REGULATION OF HUMAN MMP-9 GENE EXPRESSION BY TRANSCRIPTIONAL COACTIVATORS AND INTERFERON BETA XUEYAN ZHAO

Transcription

1 REGULATION OF HUMAN MMP-9 GENE EXPRESSION BY TRANSCRIPTIONAL COACTIVATORS AND INTERFERON BETA by XUEYAN ZHAO ETTY N. BENVENISTE, COMMITTEE CHAIR MICHAEL BRENNER JAMES COLLAWN FANG-TSYR LIN L. BURT NABORS A DISSERTATION Submitted to the graduate faculty of The University of Alabama at Birmingham, in partial fulfillment of the requirements for the degree of Doctor of Philosophy BIRMINGHAM, ALABAMA 2008

2 REGULATION OF HUMAN MMP-9 GENE EXPRESSION BY TRANSCRIPTIONAL COACTIVATORS AND INTERFERON BETA XUEYAN ZHAO CELL BIOLOGY ABSTRACT Matrix metalloprotinases are zinc-dependent endopeptidases with broad substrates from extracellular matrix proteins to bioactive molecules. Physiologically, they regulate tissue remodeling and immune responses. However, in cancers and inflammatory diseases, MMP expression is increased and exacerbates disease development. Aberrant upregulation of one MMP, MMP-9, is closely related to disease progression. Understanding positive and negative regulation of MMP-9 will shed light on the rational design of MMP-9 inhibitors. First, I investigated the roles of transcriptional coactivators in MMP-9 gene expression. Histone acetyltransferases (HAT) CBP/p300 and PCAF can activate MMP-9 promoter activity and this requires the HAT activity of PCAF. CARM1 acts as coactivator through its protein arginine methyltransferase activity. GRIP1, a p160 protein, has only a modest effect alone on MMP-9 transcription, but shows significant synergy with p300 and CARM1. Furthermore, this synergy relies on the interaction of p300 with the AD1 domain of GRIP1 and CARM1 with the AD2 domain of GRIP1. In addition, all these coactivators are present at the endogenous MMP-9 promoter as demonstrated by chromatin immunoprecipitation (ChIP) assays. Knockdown of p300, CARM1 and GRIP1 greatly reduces the expression of endogenous MMP-9. This study identifies the critical function of coactivators in activation of MMP-9 expression. ii

3 Next, I studied the mechanism of negative regulation of PMA-induced MMP-9 expression by IFN-β. Gene activation by IFN-β is well studied and it is mediated mainly through activation of the JAK-STAT pathway. This pathway activates two potent transcriptional activation complexes, GAF (STAT-1 homodimer) and ISGF3 (STAT-1, STAT-2 and IRF-9). My studies show that STAT-1, STAT-2 and IRF-9 are required for IFN-β inhibition of MMP-9 expression in cells that lack functional STAT-1, STAT-2, and IRF-9. However, the ISGF3 components are not associated with the MMP-9 promoter and IFN-β does not inhibit the signaling pathways responsible for MMP-9 induction. Lastly, ChIP assays illustrate that IFN-β reduces association of NF-κB p65, Sp1, CBP, p300 and RNA Pol II, and decreases permissive acetylation of histones H3 and H4 on the MMP-9 promoter. This work demonstrates for the first time that IFN-β activated ISGF3 complex not only activates but suppresses gene expression. iii

4 DEDICATION This dissertation is dedicated to my parents, Shenghua Zhao ( 赵生华 ) and Ailan Liu ( 柳爱兰 ). iv

5 ACKNOWLEDGMENTS The work presented in this dissertation would not have been possible without the assistance and guidance from various people who deserve special acknowledgment. I want to express my deepest respect and gratitude to my mentor, Dr. Etty (Tika) Benveniste, who gave me inspiration, generous support, constant encouragement, and invaluable advice throughout my doctoral study, and was extremely patient to assist me with scientific writing. I am very fortunate to have Dr. Etty (Tika) Benveniste as my mentor, from whom I got systematic and comprehensive training and preparation for being a successful scientist in the future. I am also very grateful for having an exceptional graduate committee and wish to thank Drs. Michael Brenner, James Collawn, Fang-Tsyr Lin and L. Burt Nabors for their resourceful comments and suggestions, continual support and encouragement. I also appreciate the assistance and friendship from the past and present members of Dr. Etty (Tika) Benveniste s lab. Finally, I would like to thank my husband s and my family for being extremely understanding and supportive throughout so many years. I'm especially grateful to my husband, Kai Chen, for his constant encouragement and support, which made it possible for me to start and successfully complete my doctoral study and at the same time to keep our life in proper balance. v

6 TABLE OF CONTENTS Page ABSTRACT... ii DEDICATION... iv ACKNOWLEDGMENTS...v LIST OF FIGURES... vii INTRODUCTION...1 Matrix Metalloproteinases...1 Eukaryotic Transcriptional Initiation...7 Matrix Metalloproteinase Histone Acetyltransferases...12 Protein Arginine Methyltransferase...15 The p160 Steroid Receptor Coactivator Family...17 Interferons...18 Significance...22 TRANSCRIPTIONAL ACTIVATION OF HUMAN MATRIX METALLOPROTEINASE- 9 GENE EXPRESSION BY MULTIPLE COACTIVATORS...24 THE INTERFERON-STIMULATED GENE FACTOR 3 COMPLEX MEDIATES THE INHIBITORY EFFECT OF INTERFERON-β ON MATRIX METALLOPROTEINASE- 9 EXPRESSION...65 CONCLUSIONS GENERAL LIST OF REFERENCES APPENDIX A vi

7 LIST OF FIGURES Figures Page INTRODUCTION 1 Function domains of human MMPs The transcription initiation complex Important cis-elements and their trans-activators in the MMP-9 promoter The domain structure of CBP/p300 and their interacting proteins Interferons (IFNs) activate the JAK-STAT pathway...20 TRANSCRIPTIONAL ACTIVATION OF HUMAN MATRIX METALLOPROTEINASE- 9 GENE EXPRESSION BY MULTIPLE COACTIVATORS 1 CBP and p300 function as coactivators for MMP-9 promoter activity PCAF enhances MMP-9 promoter activity and its HAT activity is necessary for optimal induction CARM1 and GRIP1 activate MMP-9 promoter transcription and CARM1 methyltransferase activity is required Synergy among p300, CARM1 and GRIP1 is dependent on the AD1 and AD2 domains of GRIP Knockdown of p300, CARM1 and GRIP1 reduces MMP-9 mrna expression Synergy among coactivators in MMP-9 gene expression...64 THE INTERFERON-STIMULATED GENE FACTOR 3 COMPLEX MEDIATES THE INHIBITORY EFFECT OF INTERFERON-β ON MATRIX METALLOPROTEINASE- 9 EXPRESSION 1 STAT-1 is required for IFN-β-mediated MMP-9 inhibition, and the differential effect of STAT-1 mutants on IFN-β-mediated MMP-9 inhibition vii

8 LIST OF FIGURES (Continued) Figures Page 2 STAT-2 and its transactivation domain are required for IFN-β-mediated inhibition of MMP-9 gene expression IRF-9 is required for IFN-β-mediated inhibition of MMP-9 gene expression The ISGF3 complex is recruited to the IRF-7 promoter but not to the MMP-9 promoter IFN-β does not inhibit activation of the ERK1/2 and NF-κB pathways IFN-β inhibits PMA-induced transcriptional activation of the MMP-9 promoter Proposed model of IFN-β-mediated MMP-9 gene suppression APPENDIX A 1 In vivo association of CBP with STAT-1α and STAT-2 and overexpression of CBP/p300 relieves IFN-β-mediated MMP-9 gene suppression viii

9 INTRODUCTION Matrix Metalloproteinases Matrix metalloproteinases (MMPs) are a group of 23 structurally conserved proteolytic enzymes in humans (Figure 1), which degrade all components of the extracellular matrix (ECM) and basement membranes in a concerted manner, and process bioactive mediators such as cell-surface-receptors, cytokines and chemokines (1). Historically, they were named by their substrate specificity. Later, it was found that they have extended substrates, so a sequential numbering system is used to name the MMPs (Figure 1) (2, 3). Most MMPs are secreted proteins, but six members are membranebound MMPs (MT-MMP) and MMP-23 is a unique type II transmembrane protein (Figure 1) (1, 3). They share some common domain structures such as a signal sequence, prodomain and catalytic domain (Figure 1) (1-3). The N-terminal signal sequence directs the newly synthesized proteins to the endoplasmic reticulum, followed by a prodomain with a conserved cysteine, the SH group of which binds to zinc ions to block the function of the catalytic domain (1-3). Therefore, MMPs are synthesized as inactive proenzymes or zymogens, and they are activated after cleavage of the prodomain by activated MMPs or serine proteinases (1-3). The catalytic domain has a conserved zinc ion binding motif HEXXHXXGXXH (H, histidine; E, glutamic acid; X, any amino acid; G; glycine), in which the three histidines bind to catalytic zinc ions, and the catalytic zinc ions are able to bind a hydrolytic water ion and the substrate (1-3). Some MMPs also have unique domains (Figure 1). The hemopexin domain contributes to substrate specificity, 1

10 interaction with MMP endogenous inhibitors and cell-surface molecules (1-3). The gelatinases, MMP-2 and MMP-9, have three fibronectin type II repeats to bind gelatin (1-3). MMP-9 has a unique O-glycosylated domain for interacting with multiple O-linked sugars (3). The membrane-bound MMPs are anchored to the cell membranes through their transmembrane domain or glycosyl phosphatidylinositol (GPI) anchor (2, 3). MMPs that are cleaved by furin also have a furin cleavage site (2, 3). MMP-23 is a special MMP with a cysteine array and immunoglobulin-like domain (2, 3). MMPs have an extensive substrate spectrum to regulate normal physiological processes such as embryonic development, reproduction, and wound healing, as well as pathological processes such as inflammatory diseases and cancers (4-6). Several MMP knockout mice, including MMP-9, 2, 13 and 14, demonstrate defects in bone modeling and remodeling, which relates to their ability to cleave galectin-3, vascular endothelial growth factor (VEGF), collagens and aggrecan (1). MMP-2 and 3 knockout mice have abnormal mammary gland development and MMP-2, 9 and 14 knockouts show abnormal embryonic vascular development (1). MMPs also participate in innate immunity and inflammation. Injury of the physical defense barrier, the epithelium, induces expression of several MMPs such as MMP-1 and 7 to repair the injury. Both MMP-7 activated α- defensins and the hemopexin domain of MMP-12 have direct bactericidal activity (7). Furthermore, MMPs have pro-inflammatory activities by activating membrane-bound pro-inflammatory cytokines such as tumor necrosis factor-α (TNF-α) and interleukin-1β (IL-1β) and by increasing the chemotactic activity of IL-8 (7). On the other hand, they have anti-inflammatory activities by cleaving several chemokines to produce truncated 2

11 antagonists and by activating the anti-inflammatory cytokine transforming growth factorβ1 (TGF-β1) (7). In several autoimmune diseases, the levels of MMPs are elevated which contribute to disease development. For example, in rheumatoid arthritis, MMP-3 released 3

12 soluble Fas ligand and MMP-7 and membrane-bound MMPs cleavage of RANK ligand contributes to this disease (3). In the neuroinflammatory disease of Multiple Sclerosis (MS), MMPs play several detrimental roles including cleavage of the blood-brain-barrier to allow infiltration of inflammatory cells into the CNS, digestion of myelin basic protein resulting in demyelination and production of encephalitogens, activation of proinflammatory cytokines and production of neurotoxic molecules (8). In particular, MMP- 9 levels in cerebrospinal fluid and serum of MS patients is upregulated, and inhibition of MMP-9 levels by interferon β (IFN-β) is a clinically effective treatment for MS patients (8). MMPs are also closely related to cancer progression, and their expression and activation are upregulated in almost all human cancers (2). In the late 1980s and early 1990s, MMPs were classically viewed as being produced and secreted by tumor cells. They promote tumor cell invasion and metastasis by degrading the ECM and basement membranes (5). Currently, it has been recognized that MMPs can be synthesized not only by tumor cells but also by surrounding stromal cells, such as fibroblasts and infiltrating inflammatory cells. Moreover, they regulate various cell behaviors related to cancer biology, including tumor growth, angiogenesis, apoptosis and immune surveillance (2, 5). MMP expression is primarily regulated at the transcriptional level. The MMP promoters have several cis-elements important for their transcriptional expression, and those elements are recognized by their transcriptional activators, which are activated by growth factors, cytokines, chemokines and phorbol esters (9). Recently, the MMP promoters were classified into three groups according to the composition of cis-elements identified by functional or bioinformatic analysis (9, 10). The first group of MMPs have a TATA box at approximately -30 bp and an AP-1 site at approximately -70 bp, including 4

