Targeted sequencing of refractory myeloma reveals a high incidence of mutations in CRBN and Ras pathway genes

Transcription

1 Targeted sequencing of refractory myeloma reveals a high incidence of mutations in CRBN and Ras pathway genes KM Kortüm 1,8 *, EK Mai 3,4 *, NH Hanafiah 3 *, CX Shi 1, YX Zhu 1, L Bruins 1, S Barrio 1, P Jedlowski 1, M Merz 4, J Xu 3,6, RA Stewart 1, M Andrulis 6, A Jauch 7, J Hillengass 4, H Goldschmidt 4, 5, PL Bergsagel 1, E Braggio 1, AK Stewart 1,2#, and MS Raab 3,4 *contributed equally to this study Supplementary data and information Supplementary Figure 1 Supplementary Figure 2 Supplementary Table 1 Supplementary Table 2 Supplementary methods 1

2 Supplementary Figure 1 Supplementary Figure 1: Genomic mutations, adverse cytogenetic aberrations and treatment characteristics of 50 refractory multiple myeloma patients sorted by drug refractory status and CRBN pathway mutations. To enhance comparability, a second version of Figure 1, sorted by CRBN associated genes (CRBN, IRF4, IKZF-1 and CUL4B, thereafter according to mutation frequency; top to bottom) and patients refractory status immediately prior to sampling (IMIDrefractory, PI-refractory, refractory to other drug classed and not refractory; from left to right) is provided. As in Figure 1, all patients are labeled with individual numbers. Refractory status to immunomodulatory drugs (IMiDs) or proteasome inhibitors (PIs) at any time prior to sampling is shown as well as progressive disease (PD) and refractory (IMiD, PI, other drug classes) status immediately prior to sampling. Information on the adverse cytogenetic aberrations gain 1q21 (> 2 copies), deletion (17p), translocation t(4;14) and t(14;16) are depicted. Genes mutated in at least one case are displayed. Mutation frequencies are displayed by red bars. 2

3 Treatment characteristics, cytogenetic aberrations are color-coded: red = yes; green = no; grey = unknown/not available; refractory drugs immediately prior to sampling: purple = IMiD-refractory; blue = PI-refractory; orange = other drug classes (including cytotoxic agents and antibodies); green = not refractory to treatment immediately prior to sampling. 3

4 Supplementary Figure 2 Patient #32 Patient #24 Patient #12 Supplementary Figure 2: Clonal evolution in 3 MM patients with acquired IMiD resistance at time point 2. In all three cases a subclonal CRBN mutation was identified at that time point that was not detectable at prior, IMiD sensitive time point 1. 4

5 Supplementary Table 1: Supplementary Table 1: Genes included in M 3 Pv3.0 design 5

6 Supplementary Table 2: Variant Table gene patient # chromosomal position coding type VR% transcript Ensembl transcript ID location function protein SIFT Provean PREDICTION PREDICTION (cutoff=0.05) (cutoff=-2.5) XBP1 1 chr22: c.940_958delctgggtatctcaaatctgc INDEL 60% NM_ ENST exonic frameshiftdeletion p.leu314ffs*38 NA NA NA TP53 1 chr17: c.814g>a SNV 90% NM_ ENST exonic missense p.val272met Damaging Neutral probably damaging RASA2 1 chr3: c.643a>t SNV 30% NM_ ENST exonic nonsense p.lys215ter NA NA NA PIM3 1 chr22: