site PPP2R5B NM_ E C T SNV Exonic CACNA2D4 NM_ p.W685* stop gain 1.50E C T SNV Exonic CACNA2D4 NM_ p.R522Q missense Tolerated Benign 2.28E ; G A SNV Exonic CACNA2D4 NM_ p.P413L missense Tolerated Benign G A SNV Exonic CACNA1C NM_ p.G1053E missense Damaging Probably Dam 2.87E G C SNV Exonic CACNA1C NM_ p.E1392Q missense Activating Benign 2.51E C T SNV Exonic FGF6 NM_ p.E119K missense Damaging Probably Dam 7.05E G A SNV Exonic GNB3 NM_ p.R251H missense Tolerated Possibly Dama 3.95E C T SNV Exonic GYS2 NM_ p.G338R missense Damaging Probably Dam 1.14E C T SNV Exonic EIF4B NM_ p.S585F missense Damaging Benign 7.59E A C SNV Exonic MDM2 NM_ p.Q414H missense Tolerated Probably Damaging G A SNV Exonic PTPRR NM_ p.S342F missense Damaging Probably Dam 3.08E G A SNV Exonic KITLG NM_ p.Q243* stop gain 3.82E C T SNV Exonic RPL6 NM_ p.D120N missense Damaging Possibly Dama 3.96E G A SNV Exonic TAOK3 NM_ p.R306* stop gain 1.30E C T SNV Exonic FLT1 NM_ p.E1091K missense Damaging Probably Dam 6.81E G A SNV Exonic FLT1 NM_ p.A80V missense Tolerated Benign T A SNV Exonic RB1 NM_ p.I227N missense Damaging Probably Dam 4.52E G A SNV Splice Site RB1 NM_ E C T SNV Exonic RB1 NM_ p.S463L missense Damaging Probably Dam 4.54E G A SNV Splice Site RB1 NM_ E C T SNV Exonic RB1 NM_ p.R656W missense Tolerated Benign 6.08E G A SNV Exonic COL4A1 NM_ p.P991S missense Tolerated Probably Dam 8.69E G A SNV Exonic COL4A1 NM_ p.S967F missense Tolerated Benign G A SNV Exonic COL4A1 NM_ p.S628F missense Tolerated Benign