13 MMP-1, 3, 7, 9, 10, 12, 13, 19, 20 and 26; group two MMPs have a TATA box but no proximal AP-1 site, including MMP-8, 11, 15, 21 and 27; and the third group of MMPs have neither a TATA box nor a proximal AP-1 site, including MMP-2, 14, 16, 17, 23, 24, 25 and 28 (9, 10). Expression of the third group of MMPs is mostly constitutive (9). The proximal AP-1 element in the group 1 MMPs usually cooperates with an adjacent PEA3 site to regulate MMP transcription. A number of cytokines or growth factors such as interleukins (ILs), epidermal growth factor, keratinocyte growth factor, nerve growth factor, basic fibroblast growth factor, VEGF, platelet-derived growth factor, TNF-α and TGF-β activate mitogen-activated protein kinases (MAPKs) which either phosphorylate AP-1 and ETS proteins or increase transcription of AP-1 proteins to enhance MMP expression (9). Several MMP promoters also have multiple proximal GC-boxes which are bound by Sp1, Sp3 or other GC box binding proteins to regulate their transcription such as MMP-2 and 14 (10). Nuclear factor-kappa B (NF-κB) proteins are able to induce transcription of MMP-9 through an NF-κB site in its promoter. Although there are no classical NF-κB sites in the promoters of MMP-1, 3 and 11, they are still able to be regulated by the NF-κB pathway (9). The NF-κB pathway is activated by proinflammatory cytokines such as TNF-α and IL-1, pathogens and stress signals to play critical roles in innate and adaptive immune responses (11) and cancer development and progression (12). The Wnt signaling pathway is involved in the expression of MMP-7, 14, 12 and 26 by binding of β catenin to the Tcf-4 site in their promoters (9). MMP-13 expression is induced by TGF-β activated Smad3 (9). In addition to positive regulation by multiple pathways, MMP expression is also subjected to negative regulation. For example, TGF-β inhibits MMP-1, 3, and 9 expression, and IFN-γ and IFN-β repress 5

14 MMP-9 and 13 expression (13-15). Although many MMPs share similar cis-elements in their promoters, their expression is specifically regulated in different cell types or tissues. For instance, the MMP-13 promoter has a unique Runx-2 binding site, which binds to Runx-2 expressed in developing cartilage and bone. Therefore, MMP-13 is specifically expressed in bone osteoblasts (9). Chromatin structure and promoter polymorphisms also affect the transcriptional expression of MMPs (9, 10). MMPs are synthesized as proenzymes or zymogens, which are activated by a cysteine switch mechanism. Their activation requires disruption of the interaction between the SH group of cysteine in the prodomain and Zinc ions in the catalytic domain (16, 17). This can be achieved by physical agents such as sodium dodecyl sulfate and amino-phenyl mercuric acetate to modify the SH group or the structure of MMPs (16, 17). More importantly, the prodomain is subjected to proteolysis. Pro-protein convertases or furins recognize and intracellularly cleave at a conserved RXKR or RRKR (R, arginine; X, any amino acid; K, lysine) sequence between the catalytic domain and prodomain in about one third of the MMPs, including all membrane-bound MMPs (16). The prodomain can also be cleaved by activated MMPs. The best studied example is the activation of cell surface pro-mmp-2 by active MMP-14, which involves the formation of a 1:1:1 ratio ternary complex of MMP-14, pro-mmp-2 and tissue inhibitor of metalloproteinase 2 (TIMP)-2 (16). Studies suggest that the serine protease plasmin and mast cell chymase may also be MMP activation enzymes (16). Reactive oxygen species are able to activate some MMPs in vitro (16). Another level of control of MMP activity is achieved by their endogenous inhibitors. A group of four inhibitors, TIMP-1, 2, 3 and 4, form a reversible 1:1 complex 6

15 with active MMPs to inhibit their activity. Each TIMP has its own tissue-specific expression and binds different MMP members (2). TIMP expression is also regulated at the transcriptional level and is affected by multiple signaling pathways (10). Other MMP inhibitors include α2-macroglobulin, thrombospondin-1, thrombospondin-2, reversioninducing cysteine rich protein with Kazal motifs, and the noncollagenous 1 domain of collagen type IV (2). In addition, MMP activity is fine-tuned by several mechanisms, including regulation of mrna stability, translational efficiency, enzyme compartmentalization and secretion, cell-surface recruitment, substrate targeting, shedding, oligomerization, cellular uptake and internalization, and autolysis (18). Proper MMP expression and activity under normal conditions is under the control of coordination of all these mechanisms. Those mechanisms are disturbed in disease processes, and therefore lead to aberrant high proteolytic activity to promote cancer development and metastasis, and inflammatory responses. Eukaryotic Transcriptional Initiation Transcription initiation is the major regulatory point in the control of expression of protein-coding genes, since formation of the initiation complex on the correct promoter at the right time is a prerequisite to the later correct synthesis of mrna. The eukaryotic genome is assembled into chromatin and the basic repeating subunit of chromatin is the nucleosome, which is composed of a histone octamer core wrapped by about two turns of 146 base pair of DNA (19). The octamer is composed of a central heterotetramer of histones H3 and H4, flanked by two heterodimers of histones H2A and H2B (19). Each core histone has a globular domain that mediates histone-histone 7

16 interactions within the octomer and an amino-terminal residue segment that is rich in basic amino acids extending from the surface of the nucleosome, and H2A has an additional carboxy-terminal 37 residues protruding from the nucleosome (19, 20). These histone tails play an essential role in controlling the folding of the nucleosome structure into higher-order structures. Those tails are subjected to a number of covalent modifications, including acetylation and methylation of lysines and arginines, phosphorylation of serines and threonines, ubiquitination and sumoylation of lysines, as well as ribosylation (21). Individual or combinatorial modifications are associated with different biological functions (21). For example, in most cases, the acetylation of histones by histone acetyltransferases (HATs) is associated with transcriptional activation by neutralizing the positive charge of the lysine ε amino group to weaken internucleosomal interactions and destabilize the higher-order chromatin structure (22). The compacted chromatin structure makes DNA non-accessible to the transcriptional machinery. Unlike in prokaryotes, the regulation of transcriptional initiation in eukaryotic cells is complex and involves multiple protein complexes. The protein complexes include several groups: 1) sequence-specific DNA binding proteins that mediate gene-selective transcriptional activation or repression; 2) general transcription factors (GTFs) that recognize the core promoter, recruit the RNA polymerase II (Pol II) core complex, and catalyze RNA synthesis; 3) chromatin remodeling and modification complexes that assist the transcriptional apparatus to navigate through chromatin; and 4) the multifunctional intermediary co-regulators that integrate the interactions of other regulators, and have intrinsic enzymatic activity (23, 24). The expression of a specific gene is the result of coordination of all the regulators, and each gene has its own specific transcriptional 8

17 program (Figure 2) (25). Two models of the transcriptional program have been proposed. In the first, stepwise-assembly model, sequence specific activators gain limited access to DNA and recruit the chromatin remodeling and modification complexes to relax the chromatin structure and expose more enhancer sequences and the TATA initiation site, which leads to further recruitment of co-regulators, GTFs and RNA Pol II. In the second, pre-assembly model, the transcriptional regulators form a holoenzyme with chromatin remodeling and modification proteins, co-regulators, GTFs, and RNA Pol II. The holoenzyme is recruited to gene promoters via cooperative interactions with several gene regulators (23). 9

18 Matrix Metalloproteinase-9 MMP-9, also known as 92 kda gelatinase, gelatinase B or 92 kda type IV collagenase, is a member of the MMP family. MMP-9 cleaves ECM proteins such as collagen IV, V, gelatin II, vitronectin, myelin basic protein and activates functional proteins such as latent TGF-β1, pro-tnf-α, latent VEGF, IL-8, and stromal cell derived factor-1 (26). MMP-9 has important physiological functions in the female reproductive cycle, parturition, oligodendrocyte myelination, nephrogenesis, tooth and bone development, inflammation and wound healing (26). Certain cell types such as monocytes and tissue macrophages normally produce low levels of MMP-9. Its expression can be induced in many cell types by multiple stimuli including tumor promoters, growth factors, cytokines, oncogene products, and physiological mediators such as hormones (26). Similar to other MMP members, in inflammatory diseases and a variety of cancers, MMP-9 expression is upregulated (27, 28). Studies of MMP-9 deficient mice confirm its role in physiological and pathological processes (26). MMP-9 expression is mainly regulated at the transcriptional level. The MMP-9 promoter has several essential cis-elements, NF-κB, Sp1, AP-1 and Ets-1, which are critical for the transcriptional activation of MMP-9 (Figure 3) (26). The mechanisms of phorbol 12- myristate 13-acetate (PMA)-induced transcriptional expression of MMP-9 has been comprehensively studied in HeLa cells. Expression of MMP-9 results from the coordination of cell signaling, chromatin remodeling, histone modifications, and stepwise recruitment of transcription regulators (29). First, promoter assays with deletions or mutations of MMP-9 promoter constructs show that the NF-κB, the distal and proximal AP-1 and Sp1 sites are indispensible for PMA-induced MMP-9 expression (29). Next, 10

19 nucleosome mapping demonstrates that the MMP-9 promoter is arranged into a regular array of nucleosomes, and PMA treatment induces the relaxation of the nucleosomes (29). Restriction enzyme hypersensitivity analysis identifies that the nucleosomes covering the NF-κB, distal AP-1 and Sp1 elements are subjected to remodeling upon PMA treatment, and studies in chromatin remodeling complex component Brg-1 knockout cells indicate the requirement of Brg-1 for MMP-9 expression (29). PMA activates the mitogenactivated protein kinase kinase 1 (MEK1)/ extracellular signal-regulated kinase (ERK) and NF-κB pathways, and inhibitors or dominant-negative constructs of those pathways block the expression of MMP-9 (29). Chromatin immunoprecipitation (ChIP) assays demonstrate the formation of a transcriptional initiation complex on the endogenous MMP-9 promoter upon PMA treatment (29). The ERK and NF-κB pathways activate sequence specific transactivators such as AP-1 proteins, NF-κB components, and Sp1, which are recruited to the MMP-9 promoter, and the tails of histones are subjected to multiple permissive modifications, such as acetylation, methylation, and phosphorylation (29). At the same time, transcription coregulators including the camp-response-element binding protein (CREB)-binding protein (CBP), p300, coactivator-associated arginine methyltransferase 1 (CARM1) and IKK-α, and chromatin remodeling complex components, Brg-1 and hbrm, are recruited to the promoter (29). RNA Pol II is phosphorylated and recruited to the MMP-9 promoter to initiate MMP-9 transcription (29). Those events happen within 6 h after PMA treatment (29). Further studies reveal that in unstimulated conditions, the MMP-9 promoter is occupied by transcriptional corepressor complexes such as Sin3A/histone deacetylases-1 (HDAC-1) and nuclear receptor corepressor /HDAC-3, to repress expression of MMP-9, and the corepressors are 11

20 removed upon activation by PMA (29). GTFs including TFIIA, TFIIB, TATA-binding protein (TBP), TFIIE and TBP-associated factors (TAF) 250 are constitutively associated with the MMP-9 promoter (29). Collectively, analysis of transcriptional activation of the human MMP-9 gene by PMA in HeLa cells determines that its activation depends on the coordination and stepwise recruitment of the transcription complex to the preassembled MMP-9 promoter. Histone Acetyltransferases HATs are enzymes that catalyze the transfer of an acetyl group from acetyl-coa to the lysine ε-amino groups on the N-terminal tails of histones (30). They are grouped into five families, including the GCN5-related N acetyltransferases (GNATs); the MYST (for MOZ,Ybf2/Sas3, Sas2 and Tip60 )-related HATs; p300/cbp HATs; the general transcription factor HATs including the TFIID subunit TBP-associated factor-1 (TAF1); and the nuclear hormone-related HATs steroid receptor coactivator (SRC)-1 and SRC-3 (30).In addition to acetylating histones, HATs also function as acetyltransferases to acetylate non-histone substrates (30). CBP and p300 are the two most studied HATs, with 60% homology sharing conserved functional domains: three cysteine-histidine (CH)- 12