c.898_899delinsac SNV 52% NM_ ENST exonic missense p.val300thr Tolerated Neutral benign BRAF 1 chr7: c.1799t>a SNV 64% NM_ ENST exonic missense p.val600glu Damaging Deleterious probably damaging DUSP2 1 chr2: c.719t>g SNV 50% NM_ ENST exonic missense p.ile240arg Damaging Deleterious probably damaging MAFB 1 chr20: c.725a>c SNV 49% NM_ ENST exonic missense p.lys242thr Damaging Deleterious probably damaging KRAS 2 chr12: c.57g>t SNV 50% NM_ ENST exonic missense p.leu19phe Damaging Deleterious probably damaging MAF 2 chr16: c.824a>g SNV 91% NM_ ENST exonic missense p.asn275ser Damaging Deleterious probably damaging IKZF1 2 chr7: c.454g>a SNV 31% NM_ ENST exonic missense p.ala152thr Damaging Deleterious probably damaging TP53 3 chr17: c.412_412delg INDEL 95% NM_ ENST exonic frameshiftdeletion p.ala138fs NA NA NA NRAS 3 chr1: c.183a>c SNV 58% NM_ ENST exonic missense p.gln61his Damaging Deleterious benign RB1 3 chr13: c.958c>t SNV 100% NM_ ENST exonic nonsense p.arg320ter NA NA NA FAM46C 3 chr1: c.569_573delctttg INDEL 51% NM_ ENST exonic frameshiftdeletion p.leu191fs NA NA NA SP140 4 chr2: c.1618a>g SNV 3% NM_ ENST exonic missense p.asn540asp Tolerated Neutral benign CRBN 5 chr3: c _1178delggtatgcctggactgttgcccagtgtaagat INDEL 38% NM_ ENST splicesite_5 frameshiftdeletion p.i393mfs10 NA NA NA KRAS 5 chr12: c.183a>c SNV 27% NM_ ENST exonic missense p.gln61his Damaging Deleterious benign TRAF3 5 chr14: c.1081_1081delg INDEL 38% NM_ ENST exonic frameshiftdeletion p.val361fs NA NA NA CUL4B 6 chrx: c.2221a>g SNV 5% NM_ ENST exonic missense p.lys741glu Damaging Deleterious probably damaging TP53 6 chr17: c.738g>a SNV 14% NM_ ENST exonic missense p.met246ile Damaging Deleterious probably damaging TP53 6 chr17: c.281c>g SNV 7% NM_ ENST exonic nonsense p.ser94ter NA NA NA SHC1 6 chr1: c.904a>c SNV 12% NM_ ENST exonic missense p.ser302arg Damaging Deleterious possibly damaging CUL4B 6 chrx: SNV 18% NM_ ENST splicesite_3 missense NA NA NA KRAS 7 chr12: c.35g>t SNV 95% NM_ ENST exonic missense p.gly12val Damaging Deleterious probably damaging IDH1 7 chr2: c.395g>a SNV 50% NM_ ENST exonic missense p.arg132his Damaging Deleterious benign NRAS 8 chr1: c.35g>c SNV 80% NM_ ENST exonic missense p.gly12ala Damaging Deleterious possibly damaging CDKN2C 8 chr1: c.133a>g SNV 7% NM_ ENST exonic missense p.met45val Damaging Deleterious benign CYLD 8 chr16: c.1096_1096delc INDEL 50% NM_ ENST exonic frameshiftdeletion p.q366nfs*42 NA NA NA BRAF 8 chr7: c.1397g>t SNV 10% NM_ ENST exonic missense p.gly466val Damaging Deleterious probably damaging KRAS 9 chr12: c.37g>t SNV 37% NM_ ENST exonic missense p.gly13cys Damaging Deleterious probably damaging EGR1 9 chr5: c.103c>g SNV 36% NM_ ENST exonic missense p.leu35val Damaging Neutral probably damaging TP53 11 chr17: c.584t>c SNV 13% NM_ ENST exonic missense p.ile195thr Damaging Deleterious probably damaging CRBN 12 chr3: c.979c>t SNV 7% NM_ ENST exonic nonsense p.gln327ter NA NA NA DIS3 12 chr13: c.1460a>t SNV 48% NM_ ENST exonic missense p.asp487val Damaging Deleterious probably damaging NRAS 12 chr1: c.34g>c SNV 50% NM_ ENST exonic