8 G A SNV Exonic COL4A2 NM_ p.G720S missense Damaging Probably Dam 2.14E C T SNV Exonic COL4A2 NM_ p.S829F missense Tolerated Probably Damaging T TA Insertion Exonic PCK2 NM_ p.I237Rfs* frameshift 1.99E G C SNV Exonic SOS2 NM_ p.Q178E missense Damaging Benign 7.91E C T SNV Exonic; ncrnatcl1a NM_ p.D105N missense Damaging Probably Dam 6.68E C T SNV Exonic RASGRP1 NM_ p.E319K missense Damaging Possibly Dama 8.36E A T SNV Exonic CASC5 NM_ p.T601S missense Tolerated Probably Damaging G T SNV Exonic CASC5 NM_ p.E1800* stop gain 1.74E G T SNV Splice Site TYRO3 NM_ E G A SNV Exonic GNB5 NM_ p.A263V missense Tolerated Possibly Dama 2.05E C A SNV Exonic MAP2K1 NM_ p.P124Q missense Damaging Probably Dam 1.19E C T SNV Exonic ITGA11 NM_ p.W390* stop gain 5.61E G A SNV Exonic NTHL1 NM_ p.R21W missense Damaging Benign C T SNV Exonic PRKCB NM_ p.P638S missense Tolerated Benign 1.49E C T SNV Exonic CD19 NM_ p.P376S missense Tolerated Benign G A SNV Exonic TAOK2 NM_ p.V959M missense Damaging Possibly Dama 6.01E G A SNV Exonic RBL2 NM_ p.E478K missense Tolerated Benign 2.08E C T SNV Exonic SDR42E1 NM_ p.R92Q missense Tolerated Benign A C SNV Exonic TP53 NM_ p.V218G missense Damaging Probably Dam 2.74E ; T A SNV Exonic VTN NM_ p.R324S missense Tolerated Benign C T SNV Exonic ERBB2 NM_ p.P617S missense Tolerated Benign G T SNV Exonic ITGA2B NM_ p.A788D missense Damaging Probably Dam 8.91E G A SNV Exonic ITGA2B NM_ p.Q642* stop gain 6.50E C T SNV Exonic MAP3K14 NM_ p.G248R missense Benign G A SNV Splice Site ITGB3 NM_ E C T SNV Exonic NGFR NM_ p.S24F missense Tolerated Benign C T SNV Exonic NGFR NM_ p.P370L missense Damaging Benign C T SNV Exonic ITGA3 NM_ p.P354L missense Tolerated Benign C T SNV Exonic COL1A1 NM_ p.G233E missense Damaging Probably Dam 6.93E C T SNV Exonic COL1A1 NM_ p.R220Q missense Tolerated Probably Dam 7.41E C T SNV Exonic CACNA1G NM_ p.S111F missense Damaging Possibly Dama 2.14E G A SNV Exonic TUBD1; RPS6KNM_ p.D37N missense Tolerated Benign 3.61E C T SNV Exonic CSH2 NM_ p.D197N missense Tolerated Benign A G SNV Exonic GH2 NM_ p.W241R synonymous; mactivating Benign G A SNV Exonic CACNG4 NM_ p.R171Q missense Damaging Possibly Damaging A T SNV Exonic MAP2K6 NM_ p.I56L missense Tolerated Probably Dam 1.77E G A SNV Exonic ITGB4 NM_ p.M1447I missense Tolerated Benign 3.30E G A SNV Exonic LAMA3 NM_ p.R706Q missense Damaging Possibly Dama 1.60E C T SNV Exonic MKNK2 NM_ p.D32N missense Tolerated Benign C G SNV Exonic MAP2K2 NM_ p.C125S missense Damaging Probably Dam 2.15E G A SNV Exonic CREB3L3 NM_ p.G397R missense Tolerated Benign C T SNV Exonic CACNA1A NM_ p.M1587I missense Damaging Benign 3.24E C T SNV Exonic PKN1 NM_ p.R543W missense Tolerated Possibly Damaging C T SNV Exonic MAP1S NM_ p.P760L missense Damaging Benign C G SNV Exonic COMP NM_ p.G645R missense Damaging Probably Dam 3.51E G A SNV Exonic AXL NM_ p.E818K missense Damaging Probably Dam 1.32E G A SNV Exonic COL6A2 NM_ p.V158M missense Damaging Probably Dam 7.83E C T SNV Exonic RAC2 NM_ p.G10E missense Damaging Possibly Dama 1.11E C T SNV Exonic PLA2G6 NM_ p.A664T missense Damaging Benign 2.30E G A SNV Exonic MAPK12 NM_ p.P282S missense Tolerated Benign 3.87E- 03 X C T SNV Exonic VCX3B (includenm_ p.v170m missense Tolerated Benign X C T SNV Exonic VCX3B (includenm_ p.v160m missense Tolerated Benign X C T SNV Exonic VCX3B (includenm_ p.v120m missense Tolerated Benign X C T SNV Exonic VCX3B (includenm_ p.a17t missense Activating Benign X G T SNV Exonic VCX3B (includenm_ p.t15k missense Tolerated Benign X C G SNV Exonic VCX3B (includenm_ p.a70g missense Activating Benign X G A SNV Exonic VCX3B (includenm_ p.e162k missense Damaging Possibly Dama 1.56E- 03 X A G SNV Exonic VCX3B (includenm_ p.m180v missense Tolerated Benign X A G SNV Exonic VCX3B (includenm_ p.d30g missense Tolerated Benign X C T SNV Exonic CACNA1F NM_ p.D892N missense Damaging Possibly Dama 1.84E- 04 X TTCCTCCTCCTCTTCCTCCTCCTCInsertion Exonic CACNA1F NM_ p.E825dup in- frame X G A SNV Exonic MED12 NM_ p.G1441R missense Damaging Probably Dam 8.83E- 06 X G A SNV Exonic COL4A6 NM_ p.P1378L missense Tolerated Possibly Dama 1.69E- 03 X C T SNV Exonic COL4A6 NM_ p.D1289N missense Tolerated Benign 3.01E X G A SNV Exonic COL4A6 NM_ p.P659S missense Tolerated Benign X C T SNV Exonic COL4A6 NM_ p.G569D missense Tolerated Probably Dam 3.52E- 04 X C T SNV Exonic COL4A6 NM_ p.G458S missense Damaging Probably Dam 4.72E- 04 X G A SNV Exonic COL4A5 NM_ p.G126R missense Damaging Probably Dam 2.48E- 06 X G A SNV Exonic COL4A5 NM_ p.G1669R missense Damaging 1.00E- 06 X C T SNV Exonic MTCP1 NM_ p.E75K missense Tolerated Benign RD, Read Depth; AF, Allele Frequency; Chr, Chromosome *The EDT tumor was used as the Pre for Patient C2

9 Supplementary Table 2. Amplification and Sequencing Primers Forward Reverse BRAF GGCTCTCGGTTATAAGATGGC ACAGGAAACGCACCATATCC MEK1 CGTTACCCGGGTCCAAAATG CTTTGTCACAGGTGAAATGC CATGGATGGAGGTTCTCTGG AGGGCTTGACATCTCTGTGC MEK2 CTCCCGGCCCGCCCCCTATG GTGGAGGCGCCAGCCTGTCC GTCAGCATCGCGGTTCTCC TCACCCCGAAGTCACACAG MEK1/2 TGCAGAAGAAGCTGGAGGAGC N-RAS AGCTTGAGGTTCTTGCTGGT TCAGGACCAGGGTGTCAGTG AKT1 AGCGCCAGCCTGAGAGGA TCTCCATCCCTCCAAGCTAT GACAGGTGGAAGAACAGCT

10 Supplementary Table 3. Exome sequencing data summary Patient Tumor % coverage of Mean read depth target regions of target regions (>10x) C1 Pre Prog C2 Pre* Prog C3 Pre Prog C4 Pre Prog C5 Pre Prog C6 Pre Prog C7 Pre Prog C10 Pre Prog *The EDT tumor was used as the Pre for Patient C2