21 rich domains, a KIX domain to interact with CREB, a bromodomain to bind acetylated lysine residues, a HAT activity domain and a glutamine-rich region (Figure 4) (31). They also have many similar functions; therefore, they are often referred to as CBP/p300. By interacting with a variety of transcriptional factors at different domains (some interactions are shown in Figure 4), CBP/p300 play an essential role in regulation of RNA Pol II-mediated transcription as transcriptional coactivators (22, 31). They function through serving as 1) HATs to acetylate histones and transcription factors such as p53 and NF-κB p65 to increase DNA-binding ability of transcription factors (32, 33), 2) a bridge linking sequence-specific transcriptional activators to the general transcriptional machinery, and 3) as a scaffold for assembly of multi-protein complexes (22). CBP/p300 are critical for multiple cell functions including regulation of cell growth, transformation and development (34). However, the amount of CBP/p300 is limited in cells. Haploinsufficiency of CBP in humans causes the developmental defect disease, Rubinstein-Taybi syndrome, which is characterized by mental retardation, abnormal facial features, broad thumbs, and increased incidence of malignancy (35). By simultaneous binding to transcriptional factors involving in multiple signaling pathways, CBP/p300 integrate different signaling cascades (31). They can promote both inhibitory and synergistic actions between the pathways, dependent on the gene under study. For example, IFN-α inhibits TNF-α induced HIV gene expression and IFN-γ inhibits TGF-β induced type I collagen gene expression by competing for limited p300 in cells (36, 37). On the other hand, CBP mediates the synergistic induction of chemokine CXC ligand 9 expression by IFN-γ and TNF-α (38). 13

22 CBP/p300 are nuclear phosphoproteins and their functions are regulated by phosphorylation. Phosphorylation of undefined residues on CBP/p300 by ERK, protein kinase A (PKA), calmodulin-dependent protein kinases IV and MAPK can upregulate their activity (31). Serine 1834 phosphorylation of p300 by Akt stimulates its HAT activity (39). Cyclin E/Cdk2 negatively regulates p300 and positively regulates CBP activity (31). Serine 89 phosphorylation of p300 by PKCα, PKCδ and AMP-activated protein kinase inhibits its HAT activity (39). CBP is also negatively regulated by pp90rsk (31). The phosphorylation of CBP/p300 provides another way to control gene expression by different pathways. The p300/cbp associated factor (PCAF) is one of the GNATs group of HATs, which shares sequence similarity with GCN5 and is present in a large multisubunit complex. There are multiple components in this complex including PCAF as the catalytic 14

23 unit, a set of TAFs, Spt proteins mediating correct transcription initiation site selection, ADA proteins for transcription activation and PAF400 as coactivators (40). The C- terminus of PCAF interacts with the CBP/p300 CH3 domain to compete with binding of the adenoviral oncoprotein E1A protein (41). While the interaction of CBP/p300 with PCAF is not stoichiometric, they may interact at the promoters with help from sequence specific activators (41). By acetylating histones, PCAF promotes the relaxation of chromatin to promote gene activation. What is interesting is that for expression of different genes, there are different requirements for the HAT activity of PCAF or CBP/p300 (42). For instance, in MyoD-dependent coactivation, nuclear receptor and p73- mediated transcription, the HAT activity of PCAF is indispensible (43-45). However, for CREB and STAT-1-mediated transcriptional activation, the HAT of CBP is indispensible (42). PCAF is also able to acetylate non-histone proteins such as p53 at different sites from what CBP/p300 acetylates to increase p53 DNA binding ability (41). Protein Arginine Methyltransferase Protein arginine methyltransferases (PRMTs) are a family of eleven proteins (PRMT1 to 11) with conserved methyltransferase domains. They catalyze the methylation of arginine residues of proteins to regulate transcription, muscle differentiation and tumorigenesis (46). Among them, CARM1, also known as PRMT4, and PRMT1 are under intense study because of their coactivator roles in nuclear hormone-mediated transcription (47). CARM1 and PRMT1 specifically methylate histone 3 (H3) at arginine 2 (R2), R17, and R26, and histone 4 (H4) at R3, respectively (48). Those histone modifications are permissive modifications associated with gene 15

24 activation. Both CARM1 and PRMT1 act in concert with CBP/p300 and the p160 family of coactivators to enhance transcription of several transcriptional activators, such as nuclear-hormone receptor (NR) (49), p53 (50) and NF-κB (51, 52). Studies performed with isolated histones have shown that premethylation of H4 by PRMT1 stimulates acetylation by p300 (53), whereas preacetylation of a H3 peptide by CBP stimulates methylation by CARM1 (54). This explains the synergy between HATs and PRMTs. In addition, methylation of the non-histone substrate CBP/p300 by CARM1 at the KIX domain promotes nuclear hormone transcription (55) and methylation of R714, 742 and 768 is essential for hormone and CIITA-induced gene activation (56, 57). Similar, PRMT1 is able to methylate STAT-1 at R31 to activate IFN-α/β-induced transcription (58). Furthermore, by associating with Brg-1, CARM1 also promotes chromatin remodeling (46). On the other hand, another PRMT, PRMT5, negatively regulates transcription (46). It methylates H3 at R8 and H4 at R3 and is associated with chromatin remodeling complexes hswi/snf within the same subunit as where the transcriptional corepressor complex Sin3A/HDAC binds, thus PRMT5 represses gene transcription (59, 60). Methylation of the transcription elongation factor SPT5 by PRMT5 dissociates it from DNA, which leads to repression of transcription (46). However, independent of its methylase activity, PRMT5 is able to increase androgen receptor-driven transcription (46). The methylase activities of PRMTs can be modulated by other proteins. For instance, the activity of PRMT1 is increased by hswi/snf proteins through their interactions (46). Aberrant expression of some PRMTs is involved in tumorigenesis. PRMT5 expression is upregulated in many lymphoma and leukemia cells, patient 16

25 samples, and gastric carcinoma (46). CARM1 expression is increased in prostate carcinoma (61) and breast cancer (62). The p160 Steroid Receptor Coactivator Family The p160 steroid receptor coactivator (SRC) family is a group of three homologous proteins, SRC-1/NCoA-1 (hereafter referred to as SRC-1), SRC- 2/GRIP1/NCoA-2/TIF2 (hereafter referred to as GRIP1) and SRC- 3/p/CIP/RAC3/ACTR/AIB1/TRAM-1 (hereafter referred to as ACTR) (63). Steroid hormones such as estrogen, progestins, androgens and glucocorticoids are important for development and physiological functions. They act by binding to their cognate receptors to promote the dimerization and nuclear translocation of the receptors (64). In the nucleus, those NRs bind to a specific DNA sequence, hormone response element (HRE), in hormone targeted gene promoters (64). The regulation of NR-mediated transcription is a model system for studies of transcriptional regulation, and many transcriptional coregulators were originally identified by their roles in NR-mediated transcription. Later, it was found that coregulators function in a much wider range of gene transcription. The SRC family of proteins are good examples. NRs directly interact with the p160 family proteins to recruit them to promoters and coactivate gene expression. SRC-1 and GRIP1 are identified by their ability to interact with the ligand-bound NRs such as estrogen receptor (63). ACTR is amplified in breast cancer and ovarian cancer, shares high homology with SRC-1 and GRIP1, and mediates NR function, so it is classified as a SRC family protein (65-67). SRC family proteins are highly homologous, with overall ~40% identity (63). They interact with NRs through their central three LXXLL (L, leucine; X, 17

26 any amino acid) motifs (63). As coactivators, they have two important transactivation domains, AD1 and AD2 domains, in their C-terminus (63). Several studies found that SRCs are present in a multiple protein complex with other transcriptional coactivators by interacting with CBP/p300 and PCAF through the AD1 domain (66-68) and with CARM1 and PRMT1 through the AD2 domain (47, 49). Therefore, in NR-mediated transcription, SRCs are the primary coactivators to recruit CBP/p300, PCAF and CARM1/PRMT1 as secondary coactivators (69). SRC-1 and ACTR also have weak HAT activity (66, 70). Although SRC proteins are named as steroid receptor coactivators, later it was demonstrated that they also function as coactivators for AP-1 (71) and NF-κB (72-74) regulated gene expression. SRCs may also act as a primary coactivator since direct interactions of SRC-1 with c-fos, c-jun and p50 has been demonstrated (71, 73). By simultaneously interacting with both CBP/p300 and CARM1/PRMT1, SRC synergizes with these coactivators in various combinations to activate NR and some NF-κBmediated transcription (44, 47, 51, 74, 75). Interferons IFNs are a family of secreted cytokines functioning in autocrine or paracine manners to fight against viral infection, enhance innate and adaptive immunity and regulate cell growth (76). There are three types of IFNs: type I in humans includes 13 IFN-α s, IFN-β, IFN-ω, IFN-ε and IFN-κ; type II is IFN-γ; type III has three subtypes of IFN-λ (76). Binding of virus and microbial products to Toll-like receptors (TLRs) activates transcription factors essential for IFN gene expression, including IFN regulatory factors (IRFs) and NF-κB proteins (76, 77). IFNs function through binding to their cell 18

27 surface receptors and activation of the classical Janus Kinase-Signal Transducers and Activators of Transcription (JAK-STAT) pathway and other pathways to lead to transcription of IFN-stimulated genes (ISGs) (76). Type I IFN is expressed by cells infected with virus, and type I IFN receptor subunits, IFNAR1 and IFNAR2, are ubiquitously expressed (76). IFNAR1 and IFNAR2 are associated with the cytoplasmic JAK tyrosine kinases TYK2 and JAK1, respectively (76). Upon binding by Type I IFN, the two receptor subunits dimerize and TYK2 and JAK1 are autophosphorylated and transphosphorylated. They then phosphorylate the receptors and downstream STAT-1 and STAT-2 proteins to activate them (Figure 5) (76). Activated STAT-1 and STAT-2 form a STAT-1/2 heterodimer or a STAT-1 homodimer (gamma-activated factor, GAF) (Figure 5). A third protein, IRF-9, binds to the STAT-1/2 heterodimer to form a trimer, called the interferon-stimulated gene factor 3 (ISGF3) complex (Figure 5). Both GAF and ISGF3 translocate into the nucleus and bind to gamma-interferon-activated sites (GAS) and interferon-stimulated response elements (ISRE), respectively, in the promoter of ISGs to induce their transcription (Figure 5) (76, 78). Other STAT proteins, including STAT-3, 4, 5 and 6 can also be activated by type I IFNs to form various homo- or heterodimers and bind to GAS elements (79). In contrast to type I IFN, IFN-γ is only produced by natural killer and activated T cells (76). The two IFN-γ receptors, IFNGR1 and IFNGR2, bind JAK1 and JAK2, respectively (Figure 5). Similar to type I IFN, binding of IFN-γ to its receptors leads to the phosphorylation of JAKs, receptors and downstream STAT-1 proteins (Figure 5). STAT-1 homodimerizes to form GAF and enters the nucleus to bind to GAS element to turn on ISGs expression (Figure 5) (76). Type III IFNs are co-produced with IFN-β with 19

28 unique receptors, IFN-λ receptor 1 (IFNLR1) and IL-10 receptor 2 (IL10R2). However, they activate the same signaling pathways as type I IFNs (76). In addition to the activation of the classical JAK-STAT pathways, IFNs are also able to activate v-crk sarcoma virus CT10 oncogene homolog-like protein and its downstream small GTPase RAP1, phosphatidylinositol 3-kinase and p38 pathways (79). 20

29 To date, most studies on IFNs have focused on their ability to induce expression of ISGs, and hundreds of ISGs have been identified (80-83). However, IFNs are also able to downregulate some genes such as IL-8 (84), IL-17 receptor (80), COX-7 (81), c-myc (85), several thyroid-specific genes (86) and several MMP members, MMP-9 (14, 15), MMP-2 (87), MMP-1 and MMP-13 (88). Although the pathways involved in positive gene regulation by IFNs are well-studied, how IFNs inhibit gene expression is poorly understood (86). IFN-β and IFN-γ are able to inhibit the expression of MMP-9, and STAT-1 is necessary for this inhibition (15). However, there are no GAS elements on the MMP-9 promoter (14). Further studies found that inhibition of MMP-9 by IFN-γ resulted from the competition of CBP/p300 away from the MMP-9 promoter by STAT-1 or STAT-1 induced CIITA (15, 89). IFN-γ inhibition of c-myc expression is also dependent on STAT-1, and a GAS element in the c-myc promoter is necessary, but not sufficient, for its inhibition (85). Downregulation of thyroid transcription factor expression and DNA binding ability may contribute to the inhibition of thyroid-specific genes by IFN-γ (86). Clinically, Type I IFNs have been used for treatment of viral infection, cancers, and multiple sclerosis, although their mechanisms of action are still not very clear. However, ISGs mediate at least part of the beneficial effects of IFNs. For example, IFNs induce 2-5 A synthetase, protein kinase R and myxovirus resistance proteins to directly inhibit virus replication (76, 77). IFN-α2 and IFN-β are used for treatment of hepatitis B virus, hepatitis C virus, herpes zoster, herpes simplex virus and cytomegalovirus infections (76). ISGs such as APO2L/TRAIL, XAF1 and IRF-1 have anticancer effects. IFN-α2 is clinically used for chronic myelogenous leukemia, melanoma and Kaposi s 21