missense p.gly12arg Damaging Deleterious possibly damaging PIM1 12 chr6: c.256g>a SNV 70% NM_ ENST exonic missense p.val86met Damaging Neutral possibly damaging NRAS 13 chr1: c.182a>g SNV 20% NM_ ENST exonic missense p.gln61arg Damaging Deleterious benign STAT3 13 chr17: c.28c>g SNV 29% NM_ ENST exonic missense p.leu10val Damaging Neutral probably damaging MYD88 14 chr3: c.666t>a SNV 5% NM_ ENST exonic missense p.ser222arg Damaging Neutral probably damaging CUL4B 15 chrx: c.2459g>c SNV 25% NM_ ENST exonic missense p.arg820thr Damaging Deleterious probably damaging NRAS 15 chr1: c.38g>t SNV 25% NM_ ENST exonic missense p.gly13val Damaging Deleterious probably damaging FAM46C 15 chr1: c.869_873delcttac INDEL 43% NM_ ENST exonic frameshiftdeletion p.tyr291fs NA NA NA Polyphen 2 prediction 6

7 KRAS 16 chr12: c.34g>t SNV 56% NM_ ENST exonic missense p.gly12cys Damaging Deleterious probably damaging IRF4 17 chr6: c.368a>g SNV 47% NM_ ENST exonic missense p.lys123arg Damaging Deleterious probably damaging ATM 17 chr11: INDEL 45% NM_ ENST splicesite_5 frameshiftdeletion NA NA NA CCND1 17 chr11: c.86g>t SNV 41% NM_ ENST exonic missense p.arg29leu Damaging Deleterious benign KRAS 17 chr12: c.351a>t SNV 58% NM_ ENST exonic missense p.lys117asn Damaging Deleterious probably damaging TP53 18 chr17: c.518t>a SNV 13% NM_ ENST exonic missense p.val173glu Damaging Deleterious probably damaging KRAS 19 chr12: c.183a>c SNV 17% NM_ ENST exonic missense p.gln61his Damaging Deleterious benign KRAS 20 chr12: c.183a>c SNV 17% NM_ ENST exonic missense p.gln61his Damaging Deleterious benign TP53 20 chr17: c.524g>a SNV 38% NM_ ENST exonic missense p.arg175his Damaging Deleterious possibly damaging KRAS 21 chr12: c.35g>a SNV 49% NM_ ENST exonic missense p.gly12asp Damaging Deleterious possibly damaging BIRC2 21 chr11: c.184g>t SNV 3% NM_ ENST exonic missense p.val62phe Damaging Deleterious possibly damaging KRAS 22 chr12: c.35g>c SNV 19% NM_ ENST exonic missense p.gly12ala Damaging Deleterious possibly damaging BRAF 23 chr7: c.1780g>a SNV 31% NM_ ENST exonic missense p.asp594asn Damaging Deleterious probably damaging PTPN11 23 chr12: c.1507g>a SNV 39% NM_ ENST exonic missense p.gly503arg Damaging Deleterious probably damaging CRBN 24 chr3: c.1142t>g SNV 7% NM_ ENST exonic missense p.phe381cys Damaging Deleterious probably damaging BRAF 24 chr7: c.1799t>a SNV 27% NM_ ENST exonic missense p.val600glu Damaging Deleterious probably damaging KRAS 25 chr12: c.38g>a SNV 38% NM_ ENST exonic missense p.gly13asp Damaging Deleterious possibly damaging TP53 25 chr17: c.481g>a SNV 3% NM_ ENST exonic missense p.ala161thr Damaging Neutral probably damaging CARD11 26 chr7: c.2471a>c SNV 31% NM_ ENST exonic missense p.asp824ala Tolerated Neutral benign NRAS 27 chr1: c.181c>a SNV 38% NM_ ENST exonic missense p.gln61lys Damaging Deleterious possibly damaging NFKB2 27 chr10: c.1745t>c SNV 21% NM_ ENST exonic missense p.leu582pro Damaging Deleterious probably damaging NFKB2 27 chr10: c.1916a>c SNV 5% NM_ ENST exonic missense p.his639pro Damaging Deleterious probably damaging ATM 28 chr11: c.3378a>c SNV 58% NM_ ENST exonic missense p.lys1126asn Tolerated Neutral possibly damaging NRAS 28 chr1: c.38g>a SNV 54% NM_ ENST exonic missense p.gly13asp Damaging Deleterious benign IRF4 29 chr6: c.176a>g SNV 39% NM_ ENST exonic missense p.lys59arg Tolerated Deleterious probably damaging BIRC3 29 chr11: c.599g>c SNV 29% NM_ ENST exonic missense p.gly200ala Tolerated Neutral possibly damaging KRAS 30 chr12: c.183a>c SNV 58% NM_ ENST exonic missense p.gln61his Damaging Deleterious benign MAX 30 chr14: c.214c>t SNV 77% NM_ ENST exonic nonsense p.gln72* NA NA NA TP53 30 chr17: c.840a>c SNV 41% NM_ ENST exonic missense p.arg280ser Damaging Deleterious probably damaging TRAF3 30 chr14: c.1418t>g SNV 71% NM_ ENST exonic missense p.leu473arg Damaging Deleterious probably damaging SP chr2: c.1711c>t SNV 42% NM_ ENST exonic nonsense p.arg571ter NA NA NA DIS3 31 chr13: c.2325t>g SNV 87% NM_ ENST exonic missense Phe775Leu Damaging Deleterious probably damaging BRAF 31 chr7: c.1799t>a SNV 42% NM_ ENST exonic missense p.val600glu Damaging Deleterious probably damaging CRBN 32 chr3: c.1232c>a SNV 5% NM_ ENST exonic missense p.pro411his Damaging Deleterious probably damaging TLR4 32 chr9: c.1212a>c SNV 9% NM_ ENST exonic missense p.leu404phe Damaging Deleterious probably damaging KRAS 32 chr12: c.35g>a SNV 49% NM_ ENST exonic missense p.gly12asp Damaging Deleterious possibly damaging STAT3 32 chr17: c.394c>g SNV 11% NM_ ENST exonic missense p.pro132ala Tolerated Neutral probably damaging NFKB2 32 chr10: c.2200c>g SNV 5% NM_ ENST exonic missense p.leu734val Damaging Neutral benign BRAF 33 chr7: c.1405g>a SNV 17% NM_ ENST exonic missense p.gly469arg Damaging Deleterious probably damaging CRBN 34 chr3: SNV 21% NM_ ENST splicesite_5 missense NA NA NA BRAF 34 chr7: c.1799t>a SNV 35% NM_ ENST exonic missense p.val600glu Damaging Deleterious probably damaging IGF1R 35 chr15: c.2558c>t SNV 22% NM_ ENST exonic missense p.pro853leu Tolerated Neutral benign NRAS 36 chr1: c.38g>a SNV 13% NM_ ENST exonic missense p.gly13asp Damaging Deleterious benign 7

8 TRAF3 37 chr14: SNV 3% NM_ ENST splicesite_3 missense NA NA NA FAM46C 37 chr1: c.64_77delgttagccggctgca INDEL 25% NM_ ENST exonic frameshiftdeletion p.val22fs NA NA NA IL6ST 37 chr5: c.647c>a SNV 39% NM_ ENST exonic missense p.pro216his Damaging Deleterious probably damaging CUL4B 38 chrx: c.1270g>a SNV 5% NM_ ENST exonic missense p.glu424lys Damaging Deleterious probably damaging NR3C1 38 chr5: c.1832g>a SNV 7% NM_ ENST exonic missense p.arg611lys Damaging Deleterious probably damaging CUL4B 38 chrx: c.1219g>a SNV 5% NM_ ENST exonic missense p.glu407lys Tolerated Neutral benign PSMD1 38 chr2: c.11c>g SNV 8% NM_ ENST exonic missense p.ser4trp Damaging Deleterious probably damaging KRAS 38 chr12: c.34g>a SNV 46% NM_ ENST exonic missense p.gly12ser Damaging Deleterious possibly damaging PIK3CA 38 chr3: c.269g>a SNV 3% NM_ ENST exonic missense p.cys90tyr Damaging Deleterious probably damaging CARD11 38 chr7: c.3424g>a SNV 4% NM_ ENST exonic missense p.glu1142lys Damaging Neutral probably damaging PSMB8 38 chr6: c.92c>t SNV 5% NM_ ENST exonic missense p.thr31met Tolerated Neutral NA ATM 38 chr11: c.1409c>g SNV 6% NM_ ENST exonic nonsense p.ser470ter NA NA NA NR3C1 38 chr5: c.1027c>t SNV 17% NM_ ENST exonic nonsense p.gln343ter NA NA NA NR3C1 38 chr5: c.1375g>a SNV 7% NM_ ENST exonic missense p.gly459arg Damaging Deleterious probably damaging CRBN 38 chr3: c.721_722insgggc INDEL 25% NM_ ENST exonic frameshiftinsertion p.pro241argfs*10 NA NA NA NR3C1 38 chr5: c.1465g>t SNV 8% NM_ ENST exonic nonsense p.glu489ter NA NA NA ATM 39 chr11: c.2572t>c SNV 35% NM_ ENST exonic missense Phe858Leu Tolerated Deleterious possibly damaging FGFR3 40 chr4: c.742c>t SNV 42% NM_ ENST exonic missense p.arg248cys Damaging Deleterious probably damaging NFKBIA 40 chr14: c.650g>a SNV 8% NM_ ENST exonic missense p.gly217asp Damaging Deleterious probably damaging FAM46C 40 chr1: c.274g>a SNV 5% NM_ ENST exonic missense p.asp92asn Damaging Deleterious probably damaging RASA2 40 chr3: c.539g>a SNV 8% NM_ ENST exonic missense p.cys180tyr Damaging Deleterious probably damaging BRAF 41 chr7: c.1497a>c SNV 52% NM_ ENST exonic missense p.lys499asn Damaging Deleterious possibly damaging BRAF 41 chr7: c.2083g>a SNV 39% NM_ ENST exonic missense p.glu695lys Damaging Deleterious benign TP53 41 chr17: c.722c>g SNV 90% NM_ ENST exonic missense p.ser241cys Damaging Deleterious probably damaging NFKB2 42 chr10: c.1336t>g SNV 14% NM_ ENST exonic missense p.tyr446asp Tolerated Neutral possibly damaging KRAS 43 chr12: c.53c>t SNV 70% NM_ ENST exonic missense p.ala18val Damaging Deleterious probably damaging TP53 43 chr17: c.542g>a SNV 7% NM_ ENST exonic missense p.arg181his Damaging Neutral probably damaging BTG1 44 chr12: c.139c>a SNV 38% NM_ ENST exonic missense p.leu47met Tolerated Neutral benign BIRC2 44 chr11: c.488c>g SNV 8% NM_ ENST exonic missense p.ser114cys Damaging Neutral benign TRAF3 44 chr14: c.1678g>c SNV 45% NM_ ENST exonic missense p.val560leu Damaging Deleterious probably damaging CYLD 44 chr16: c.2497c>t SNV 27% NM_ ENST exonic missense p.his833tyr Damaging Deleterious probably damaging NRAS 45 chr1: c.182a>g SNV 22% NM_ ENST exonic missense p.gln61arg Damaging Deleterious benign NFKB2 45 chr10: c.1069g>c SNV 19% NM_ ENST exonic missense p.gly357arg Tolerated Deleterious probably damaging NRAS 46 chr1: c.182a>g SNV 12% NM_ ENST exonic missense p.gln61arg Damaging Deleterious benign TP53 46 chr17: c.329g>t SNV 16% NM_ ENST exonic missense p.arg110leu Damaging Deleterious benign TP53 46 chr17: c.452c>g SNV 7% NM_ ENST exonic missense p.pro151arg Damaging Deleterious probably damaging FAM46C 46 chr1: c.882c>g SNV 16% NM_ ENST exonic missense p.asn294lys Damaging Deleterious benign NRAS 47 chr1: c.182a>g SNV 36% NM_ ENST exonic missense p.gln61arg Damaging Deleterious benign TP53 47 chr17: c.395a>g SNV 6% NM_ ENST exonic missense p.lys132arg Damaging Deleterious probably damaging ATM 48 chr11: c.6067g>a SNV 56% NM_ ENST exonic missense p.gly2023arg Damaging Deleterious NA NRAS 48 chr1: c.183a>t SNV 7% NM_ ENST exonic missense p.gln61his Damaging Deleterious benign KRAS 49 chr12: c.71t>a SNV 14% NM_ ENST exonic missense p.ile24asn Damaging Deleterious probably damaging FGFR3 49 chr4: c.2427a>c SNV 35% NM_ ENST exonic stop_lost p.