30 sarcoma (76). IFN-β is an effective clinical treatment for MS, and it may alter the balance of immunoregulatory and pro-inflammatory cytokines, inhibiting Th1 cytokines and stimulating expression of Th2 cytokines, downregulate T-cell resistance to apoptosis, inhibit production of MMP-9, and modulate the expression of adhesion molecules and chemokines (90). Significance MMPs are a group of proteinases that play deleterious roles in inflammatory diseases and cancers (5, 6, 8), so they are prime targets for disease therapy. A great deal of effort has gone into developing and clinically testing small molecule inhibitors mimicking MMP substrates (5, 18). However, most of the clinical trial results have been disappointing because of significant side effects, which result from the unselective inhibition of all MMPs and other metalloproteinases, or because of lack of efficacy (6, 18). Therefore, developing individual MMP-specific inhibitors targeting different levels of MMP regulation is essential for further drug studies on MMPs (18). The transcriptional control of MMPs is the major regulation point of MMP expression (18). Furthermore, the upregulation of MMPs in tumors is not due to gene amplification or activating mutations, but may be due to increased gene transcription (2). Therefore, therapeutic strategies that target the transcriptional level of MMPs are promising for cancer therapy and autoimmune diseases. MMP-9, as a major member of MMPs, is associated with several different types of cancers and inflammatory diseases. In order to better control the expression of MMP-9, it is critical to understand the regulation of MMP-9 transcription, thereby providing therapeutic targets. 22

31 IFN-β can effectively inhibit MMP-9 expression in multiple human cell lines such as glioma cells (15), fibroblasts (15), sarcoma (91) and peripheral blood monocytes (92). Thus far, compared to what is known about positive gene regulation by IFN-β, little is known about its negative regulatory role. Therefore, understanding the mechanism of IFN-β inhibition of MMP-9 not only can lead to a design of better MMP inhibitors, but also provide insights on the negative regulatory effects of IFN-β. The aims of this study are to define the role of coactivators in MMP-9 transcription and the molecular mechanisms of IFN-β-mediated inhibition of MMP-9 expression. 23

32 TRANSCRIPTIONAL ACTIVATION OF HUMAN MATRIX METALLOPROTEINASE- 9 GENE EXPRESSION BY MULTIPLE COACTIVATORS by XUEYAN ZHAO AND ETTY N. BENVENISTE Submitted to Journal of Molecular Biology, 2008 Format adapted for dissertation 24

33 Summary Matrix metalloproteinase-9 (MMP-9), a proteolytic enzyme for matrix proteins, chemokines and cytokines, is a major target in cancer and autoimmune diseases since it is aberrantly upregulated. To control MMP-9 expression in pathological conditions, it is necessary to understand the regulatory mechanisms of MMP-9 expression. MMP-9 gene expression is regulated primarily at the transcriptional level. In this study, we investigated the role of multiple coactivators in regulating MMP-9 transcription. We demonstrate that multiple transcriptional coactivators are involved in MMP-9 promoter activation, including CBP/p300, PCAF, CARM1 and GRIP1. Furthermore, enhancement of MMP-9 promoter activity requires the histone acetyltransferase activity of PCAF but not that of CBP/p300. The coactivator function of CARM1 depends on its methyltransferase activity. More importantly, these coactivators are not only able to activate MMP-9 transcription independently, but also function in a synergistic manner. Significant synergy was observed among CARM1, p300 and GRIP1, which is dependent on the interaction of p300 and CARM1 with the AD1 and AD2 domains of GRIP1, respectively. This suggests the formation of a ternary coactivator complex on the MMP-9 promoter. Chromatin immunoprecipitation assays demonstrate that these coactivators associate with the endogenous MMP-9 promoter, and that sirna knockdown of expression of these coactivators reduces endogenous MMP-9 expression. Taken together, these studies demonstrate a new level of transcriptional regulation of MMP-9 expression by the cooperative action of coactivators. 25

34 Introduction Matrix metalloproteinase-9 (MMP-9), a member of a group of 23 structurally conserved human proteolytic enzymes, plays important roles in normal physiological processes such as reproduction, inflammation and wound healing. 1,2 However, elevated levels of MMP-9 are detected in multiple human cancers such as breast, colon, brain and lung cancer, 3 and inflammatory diseases such as multiple sclerosis and rheumatoid arthritis. 1 Inhibition of MMP-9 expression by interferon-β in multiple sclerosis 4 or by RNAi targeting in brain tumors 5 has been shown to be beneficial. To better control the expression of MMP-9, it is a prerequisite to understand MMP-9 regulation under both physiological and pathological conditions. Expression of MMP-9 is regulated primarily at the transcriptional level, which is tightly and specifically regulated. 1,6,7 Multiple signaling pathways induce MMP-9 gene transcription by activating sequence specific transcription factors, such as AP-1, NF-κB, Sp1 and Ets1, which subsequently bind to cis-elements on the MMP-9 promoter. 1,6,7 This promotes the further recruitment of chromatin remodeling complexes, coactivators and general transcriptional machinery to induce MMP-9 expression. 7 However, the identify and functions of coactivators involved in MMP-9 expression are still not clear. Thus, in this study, the role of the three classes of coactivators in MMP-9 expression was determined. The camp-response-element binding protein (CREB)-binding protein (CBP) and p300 were originally identified as proteins that bind to CREB and adenoviral E1A, respectively. 8 They are homologous proteins involved in cell growth, transformation and development, however, they do have distinct unique properties. 9,10 CBP and p300 have 26

35 conserved functional domains: three cysteine-histidine (CH)-rich domains, a CREBbinding domain referred to as the KIX domain, a bromodomain, a histone acetyltransferase (HAT) activity domain and a glutamine-rich region. 11 They mainly function as transcriptional coactivators with intrinsic HAT activity. CBP and p300 are key regulators of RNA polymerase II-mediated transcription, functioning to link sequence specific transcriptional activators to the general transcriptional machinery, thereby stabilizing the pre-initiation complex. 8 They also function as a scaffold for the assembly of multi-protein complexes. Furthermore, as HATs, they acetylate not only the four histone tails to relax chromatin structure, 12,13 but also a number of non-histone proteins such as p53 and NF-κB p65 to increase their DNA-binding ability. 14,15 By interacting with a variety of transcriptional factors, CBP and p300 regulate expression of a large number of genes. 9 The p300/cbp associated factor (PCAF) was originally identified as a homolog to the yeast histone acetylase GCN5, and binds to the CH3 domain of CBP/p PCAF also has intrinsic HAT activity, with a histone H3 preference. 16 Although PCAF and CBP/p300 bind each other and both have HAT activities, expression of particular genes specifically requires the HAT activity of CBP/p300 or pcaf. 17 For example, the HAT activity of PCAF is required for nuclear receptor and p73-mediated transcription, but the HAT activity of CBP is required for CREB and STAT-1-mediated transcriptional activation. 17,18 Protein arginine methyltransferases (PRMTs) include eleven enzymes with conserved catalytic motifs that catalyze mono- or di-methylation of arginine residues in proteins to regulate gene expression, muscle differentiation and tumorigenesis

36 Coactivator-associated arginine methyltransferase 1 (CARM1), also known as PRMT4, and PRMT1 are two PRMTs that play important roles in transcriptional activation by methylating histones and non-histone substrates. 19,20 CARM1 specifically methylates histone 3 (H3) at N-terminal arginine 2, 17, 26 and some sites in the C-terminus, 19,21,22 while PRMT1 methylates H4 at arginine Also, CARM1 can methylate CBP/p300 in the KIX domain to promote nuclear hormone transcription. 24 Methylation of CBP at arginine 714, 742 and 768 has also been identified to be critical for hormone and CIITAinduced gene activation. 25,26 PRMT1 is able to methylate STAT-1 at arginine 31 to protect it from the binding of its inhibitor PIAS1, and therefore activate interferon α/βinduced transcription. 27 Studies in CARM1 knockout cells have demonstrated that a subset of NF-κB regulated genes require CARM1, 28 and PRMT1 is also able to coactivate NF-κB p65-mediated transcriptional activation at the MIP-2 and HIV-1 LTR promoters. 29 The p160 steroid receptor coactivator (SRC) family includes three members, SRC-1/NCoA-1 (hereafter referred to as SRC-1), SRC-2/GRIP1/NCoA-2/TIF2 (hereafter referred to as GRIP1) and SRC-3/p/CIP/RAC3/ACTR/AIB1/TRAM-1 (hereafter referred to as ACTR). 30 They are proteins with approximately 40% homology and share similar domain structures. 30 Through their conserved central three LXXLL (L, leucine; X, any amino acid) motifs, p160 proteins interact with nuclear receptors. 30 The C-terminus of p160 has two transactivation domains, AD1 and AD2, through which activating signals are transmitted to other coactivators and the general transcriptional machinery. CBP/p300 and PCAF interact with the AD1 domain, and CARM1 and PRMT1 interact with the 28

37 AD2 domain. 21,34 In nuclear receptor-dependent transactivation, the p160 proteins are recruited to promoters through direct interactions with nuclear receptors, and then they recruit additional secondary coactivators such as CBP, p300, CARM1 and PRMT1 to form multiple protein complexes that activate gene transcription. 20 In addition, p160 proteins coactivate other transcription factors such as AP-1 35 and NF-κB Studies have shown that the above three major classes of coactivators play important roles in nuclear receptor-mediated gene transcription. 17,20,21,39-42 In addition, they are involved in regulation of some NF-κB-mediated genes such as E-selectin, IP-10, IL-8 and MIP-2. 28,29,36-38,43,44 Our previous studies demonstrated that MMP-9 gene expression depends on binding of the sequence specific activators AP-1 and NF-κB to their corresponding cis-elements on the MMP-9 promoter, and that CBP/p300 and CARM1 are recruited to the MMP-9 promoter upon activation. 7 CARM1 is recruited to the MMP-9 promoter concurrent with CBP/p However, the function of CARM1 in MMP-9 expression, and the role of other coactivators is not known. In this study, we have determined that CBP/p300, pcaf, CARM1 and GRIP1 are all involved in MMP-9 gene expression, likely by functioning as a transcriptional complex. Furthermore, reduction of cellular concentrations of p300, CARM1 and GRIP1 by sirna knockdown diminishes expression of the endogenous MMP-9 gene, validating the importance of these coactivators in MMP-9 expression. 29

38 Results CBP and p300 function as coactivators for MMP-9 promoter activity. Since CBP and p300 are present at the MMP-9 promoter 7 and they function as transcriptional coactivators for multiple transcription factors, 8 their roles in MMP-9 expression were evaluated using a MMP-9 promoter luciferase assay. Increasing amounts of wild type CBP (Fig. 1A) significantly enhanced phorbol 12-myristate 13-acetate (PMA)-induced MMP-9 promoter activity in HeLa cells in a dose-dependent manner (Fig. 1B), indicating that CBP functions as a coactivator for MMP-9 expression. Similar results were observed for p300; a dose-dependent enhancement of PMA-induced MMP-9 promoter activity (Fig. 1C). To determine if the HAT activity of CBP and p300 are required for their ability to activate MMP-9 promoter transcription, two HAT-deficient mutant constructs, CBP WY and p300 WY (Fig. 1A), 45 were expressed and MMP-9 promoter activity determined. The CBP WY construct enhanced PMA-induced reporter activity in a comparable manner as the wild type construct (Fig. 1B). Similarly, p300 WY enhanced PMA-induced MMP-9 reporter activity as well as wild type p300 (Fig. 1C). The third CH3 domain of CBP/p300 interacts with multiple transcription factors such as PCAF, TFIIB, RNA helicase A, Ets1, Jun B and c-fos. 9 A construct expressing a mutant form of p300 lacking the CH3 domain (p300 CH3) (Fig. 1A), 46 was tested to assess its effect on MMP-9 activation. This construct slightly increased MMP-9 promoter activity compared to empty vector transfected cells at 0.2 µg. No further effect was observed with increasing amounts of the p300 CH3 construct (Fig. 1C). Therefore, these data suggest that CBP and p300 function as coactivators for MMP-9 expression, that their HAT 30

39 activity is not necessary for PMA-induced MMP-9 activation, and that the CH3 domain is required for optimal activation of MMP-9. PCAF is a coactivator for MMP-9 activation and its HAT activity is critical. Since the HAT activities of CBP and p300 were not required for PMA-induced MMP-9 activation, the role of PCAF, another HAT, in MMP-9 expression was evaluated. Increasing amounts of PCAF (Fig. 2A) enhanced both basal and PMA-inducible MMP-9 reporter activity (Fig. 2B). To determine if the HAT activity of PCAF was involved, HeLa cells were transfected with two HAT-deficient mutants of PCAF, PCAF HAT1 and PCAF HAT2 (Fig. 2A), 18 together with a luciferase reporter plasmid for MMP-9 (MMP-9-luc). PCAF HAT1 was only able to enhance MMP-9 promoter activity at the highest concentration (0.6 µg) (Fig. 2B), while PCAF HAT2 increased MMP-9 promoter activity at all three concentrations tested (Fig. 2B). However, the degree of activation by PCAF HAT1 and PCAF HAT2 was significantly lower than that of wild type PCAF. These differences are not due to different expression levels of the proteins (Fig. 2C). CARM1 and GRIP1 augment MMP-9 promoter activity, and the methyltransferase activity of CARM1 is required for this response. MMP-9 is a NF-κB regulated gene 1 and previous studies have shown that the arginine methyltransferase CARM1 is a coactivator for expression of a subset of NF-κB regulated genes. 28 CARM1 is recruited to the MMP-9 promoter upon activation, 7 although its function is not known. To determine whether CARM1 is a coactivator of 31

40 MMP-9 expression, CARM1 (Fig. 3A) was expressed in HeLa cells and MMP-9 promoter activity determined. At the highest concentration of expression plasmid tested (0.6 µg) CARM1 enhanced PMA-induced MMP-9 promoter activity (Fig. 3B). CARM1E267Q, an enzymatic activity deficient construct (Fig. 3A), 39 had no effect on MMP-9 promoter activity at all concentrations tested (Fig. 3B), indicating that CARM1 methyltransferase activity is necessary for activation of MMP-9 expression. Immunoblotting analysis demonstrated comparable expression levels of CARM1 and CARM1E267Q (Fig. 3C). The p160 family of coactivators, SRC-1, GRIP1 and ACTR, has been shown to activate NF-κB-mediated transcription, and GRIP1 is required for the coactivator function of CARM1 and p300 for estrogen receptor-mediated transcription. 40 Thus, the role of GRIP1 in activation of MMP-9 promoter transcription was tested. GRIP1 enhanced both basal and PMA-inducible MMP-9 transcriptional activity (Fig. 3D). The expression of GRIP1 was confirmed by immunoblotting analysis (Fig. 3E). Synergistic activation of MMP-9 promoter transcription by three classes of coactivators. Thus far, our data illustrate that members of three classes of coactivators, HATs, PRMTs and p160 proteins, function as coactivators for MMP-9 gene expression. Whether cooperative interactions occur among these coactivators was next determined. Cells were transfected with 0.2 µg of the expression constructs for CARM1, p300 or GRIP1 alone or in various combinations. When the individual expression constructs were transfected alone, they had only a modest effect on MMP-9 reporter activity or no effect (Fig. 4, bars 32

41 3-8). Coexpression of CARM1 and p300 had an additive effect on activation of the MMP-9 reporter (Fig. 4, bars 15 & 16). Synergistic coactivation of the MMP-9 promoter was observed when CARM1 was coexpressed with GRIP1 (Fig. 4, bars 17 & 18), or when p300 was expressed with GRIP1 (Fig. 4, bars 25 & 26). Remarkably, when these three coactivators were expressed together, both basal and PMA-induced MMP-9 reporter activity was strikingly increased to 110-fold and 764-fold, respectively (Fig. 4, bars 33 & 34). GRIP1 showed strong synergistic effects with CARM1 and/or p300 (Fig. 4, bars 33 & 34), however, in the absence of GRIP1, CARM1 and p300 had only an additive effect (Fig. 4, bars 15 & 16). These results suggest that GRIP1 is necessary for mediating synergy between these three coactivators. Studies have shown that CARM1, p300 and GRIP1 can form a ternary coactivator complex through the binding of CBP/p300 to the AD1 domain and other unidentified regions of GRIP1, and binding of CARM1 to the AD2 domain of GRIP1 (Fig. 4). 39 Therefore, three GRIP1 deletion constructs, GRIP1 AD1, 40 GRIP1 AD2 33 and GRIP1 AD1+ AD2 40 were tested. When the individual deletion constructs were transfected into HeLa cells, they had minor or no effect on MMP-9 reporter activity (Fig. 4, bars 9-14). Coexpression of CARM1 with GRIP1 AD1 (Fig. 4, bars 19 & 20) showed the same degree of synergy as wild type GRIP1 (Fig. 4, bars 17 & 18). However, when GRIP1 AD2 or GRIP1 AD1+ AD2 were tested, no additive or synergistic effect with CARM1 was observed (Fig. 4, bars 21-24). These data indicate that the cooperation between CARM1 and GRIP1 depends on the AD2 domain of GRIP1. p300 did not synergize with GRIP1 AD1 to activate MMP-9 reporter activity (Fig. 4, bars 27 & 28), and less synergy was observed with GRIP1 AD2 33

42 (Fig. 4, bars 29 & 30), compared to wild type GRIP1 (Fig. 4, bars 25 & 26). GRIP1 AD1+ AD2 completely lost its ability to synergize with p300 (Fig. 4, bars 31 & 32). Collectively, these data indicate that the AD1 domain of GRIP1 is required to mediate the synergistic effect with p300. Next, we examined the role of the GRIP1 AD1 and AD2 domains in the substantial synergy among CARM1, p300 and GRIP1. When GRIP1 AD1 was coexpressed with p300 and CARM1, basal and PMA-inducible MMP-9 promoter activity dropped to 29-fold and 188-fold, respectively (Fig. 4, bars 35 & 36), a substantial reduction compared to the effect of wild type GRIP1 (Fig. 4, bars 33 & 34). Deletion of the AD2 domain had a similar effect (Fig. 4, bars 37 & 38). Deletion of both AD1 and AD2 domains significantly diminished the synergistic effect among the three coactivators (Fig. 4, bars 39 & 40). Our data support the formation of a ternary coactivator complex at the MMP-9 promoter in which p300 and CARM1 bind the AD1 and AD2 domains of GRIP1, respectively. Multiple coactivators associate with the MMP-9 promoter and sirna knockdown of p300, CARM1 or GRIP1 inhibit MMP-9 expression. The above MMP-9 reporter assays demonstrated that multiple coactivators are involved in MMP-9 expression. To confirm their roles in expression of the endogenous MMP-9 gene, chromatin immunoprecipitation (ChIP) assays were performed. As demonstrated previously, 7 in the basal state, there were low levels of CBP, p300 and CARM1 associated with the MMP-9 promoter, which were enhanced upon PMA treatment (Fig. 5A). PCAF and GRIP1 were associated with the MMP-9 promoter in the 34

43 basal state, and the presence of PCAF was enhanced by PMA treatment, especially at the 6 h time point (Fig. 5A). However, PMA had only a modest effect on the level of GRIP1 at the MMP-9 promoter (Fig. 5A). To determine the functional importance of p300, CARM1 and GRIP1, endogenous levels were inhibited by sirna duplexes, and mrna levels of MMP-9 determined by reverse transcription-pcr (RT-PCR). A 30% knockdown of p300, 60% knockdown of CARM1 and 80% knockdown of GRIP1 was achieved (Fig. 5B). PMA-induced MMP-9 expression was reduced 30% in p300 knockdown cells compared to the mock transfected cells (Fig. 5C). Knockdown of CARM1 and GRIP1 led to a greater reduction (60%) of MMP-9 mrna expression (Fig. 5C). These data demonstrate that these three coactivators play a vital role in endogenous MMP-9 expression, and that the expression levels of MMP-9 are tightly regulated by the cellular concentrations of the coactivators. 35

44 Discussion In this study, we investigated the coactivators involved in human MMP-9 gene expression, and found that members of three classes of coactivators are essential for MMP-9 expression, including CBP/p300, PCAF, CARM1 and GRIP1. These three classes of coactivators can activate MMP-9 promoter transcription in independent, additive and synergistic manners. ChIP assays demonstrate their association with the endogenous MMP-9 promoter, and sirna knockdown of the coactivators reduced expression of the endogenous MMP-9 gene. These data confirm the importance of coactivators in endogenous MMP-9 gene expression. We have previously shown that PMA is a potent inducer of MMP-9, 7 and thus utilized it for our studies. Upon PMA stimulation, CBP and p300 were recruited to the MMP-9 promoter (Fig. 5A), and overexpression of CBP and p300 significantly increased PMA-induced MMP-9 promoter activity (Fig. 1B and 1C). This effect was independent of the HAT activity of either CBP or p300, but required the p300 CH3 domain (Fig. 1B and 1C). Besides functioning as HATs to activate gene transcription, CBP and p300 also provide a platform for formation of multiple protein complexes and bridge interactions between transcription factors and transcriptional machinery such as the RNA polymerase II complex, 8 which may explain their coactivator roles in MMP-9 expression. Further studies indicated the CH3 domain interacting protein, PCAF, enhanced MMP-9 promoter activity (Fig. 2B), and its HAT activity was required for maximal induction (Fig. 2B). Also, PCAF was recruited to the MMP-9 promoter upon PMA treatment (Fig. 5A). These data suggest that PCAF is the major HAT for MMP-9 expression. A transcription factor 36

45 specific requirement of distinct coactivator components and HAT activity has been previously documented. The HAT activity of PCAF, but not CBP, was required for p65- mediated E-selectin reporter activation. 38 In nuclear receptor-mediated transcription, the HAT of PCAF but not of CBP/p300 was required. 17,39 On the other hand, for CREB regulated genes, the HAT of CBP but not of PCAF was essential. 17 It has been shown that expression of a subset of NF-κB regulated genes, such as MCP-1, IP-10, MIP-2 and G-CSF, is impaired in CARM1 knockout mouse embryo fibroblasts. 28 Knockdown of CARM1 by RNAi reduced the expression of NF-κB regulated genes in 293T cells such as IL-8, IP-10 and TNF-α. 44 However, the requirement for CARM1 is gene-specific since the expression of other NF-κB regulated genes such as IL-6, ΙκΒα and COX-2 was not affected by CARM1 knockout. 28 We found that MMP-9 promoter activity was enhanced when CARM1 was overexpressed (Fig. 3B), and that CARM1 was recruited to the MMP-9 promoter upon PMA treatment (Fig. 5A). Furthermore, knockdown of CARM1 expression substantially reduced the expression of endogenous MMP-9 mrna (Fig. 5B and 5C). These data demonstrate that CARM1 acts as a coactivator for MMP-9 expression and is required for MMP-9 expression. This differs from what was observed for p65-mediated TNF-α activation, in which CARM1 was able to activate TNF-α promoter activity in 293T cells only in the presence of CBP/p This difference may be due to different endogenous cellular concentrations of CARM1. That is, 293 cells may already have enough CARM1, so overexpression alone would not show any effect. However, it is also possible that the coactivators have gene-specific effects for different NF-κB regulated genes. CARM1 functions mainly 37

46 through methylating histones or non-histone proteins involved in transcription. 20 In several NF-κB regulated gene promoters, CARM1 recruitment upon TNF-α treatment is correlated with methylation of histone H3 at arginine 17, 28,44 which is linked to gene activation. 47 We previously demonstrated that H3 arginine 17 methylation occurs coincident with CARM1 recruitment at the MMP-9 promoter. 7 When the methyltransferase activity of CARM1 was eliminated, CARM1 lost its ability to activate the MMP-9 promoter (Fig. 3B; CARM1E267Q). Thus, methylation of histones by CARM1 likely contributes to its coactivator function for MMP-9 expression. Another PRMT, PRMT1, functions as a coactivator for p65 regulated MIP-2 and HIV-1 LTR transcriptional activation, 29 however, it did not activate MMP-9 transcription in HeLa cells (data not shown). The p160 family protein GRIP1 alone had only a modest effect on MMP-9 promoter activation (Fig. 3D), and its association with the endogenous MMP-9 promoter was not modulated by PMA treatment (Fig. 5A). This suggests that it is not an effective coactivator by itself, and may need other proteins to function. SRC-1, another p160 family member, interacts with both p50 37 and c-fos. 35 We found an in vivo association of p50 with GRIP1 in unstimulated cells by coimmunopreciptation (data not shown), and low levels of p50 are present on the MMP-9 promoter in unstimulated cells. 7 This may explain the constitutive association of GRIP1 with the MMP-9 promoter (Fig. 5A). More importantly, knockdown of GRIP1 in HeLa cells had a substantial effect on MMP-9 expression (Fig. 5B and 5C), demonstrating that it is required for MMP-9 expression. Synergy by various combinations of coactivators has been shown for nuclear receptor 38