*809c Damaging Neutral NA DIS3 49 chr13: c.2258a>g SNV 22% NM_ ENST exonic missense p.tyr753cys Damaging Deleterious probably damaging BRAF 49 chr7: c.1780g>a SNV 31% NM_ ENST exonic missense p.asp594asn Damaging Deleterious probably damaging IDH2 49 chr15: c.632a>g SNV 3% NM_ ENST exonic missense p.asn211ser Damaging Neutral benign CDKN1B 49 chr12: c.163_164delgc InDelframeshift 12% NM_ ENST exonic frameshiftdeletion p.ala55glufs*69 NA NA NA IL6ST 50 chr5: g.38954g>a SNV 37% NM_ ENST exonic missense p.ala418thr Tolerated NA benign NRAS 50 chr1: c.35g>a SNV 61% NM_ ENST exonic missense p.gly12asp Damaging Deleterious benign FAM46C 50 chr1: c.448_456delgaccgctgg INDEL 7% NM_ ENST exonic frameshiftdeletion NA Deleterious NA TP53 50 chr17: c.451c>a SNV 40% NM_ ENST exonic missense p.pro151thr Damaging Deleterious possibly damaging 8

9 Supplementary methods: Details on preparation of the lentiviral vectors for CRBN mutants and wild type: We first created a lenti-vector pcdhpurocrbn to overexpress wild type CRBN by subclone wild type CRBN from pcdhgfpcrbn as previously reported by our group. Then we used pcdhpurocrbn as a template to introduce the CRBN mutations. All mutations were introduced by PCR. In patient #12 (chr3: , genotype G/A) the mutation causes an early termination of transcription. The following pair of primers was used for this patient (forward primer: 5 -cacgctgttttgacctccatagaagattc and reverse primer: 5 - gtctcaggatccttaacattgtttacagcaaagg) to introduce the mutation (stop code added at 3 primer). For creating the CRBN mutation of patient #24 (chr3: genotype A/C) we used two rounds of PCR. In the first round we ran two PCRs with two pair of primers (PCR1: forward primer: 5 -cacgctgttttgacctccatagaagattc and reverse primer: 5 - aggacaccagctgtgttctgtagaa; PCR2: forward primer: 5 - cacagctggtgtcctgggtatgcctggactg and reverse primer: 5 - ACCGGAGCGATCGCAGATCCTTC). The point mutation was introduced by the reverse primer in the PCR1 and forward primer at PCR2). After purification PCR1 and PCR2 was combined together as a template, then amplified by a pair of primers (forward primer: 5 -Cacgctgttttgacctccatagaagattc and reverse primer: 5 - ACCGGAGCGATCGCAGATCCTTC). The mutation of patient #32 was introduced in a way similar with patient #24. Mutated CRBN was cloned into a lenti-vector pcdh-cmv-mcs-ef1-puro (SBI, Mountain View, CA 94043) which was packaged into lentivirus and infected myeloma cells. After selection with puromycin My5 cells over expression either wild type or mutated CRBN were tested response against LEN. Colorimetric assays were also performed to assay drug activity. Cells from 48-hour cultures were pulsed with 10 μl of 5 mg/ml 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrasodium bromide (MTT; Chemicon International Inc, Temecula, CA) to each well for 4 hours, followed by 100 μl isopropanol that contained 0.04 HCl. Absorbance readings at a wavelength of 570 nm were taken on a spectrophotometer. 9