47 function, for example, between CARM1 and GRIP1, 21 CARM1 and PRMT1, 34 CARM1 and p300, 40 and among CBP/p300, CARM1 and GRIP1. 39 p65-activated HIV LTR luciferase activity is also synergistically enhanced by p300, CARM1 and GRIP1. 28 Synergy between CBP and SRC-1 or PCAF has been demonstrated for p65-activated E- selectin promoter activity. 38 In our study, we found that the combination of CARM1 plus p300 had an additive effect on MMP-9 promoter transcription (Fig. 4, bars 15 & 16). GRIP1 significantly enhanced the ability of either CARM1 or p300 to activate MMP-9 promoter activity (Fig. 4, bars 17 & 18 and 25 & 26). The most pronounced synergistic effect was observed when all three coactivators were simultaneously expressed (Fig. 4, bars 33 & 34). More importantly, the studies performed with the GRIP1 mutants clearly demonstrated the critical role of GRIP1 in mediating the formation of a ternary coactivator complex with p300 and CARM1 through its AD1 and AD2 domains (Fig. 4). MMP-9 transcription is a complex tightly regulated process 7 and this study illustrates additional complexity with respect to the involvement of coactivators. As shown in Figure 6, upon induction of MMP-9 gene expression by PMA, sequence specific transcription factors such as AP-1 and NF-κB are activated and recruited to the MMP-9 promoter. 7 They can further recruit the chromatin remodeling complex component Brg-1 to relax chromatin and coactivators such as CBP/p300 and CARM1. The CBP/p300 associated PCAF is also recruited to the MMP-9 promoter. At the promoter, CBP/p300 and CARM1 likely bind to the AD1 and AD2 domains, respectively, of GRIP1 to form a ternary complex. The ternary complex positions the coactivators in proximal distance to promote their functions in a synergistic way. One 39

48 way may be that PCAF and CARM1 collaborate to modify histones to promote the further relaxation of MMP-9 chromatin, allowing the binding of transcriptional factors and providing docking sites for other transcriptional coactivators. It has been demonstrated previously that acetylation of H3 lysine 18 and 23 by CBP/p300 promotes the recruitment of CARM1 and methylation of arginine 17 on the ps2 promoter following estrogen stimulation. 48 On the other hand, modification of coactivators can also contribute to their synergy. For example, methylation of CBP/p300 by CARM1 plays an important role in GRIP1- and estrogen-induced gene activation. 25 Furthermore, CARM1 interacts with the chromatin remodeling complex component Brg-1 and coassembles at estrogen receptor regulated gene promoters, so they can enhance each others functions. 49 Similar events may occur on the MMP-9 promoter, thereby contributing to the synergistic effects among the coactivators. In addition, this multiple coactivator complex on the MMP-9 promoter may form the transcription preinitiation complex with general transcriptional machinery such as TFIID and RNA polymerase II complexes. Collectively, our studies illustrate the complexity of MMP-9 gene regulation, and suggest that these coactivators may be potential targets in controlling aberrant MMP-9 expression in disease states. It has been shown that some of the coactivators are overexpressed in cancers. For example, CARM1 is overexpressed in prostate carcinoma 50 and breast cancer. 51 ACTR, another p160 protein, is amplified and overexpressed in breast and ovarian cancers. 52 MMP-9 is also upregulated in breast, ovarian and prostate cancers, 3 so its upregulation may result from the overexpression of these coactivators. Reduction of coactivator expression in these cancers may lead to less MMP-9 expression, and therefore control tumor growth, angiogenesis and invasion. 40

49 Materials and Methods Reagents and antibodies PMA was purchased from Calbiochem (San Diego, CA, USA). Polyclonal rabbit antibodies against CBP, p300, GRIP1, pcaf and normal IgG control were purchased from Santa Cruz Biotechnology (Santa Cruz, CA, USA). Monoclonal mouse antibodies against actin and HA tag, and polyclonal rabbit antibody against FLAG tag were purchased from Sigma (St. Louis, MO, USA). The secondary peroxidase-conjugated antibodies and ECL reagents were from Pierce (Rockford, IL, USA). Protein A/G agarose/salmon sperm DNA for the ChIP assays, and the CARM1 antibody were from Upstate Cell Signaling Solution (Charlottesville, VA, USA). The Fugene 6 transfection reagent was purchased from Roche (Basel, Switzerland). Cell lines and plasmids HeLa cells were passaged as previously described. 53 The luciferase reporter plasmid for MMP-9 (MMP-9-Luc) containing 670 bp of the human MMP-9 promoter was obtained from Dr. D. Boyd, MD Anderson Cancer Center, Houston, TX, USA. 54 pcdna3 was from Invitrogen (Carlsbad, CA, USA). pcmv-cbp-flag was a generous gift of Dr. M. G. Rosenfeld, University of California, San Diego, CA, USA. 17 pcmvβ- HA-p300 was purchased from Upstate Cell Signaling Solution. pcmvβ-p300 CH3-HA was a gift from Dr. D. Livingston, Dana-Farber Cancer Institute, Boston, MA, USA. 46 pcdna3-cbpwy-ha and pcmvβ-p300wy-ha were from Dr. R. Eckner, New Jersey Medical School, Newark, NJ, USA. 45 pcx-flag-pcaf was obtained from Dr. Y. Nakatani at the National Institutes of Health, Bethesda, MD, USA. 16 pcx-flag-pcaf 41

50 HAT1 and pcx-flag-pcaf HAT2 were from Dr. D. Liao at the University of Florida, Gainesville, FL, USA. 18 The psg5.ha vector was obtained from Dr. M. Stallcup, University of Southern California, Los Angeles, CA, USA. CARM1, 21 CARM1E267Q, 39 PRMT1, 34 GRIP1, 21 GRIP1 AD1, 40 GRIP1 AD2 33 and GRIP1 AD1+ AD2 40 were expressed from the psg5.ha vector and were a generous gift from Dr. M. Stallcup. Transient transfection and luciferase assay HeLa cells (1.8 x 10 5 ) in six-well culture dishes were transiently transfected with 0.2 µg of MMP-9-Luc and increasing amounts of coactivator expression constructs (0, 0.2, 0.4, 0.6 µg) using the Fugene 6 reagent following manufacturer s instructions. Total DNA was normalized by addition of the empty vector pcdna3 or psg5.ha. After recovery, cells were incubated in serum-free media or in the presence of PMA (50 ng/ml) for 16 h and whole cell extracts were used for luciferase assay and normalized to total protein as described before. 53 The luciferase activity of the untreated and no coactivator overexpressed sample was arbitrarily set at 1 for calculation of fold induction upon PMA treatment. Immunoblotting Immunoblotting was performed as previously described. 55 HeLa cells were transfected with coactivator overexpression constructs for 48 h and then cells were lysed in 1X RIPA buffer. Cell lysates were separated on 8% SDS-PAGE gel and transferred to nitrocellulose membranes. After blocking the membranes with 5% non-fat milk, the 42

51 membranes were incubated with specific primary antibodies at 4 C overnight. After three washings, membranes were incubated with secondary antibodies at room temperature for 45 minutes. Membranes were washed three times again and ECL reagents used to detect the proteins. ChIP assay ChIP assays were performed as previously described. 7,53 Cells were cross-linked and the nuclei were extracted and sonicated. After preclearing, the soluble chromatin was immunoprecipitated with 4 µg of appropriate antibodies and protein A/G beads were added to bind the precipitates. After several washings, elutes were heated to reverse the cross-linking. DNA fragments were purified and analyzed by semi-quantitative PCR using the following primers for human MMP-9: forward 5 -GAC CAA GGG ATG GGG GAT C-3 and reverse 5 -CTT GAC AGG CAA GTG CTG AC-3. SiRNA knockdown, total RNA isolation and RT-PCR HeLa cells (1 x 10 5 ) in 12-well culture dishes were transiently transfected with 100 nm SMART pool on-target plus sirna duplexes for p300, CARM1 or GRIP1 using the DharmaFECT reagent 1 according to the manufacturer s protocol (Dharmacon, Chicago, IL, USA). 48 h after transfection, the media was changed to serum free media overnight. Cells were then untreated or treated with PMA (50 ng/ml) for 8 h. Total cellular RNA was extracted, and one µg of total RNA was reverse transcribed to cdna using M-MLV reverse transcriptase (Promega, Madison, WI, USA) with oligo (dt) 15 primer according the manufacturer s protocol. cdnas were diluted 5 times and 5 µl was used as a template 43

52 for the PCR reaction. PCR products were visualized by ethidium bromide staining after agarose gel electrophoresis. GAPDH was amplified using the primers: forward 5 - CGGAGTCAACGGATTTGGTCGTAT-3 and reverse 5 - AGCCTTCTCCATGGTGGTGAAGAC MMP-9 was amplified using the primers: forward 5 -TGGACGATGCCTGCAACGTG-3 and reverse 5 - GTCGTGCGTGTCCAAAGGCA p300 was amplified using the primers: forward 5 -GTATGATCCGTGGCAGTGTG-3 and reverse 5 - CCCTATGCTTGGGGGAGTAT-3. CARM1 was amplified with primers: forward 5 - GCCACAACAACCTGATTCCT-3 and reverse 5 -TGTTCCAGCAGATGACAAGC- 3, and GRIP1 was amplified with primers: forward 5 - GCAGCTGCCAACATAGATGA-3 and reverse 5 -CAAATCAAGCAGGACTGCAA- 3. Statistical analysis Data are presented as mean ± standard error (S.E.), and the Student s t-test was used to determine statistical difference. P values of 0.05 were considered to be statistically significant. 44

53 Acknowledgements We are grateful to Drs. D. Boyd, M. G. Rosenfeld, D. Livingston, R. Eckner, Y. Nakatani, D. Liao and M. Stallcup for providing valuable plasmid constructs for this study. This work was supported in part by National Institutes of Health grants CA and NS (to E.N.B.). 45

54 Figure legends Fig. 1. CBP and p300 function as coactivators for MMP-9 promoter activity. (A) Schematic diagram of CBP/p300 and mutant constructs. CH: cysteine-histidine-rich domains; KIX: CREB-binding domain; Bromo: bromodomain; HAT: histone acetyltransferase activity domain; Q-rich: glutamine-rich region; W: tryptophan; Y: tyrosine; A: alanine; S: serine. (B) HeLa cells were transiently transfected with the MMP- 9-Luc reporter construct and 0 to 0.6 µg of pcmv-cbp or pcdna3-cbpwy or pcdna3 to normalize the total DNA transfected, and MMP-9 promoter activity determined as described in Materials and Methods. The results are the mean ± S.E. of at least three independent experiments. (C) HeLa cells were transiently transfected with the MMP-9-Luc reporter construct and 0 to 0.6 µg of pcmvβ-p300, pcmvβ-p300wy or pcmvβ-p300 CH3, and MMP-9 promoter activity determined as described in Materials and Methods. The results are the mean ± S.E. of at least three independent experiments. * p 0.05 compared to pcdna3 only transfected PMA treated samples; # p 0.05 between the two linked samples; NS, not significant between the two linked samples. Fig. 2. PCAF enhances MMP-9 promoter activity and its HAT activity is necessary for optimal induction. (A) Schematic diagram of PCAF and deletion constructs. HAT: histone acetyltransferase activity domain; Bromo: bromodomain. (B) HeLa cells were transiently transfected with the MMP-9-Luc reporter construct and 0 to 0.6 µg of pcx- PCAF, pcx-pcaf HAT1 or pcx-pcaf HAT2, and MMP-9 promoter activity determined as described in Materials and Methods. The results are the mean ± S.E. of at least three independent experiments. * p 0.05 compared to pcdna3 only transfected 46

55 PMA treated samples; # p 0.05 between the two linked samples; NS, not significant compared to pcdna3 only transfected PMA treated samples. (C) HeLa cells were transiently transfected with 0.4 µg of pcdna3, pcx-flag-pcaf, pcx-flag-pcaf HAT1 or pcx-flag-pcaf HAT2 for 48 h, and whole cell lysates isolated and subjected to immunoblotting analysis. Actin was utilized as a loading control. Fig. 3. CARM1 and GRIP1 activate MMP-9 promoter transcription and CARM1 methyltransferase activity is required. (A) Schematic diagram of CARM1 and CARM1E267Q. E: glutamic acid; Q: glutamine. (B) HeLa cells were transiently transfected with the MMP-9-Luc reporter construct and 0 to 0.6 µg of psg5-carm1 or psg5-carm1e267q, and MMP-9 promoter activity determined as described in Materials and Methods. The results are the mean ± S.E. of at least three independent experiments. * p 0.05 compared to psg5 only transfected PMA treated samples; # p 0.05 between the two linked samples; NS, not significant compared to psg5 only transfected PMA treated samples. (C) HeLa cells were transiently transfected with 0.6 µg of psg5.ha, psg5.ha-carm1 or psg5.ha-carm1e267q for 48 h and whole cell lysates isolated and subjected to immunoblotting analysis. Actin was utilized as a loading control. (D) HeLa cells were transiently transfected with the MMP-9-Luc reporter construct and 0 to 0.6 µg of psg5-grip1, and MMP-9 promoter activity determined as described in Materials and Methods. The results are the mean ± S.E. of at least three independent experiments. * p 0.05 compared to psg5 only transfected PMA treated samples; NS, not significant compared to psg5 only transfected PMA treated samples. (E) HeLa cells were transiently transfected with 0.6 µg of psg5.ha or psg5.ha-grip1 47

56 for 48 h and whole cell lysates subjected to immunoblotting analysis. Actin was utilized as a loading control. Fig. 4. Synergy among p300, CARM1 and GRIP1 is dependent on the AD1 and AD2 domains of GRIP1. HeLa cells were transiently transfected with the MMP-9-Luc reporter construct and 0.2 µg of various combinations of psg5-carm1, pcmvβ-p300, psg5- GRIP1, psg.5-grip1 AD1, psg.5-grip1 AD2 and psg.5-grip1 AD1+ AD2, and then MMP-9 promoter activity determined as described in Materials and Methods. The results are the mean ± S.E. of at least three independent experiments. * p 0.05 compared to empty vector only PMA treated samples (bar 2); p 0.05 compared to CARM1 or p300 construct alone PMA treated samples (bars 4 and 6); # p 0.05 wild type GRIP1 transfected PMA treated samples compared to mutant GRIP1 transfected PMA treated samples. NS1, not significant compared to empty vector only PMA treated samples (bar 2); NS2, not significant between the two linked samples; NS3, not significant compared to corresponding single coactivator expressed PMA-treated samples (bars 4 and 6); NS4, not significant compared to CARM1 and p300 coexpressed PMA-treated samples (bar 16). Insert is a schematic diagram of GRIP1. bhlh/pas: bhlh/per/ah receptor nuclear translocator (ARNT)/Sim domain involved in DNA binding and heterodimerization between proteins containing these motifs; 30 S/T: serine/threonine-rich regions; L1L2L3: three LXXLL (L, leucine; X, any amino acid) motifs for interaction with ligand-bound nuclear receptors; 30 AD1 and AD2: two intrinsic transcriptional activation domains. The AD1 domain is responsible for interaction with CBP and p300; The AD2 domain is responsible for interaction with CARM1 and PRMT1. 21,

57 Fig. 5. Knockdown of p300, CARM1 and GRIP1 reduces MMP-9 mrna expression. (A) ChIP assays were performed with soluble chromatin from HeLa cells that were untreated or treated with PMA (50 ng/ml) for 2 to 6 h, using antibodies against CBP, p300, CARM1, pcaf and GRIP1. Polyclonal rabbit IgG is utilized as a negative control. Immunoprecipitated DNA fragments were amplified with MMP-9 ChIP primers. Input chromatin was subjected to PCR to control for variations in immunoprecipitation starting material. Representative of three independent experiments. Fold induction is shown below each column. (B) HeLa cells were left untransfected, mock transfected, or transfected with SMART pool sirnas to p300, CARM1 or GRIP1. 48 h after transfection, cells were serum starved and then left untreated or treated with PMA for 8 h. Total RNA was then isolated and subjected to RT-PCR analysis with primers for p300, CARM1 and GRIP1 to evaluate the knockdown level of the coactivators as described in Materials and Methods. The intensity of untreated untransfected samples were arbitrarily set at 1 for calculation of the relative expression level of the coactivators in mock or sirna transfected cells, and the values are shown below each column. (C) The same cdna samples obtained in B were used for PCR with primers for MMP-9 and GAPDH to determine mrna levels. GAPDH mrna level was utilized as a control to normalize the variation between samples. The intensity of the PMA-treated untransfected sample was arbitrarily set at 1 for calculation of the relative expression level of MMP-9 in mock or sirna transfected cells, and the values are shown below each column. The data are representative of three independent experiments. 49

58 Fig. 6. Synergy among coactivators in MMP-9 gene expression. The human MMP-9 promoter is wrapped into a nucleosome structure. Activation of the MMP-9 gene induces recruitment of transcription factors such as NF-κB, Sp1 and AP-1, which can further recruit multiple coactivators such as CBP/p300, PCAF and CARM1 to the MMP-9 promoter. The tails of histones are modified by those enzymes to further relax chromatin. Ac, acetylation; Me, methylation. The AD1 and AD2 domains of GRIP1 bind to CBP/p300 and CARM1, respectively, to promote the formation and stabilization of this multiple protein complex to synergistically induce transcription of the MMP-9 gene. 50

59 References 1. Van den Steen, P. E., Dubois, B., Nelissen, I., Rudd, P. M., Dwek, R. A. & Opdenakker, G. (2002). Biochemistry and molecular biology of gelatinase B or matrix metalloproteinase-9 (MMP-9). Crit. Rev. Biochem. Mol. Biol. 37, Page-McCaw, A., Ewald, A. J. & Werb, Z. (2007). Matrix metalloproteinases and the regulation of tissue remodelling. Nat. Rev. Mol. Cell. Biol. 8, Egeblad, M. & Werb, Z. (2002). New functions for the matrix metalloproteinases in cancer progression. Nat. Rev. Cancer 2, Billiau, A., Kieseier, B. C. & Hartung, H. P. (2004). Biologic role of interferon β in multiple sclerosis. J. Neurol. 251 Suppl. 2, II Lakka, S. S., Gondi, C. S., Dinh, D. H., Olivero, W. C., Gujrati, M., Rao, V. H., Sioka, C. & Rao, J. S. (2005). Specific interference of upar and MMP-9 gene expression induced by double-stranded RNA results in decreased invasion, tumor growth and angiogenesis in gliomas. J. Biol. Chem. 280, Yan, C. & Boyd, D. D. (2007). Regulation of matrix metalloproteinase gene expression. J. Cell. Physiol. 211, Ma, Z., Shah, R. C., Chang, M. J. & Benveniste, E. N. (2004). Coordination of cell signaling, chromatin remodeling, histone modifications, and regulator recruitment in human matrix metalloproteinase 9 gene transcription. Mol. Cell. Biol. 24, Chan, H. M. & La Thangue, N. B. (2001). p300/cbp proteins: HATs for transcriptional bridges and scaffolds. J. Cell Sci. 114,

60 9. Vo, N. & Goodman, R. H. (2001). CREB-binding protein and p300 in transcriptional regulation. J. Biol. Chem. 276, Goodman, R. H. & Smolik, S. (2000). CBP/p300 in cell growth, transformation, and development. Genes Dev. 14, Kalkhoven, E. (2004). CBP and p300: HATs for different occasions. Biochem. Pharmacol. 68, Ogryzko, V. V., Schiltz, R. L., Russanova, V., Howard, B. H. & Nakatani, Y. (1996). The transcriptional coactivators p300 and CBP are histone acetyltransferases. Cell 87, Bannister, A. J. & Kouzarides, T. (1996). The CBP co-activator is a histone acetyltransferase. Nature 384, Gu, W. & Roeder, R. G. (1997). Activation of p53 sequence-specific DNA binding by acetylation of the p53 C-terminal domain. Cell 90, Chen, L. F., Mu, Y. & Greene, W. C. (2002). Acetylation of RelA at discrete sites regulates distinct nuclear functions of NF-κB. EMBO J. 21, Yang, X. J., Ogryzko, V. V., Nishikawa, J., Howard, B. H. & Nakatani, Y. (1996). A p300/cbp-associated factor that competes with the adenoviral oncoprotein E1A. Nature 382, Korzus, E., Torchia, J., Rose, D. W., Xu, L., Kurokawa, R., McInerney, E. M., Mullen, T. M., Glass, C. K. & Rosenfeld, M. G. (1998). Transcription factorspecific requirements for coactivators and their acetyltransferase functions. Science 279,

61 18. Zhao, L. Y., Liu, Y., Bertos, N. R., Yang, X. J. & Liao, D. (2003). PCAF is a coactivator for p73-mediated transactivation. Oncogene 22, Pal, S. & Sif, S. (2007). Interplay between chromatin remodelers and protein arginine methyltransferases. J. Cell. Physiol. 213, Lee, D. Y., Teyssier, C., Strahl, B. D. & Stallcup, M. R. (2005). Role of protein methylation in regulation of transcription. Endocr. Rev. 26, Chen, D., Ma, H., Hong, H., Koh, S. S., Huang, S. M., Schurter, B. T., Aswad, D. W. & Stallcup, M. R. (1999). Regulation of transcription by a protein methyltransferase. Science 284, Schurter, B. T., Koh, S. S., Chen, D., Bunick, G. J., Harp, J. M., Hanson, B. L., Henschen-Edman, A., Mackay, D. R., Stallcup, M. R. & Aswad, D. W. (2001). Methylation of histone H3 by coactivator-associated arginine methyltransferase 1. Biochemistry 40, Wang, H., Huang, Z. Q., Xia, L., Feng, Q., Erdjument-Bromage, H., Strahl, B. D., Briggs, S. D., Allis, C. D., Wong, J., Tempst, P. & Zhang, Y. (2001). Methylation of histone H4 at arginine 3 facilitating transcriptional activation by nuclear hormone receptor. Science 293, Xu, W., Chen, H., Du, K., Asahara, H., Tini, M., Emerson, B. M., Montminy, M. & Evans, R. M. (2001). A transcriptional switch mediated by cofactor methylation. Science 294, Chevillard-Briet, M., Trouche, D. & Vandel, L. (2002). Control of CBP coactivating activity by arginine methylation. EMBO J. 21,

62 26. Zika, E., Fauquier, L., Vandel, L. & Ting, J. P. (2005). Interplay among coactivator-associated arginine methyltransferase 1, CBP, and CIITA in IFN-γinducible MHC-II gene expression. Proc. Natl. Acad. Sci. USA 102, Mowen, K. A., Tang, J., Zhu, W., Schurter, B. T., Shuai, K., Herschman, H. R. & David, M. (2001). Arginine methylation of STAT1 modulates IFNα/β-induced transcription. Cell 104, Covic, M., Hassa, P. O., Saccani, S., Buerki, C., Meier, N. I., Lombardi, C., Imhof, R., Bedford, M. T., Natoli, G. & Hottiger, M. O. (2005). Arginine methyltransferase CARM1 is a promoter-specific regulator of NF-κB-dependent gene expression. EMBO J. 24, Hassa, P. O., Covic, M., Bedford, M. T. & Hottiger, M. O. (2008). Protein arginine methyltransferase 1 coactivates NF-κB-dependent gene expression synergistically with CARM1 and PARP1. J. Mol. Biol. 377, Xu, J. & Li, Q. (2003). Review of the in vivo functions of the p160 steroid receptor coactivator family. Mol. Endocrinol. 17, Chen, H., Lin, R. J., Schiltz, R. L., Chakravarti, D., Nash, A., Nagy, L., Privalsky, M. L., Nakatani, Y. & Evans, R. M. (1997). Nuclear receptor coactivator ACTR is a novel histone acetyltransferase and forms a multimeric activation complex with P/CAF and CBP/p300. Cell 90, Voegel, J. J., Heine, M. J., Tini, M., Vivat, V., Chambon, P. & Gronemeyer, H. (1998). The coactivator TIF2 contains three nuclear receptor-binding motifs and 54

63 mediates transactivation through CBP binding-dependent and -independent pathways. EMBO J. 17, Ma, H., Hong, H., Huang, S. M., Irvine, R. A., Webb, P., Kushner, P. J., Coetzee, G. A. & Stallcup, M. R. (1999). Multiple signal input and output domains of the 160-kilodalton nuclear receptor coactivator proteins. Mol. Cell. Biol. 19, Koh, S. S., Chen, D., Lee, Y. H. & Stallcup, M. R. (2001). Synergistic enhancement of nuclear receptor function by p160 coactivators and two coactivators with protein methyltransferase activities. J. Biol. Chem. 276, Lee, S. K., Kim, H. J., Na, S. Y., Kim, T. S., Choi, H. S., Im, S. Y. & Lee, J. W. (1998). Steroid receptor coactivator-1 coactivates activating protein-1-mediated transactivations through interaction with the c-jun and c-fos subunits. J. Biol. Chem. 273, Werbajh, S., Nojek, I., Lanz, R. & Costas, M. A. (2000). RAC-3 is a NF-κB coactivator. FEBS Lett. 485, Na, S. Y., Lee, S. K., Han, S. J., Choi, H. S., Im, S. Y. & Lee, J. W. (1998). Steroid receptor coactivator-1 interacts with the p50 subunit and coactivates nuclear factor κb-mediated transactivations. J. Biol. Chem. 273, Sheppard, K. A., Rose, D. W., Haque, Z. K., Kurokawa, R., McInerney, E., Westin, S., Thanos, D., Rosenfeld, M. G., Glass, C. K. & Collins, T. (1999). Transcriptional activation by NF-κB requires multiple coactivators. Mol. Cell. Biol. 19,

64 39. Lee, Y. H., Koh, S. S., Zhang, X., Cheng, X. & Stallcup, M. R. (2002). Synergy among nuclear receptor coactivators: selective requirement for protein methyltransferase and acetyltransferase activities. Mol. Cell. Biol. 22, Chen, D., Huang, S. M. & Stallcup, M. R. (2000). Synergistic, p160 coactivatordependent enhancement of estrogen receptor function by CARM1 and p300. J. Biol. Chem. 275, Rosenfeld, M. G. & Glass, C. K. (2001). Coregulator codes of transcriptional regulation by nuclear receptors. J. Biol. Chem. 276, McKenna, N. J. & O'Malley, B. W. (2002). Combinatorial control of gene expression by nuclear receptors and coregulators. Cell 108, Gerritsen, M. E., Williams, A. J., Neish, A. S., Moore, S., Shi, Y. & Collins, T. (1997). CREB-binding protein/p300 are transcriptional coactivators of p65. Proc. Natl. Acad. Sci. USA 94, Miao, F., Li, S., Chavez, V., Lanting, L. & Natarajan, R. (2006). CARM1 enhances NF-κB mediated gene transcription through methylation of histone H3 at arginine 17. Mol. Endocrinol. 20, Bordoli, L., Husser, S., Luthi, U., Netsch, M., Osmani, H. & Eckner, R. (2001). Functional analysis of the p300 acetyltransferase domain: the PHD finger of p300 but not of CBP is dispensable for enzymatic activity. Nucleic Acids Res. 29, Eckner, R., Ewen, M. E., Newsome, D., Gerdes, M., DeCaprio, J. A., Lawrence, J. B. & Livingston, D. M. (1994). Molecular cloning and functional analysis of 56

65 the adenovirus E1A-associated 300-kD protein (p300) reveals a protein with properties of a transcriptional adaptor. Genes Dev. 8, Bauer, U. M., Daujat, S., Nielsen, S. J., Nightingale, K. & Kouzarides, T. (2002). Methylation at arginine 17 of histone H3 is linked to gene activation. EMBO Rep. 3, Daujat, S., Bauer, U. M., Shah, V., Turner, B., Berger, S. & Kouzarides, T. (2002). Crosstalk between CARM1 methylation and CBP acetylation on histone H3. Curr. Biol. 12, Xu, W., Cho, H., Kadam, S., Banayo, E. M., Anderson, S., Yates, J. R., 3rd, Emerson, B. M. & Evans, R. M. (2004). A methylation-mediator complex in hormone signaling. Genes Dev. 18, Hong, H., Kao, C., Jeng, M. H., Eble, J. N., Koch, M. O., Gardner, T. A., Zhang, S., Li, L., Pan, C. X., Hu, Z., MacLennan, G. T. & Cheng, L. (2004). Aberrant expression of CARM1, a transcriptional coactivator of androgen receptor, in the development of prostate carcinoma and androgen-independent status. Cancer 101, El Messaoudi, S., Fabbrizio, E., Rodriguez, C., Chuchana, P., Fauquier, L., Cheng, D., Theillet, C., Vandel, L., Bedford, M. T. & Sardet, C. (2006). Coactivator-associated arginine methyltransferase 1 (CARM1) is a positive regulator of the Cyclin E1 gene. Proc. Natl. Acad. Sci. USA 103, Anzick, S. L., Kononen, J., Walker, R. L., Azorsa, D. O., Tanner, M. M., Guan, X.-Y., Sauter, G., Kallioniemi, O.-P., Trent, J. M. & Meltzer, P. S. (1997). AIB1, 57

66 a steroid receptor coactivator amplified in breast and ovarian cancer. Science 277, Zhao, X., Nozell, S., Ma, Z. & Benveniste, E. N. (2007). The interferonstimulated gene factor 3 complex mediates the inhibitory effect of interferon-β on matrix metalloproteinase-9 expression. FEBS J. 274, Gum, R., Lengyel, E., Juarez, J., Chen, J. H., Sato, H., Seiki, M. & Boyd, D. (1996). Stimulation of 92-kDa gelatinase B promoter activity by ras is mitogenactivated protein kinase kinase 1-independent and requires multiple transcription factor binding sites including closely spaced PEA3/ets and AP-1 sequences. J. Biol. Chem. 271, Ma, Z., Qin, H. & Benveniste, E. N. (2001). Transcriptional suppression of matrix metalloproteinase-9 gene expression by IFN-γ and IFN-β: critical role of STAT- 1α. J. Immunol. 167, Forsyth, P. A., Wong, H., Laing, T. D., Rewcastle, N. B., Morris, D. G., Muzik, H., Leco, K. J., Johnston, R. N., Brasher, P. M., Sutherland, G. & Edwards, D. R. (1999). Gelatinase-A (MMP-2), gelatinase-b (MMP-9) and membrane type matrix metalloproteinase-1 (MT1-MMP) are involved in different aspects of the pathophysiology of malignant gliomas. Br. J. Cancer 79,

67 Figure 1 59

68 Figure 2 60

69 Figure 3 61

70 Figure 4 62

71 Figure 5 63

72 Figure 6 64

73 THE INTERFERON-STIMULATED GENE FACTOR 3 COMPLEX MEDIATES THE INHIBITORY EFFECT OF INTERFERON-β ON MATRIX METALLOPROTEINASE- 9 EXPRESSION by XUEYAN ZHAO, SUSAN NOZELL, ZHENDONG MA AND ETTY N. BENVENISTE FEBS Journal, 274: (2007) Copyright 2007 by Blackwell Publishing Ltd Used by permission Format adapted and errata corrected for dissertation 65

74 Summary Matrix metalloproteinase-9 (MMP-9) displays a preference for a broad range of substrates including extracellular matrix proteins and cytokines. MMP-9 plays an important role in physiological processes, as well as in inflammatory diseases and numerous cancers. Interferon-β is a pleiotropic cytokine with antiviral, antiproliferative and immunomodulatory activities. Interferon-β positively regulates gene expression, predominantly through the Janus kinase-signal transducer and activator of transcription (STAT) pathway. However, little is known about the mechanisms used by interferon-β to negatively regulate gene expression. In the present study, we show that interferon-β inhibits MMP-9 gene expression at the transcriptional level. Using cell lines deficient in three components of the interferon-β-activated interferon-stimulated gene factor 3 (ISGF3) complex (i.e. STAT-1, STAT-2 and interferon regulatory factor 9), the results of our study indicate that all three members are required for interferon-β inhibition. Chromatin immunoprecipitation assays demonstrate that interferon-β reduces recruitment of transcriptional activators and coactivators, such as nuclear factor kappa B p65, Sp1, CREB-binding protein and p300, to the MMP-9 promoter, and decreases the degree of histone acetylation at the MMP-9 promoter. This occurs in the absence of an association of the ISGF3 complex with the MMP-9 promoter. Taken together, these data define the role of interferon-β and the ISGF3 members in suppressing MMP-9 gene expression. 66

75 Introduction Matrix metalloproteinase-9 (MMP-9) degrades extracellular matrix proteins such as collagen IV and V, gelatin II, vitronectin and myelin basic protein, and can cleave proteins such as transformation growth factor-β1, pro-tumor necrosis factor (TNF)-α, latent vascular endothelial growth factor, interleukin-8 and stromal cell-derived factor-1, leading to their activation [1]. Normally, MMP-9 is produced at low levels in a variety of cell types; however, high levels of MMP-9 have been related to several inflammatory diseases, such as multiple sclerosis (MS) and rheumatoid arthritis [1], in addition to a variety of cancers such as glioma, breast cancer and lung cancer [2, 3]. Although the exact mechanism underlying the up-regulation of MMP-9 in disease states is not clear, MMP-9 expression can be induced by various stimuli, such as endothelial growth factor, interleukin-1α, TNF-α, lipopolysaccharide and 4β-phorbal 12-myristate 13-acetate (PMA) [1, 4]. Depending on the stimulus and cell type, different signaling cascades, including nuclear factor kappa B (NF-κB), mitogen-activated protein kinase and phosphoinositide-3 kinase, are responsible for MMP-9 induction, primarily affecting MMP-9 transcription [1, 4]. The final target of these signaling cascades is the MMP-9 promoter. Previous studies have identified several cis-elements, including binding sites for NF-κB, Sp1, AP-1 and Ets-1 proteins within the minimal 670 bp MMP-9 promoter, and these sites are critical for transcriptional activation of MMP-9 [5-8]. More comprehensive studies on the molecular mechanisms of PMA-induced MMP-9 expression in HeLa cells indicate that the coordination of cell signaling, chromatin remodeling, histone modifications, and stepwise recruitment of transcription regulators are essential for MMP-9 gene expression [9]. 67

76 Interferon (IFN)-β is produced by many cell types upon virus infection, and has anti-viral, anti-proliferative and immunomodulatory activities [10]. IFN-β can stimulate the transcription of many genes primarily through the Janus Kinase (JAK)-STAT pathway. Upon binding of IFN-β to its cell surface receptor, composed of interferonalpha receptor 1 and 2, IFN-β induces dimerization of the two receptor subunits, followed by phosphorylation and activation of JAK tyrosine kinases, JAK1 and TYK2. Activated JAKs then phosphorylate tyrosine residues within the receptors and latent STAT-1 and STAT-2 proteins. STAT-1 has two alternatively spliced isoforms: STAT-1α and STAT- 1β. STAT-1β lacks the carboxyl terminal transactivation domain (TAD) of STAT- 1α [11]. After tyrosine phosphorylation, STAT-1α/β and STAT-2 are activated and form a STAT-1/2 heterodimer. The STAT-1/2 heterodimer is joined by interferon regulatory factor (IRF)-9 (also known as p48 or ISGF3γ) to form the heterotrimeric interferonstimulated gene factor 3 (ISGF3) complex, and translocates into the nucleus. In the nucleus, ISGF3 binds to interferon-stimulated response elements (ISRE) in the promoter of IFN-β inducible genes to stimulate transcription [11]. To a lesser extent, IFN-β stimulation leads to the formation of a STAT-1α homodimer (gamma-activated factor, GAF), which binds to gamma-interferon-activated sites. Both ISGF3 and GAF complexes induce gene expression by IFN-β, although the ISGF3 response is dominant [11]. In addition to gene induction, IFN-β can also inhibit the transcription of selected genes [12, 13], although less is known about the mechanisms underlying IFN-β-mediated negative gene regulation. 68

77 IFN-β is used clinically for the treatment of autoimmune diseases such as MS [14]. Although the precise mechanism(s) of action of IFN-β in MS remains ill-defined, one function is the reduction of MMP-9 expression. As well, IFN-β inhibits MMP-9 expression in tumor cell lines, including monocytic leukemia, astroglioma and fibrosarcoma, as well as in immune cells such as dendritic cells, T lymphocytes and mononuclear cells [1, 14-16]. However, how IFN-β inhibits MMP-9 expression is poorly understood, and whether the ISGF3 complex is required remains unknown. In this study, we demonstrate that the three members of the ISGF3 complex, STAT-1, STAT-2 and IRF-9, are required for the inhibitory effect of IFN-β on MMP-9 gene expression at the transcriptional level. IFN-β inhibition occurs at the MMP-9 promoter by reducing the presence of transcriptional activators and coactivators, and diminishing H3 and H4 histone acetylation. These results highlight the role of the ISGF3 complex in negatively regulating MMP-9 expression. 69

78 Results STAT-1 tyrosine phosphorylation is required for IFN-β-meditated inhibition of MMP-9 gene expression IFN-β stimulates gene expression via the ISGF3 complex, which is composed of STAT-1, STAT-2 and IRF-9 [11]. However, to date, it is not known whether the entire ISGF3 complex is involved in mediating inhibitory effects of IFN-β. Previous studies indicated that both STAT-1α and STAT-1β were involved in mediating the inhibitory effect of IFN-β on MMP-9 gene expression in HT1080 fibrosarcoma cells [13]. To further study the domain(s) of STAT-1 involved in this response, as well as the involvement of STAT-2 and IRF-9, we utilized a series of HT1080 fibrosarcoma-derived cell lines that are deficient or mutant in STAT-1, STAT-2 and IRF-9. U3A cells are deficient in STAT-1α and STAT-1β, U6A cells are deficient in STAT-2, and U2A cells harbor a truncated and inactive IRF-9 [17-21]. We have utilized a luciferase reporter driven by the human MMP bp promoter, which contains all the essential elements for MMP-9 expression, to monitor MMP-9 promoter activity and analyze the effect of different STAT-1 constructs in mediating the inhibitory effect of IFN-β. In U3A cells, which lack STAT-1, PMAinduced MMP-9 promoter activity was unaffected by the addition of IFN-β, indicating that IFN-β was unable to inhibit MMP-9 promoter activity in the absence of STAT-1 (Fig. 1B; U3A). We next analyzed different STAT-1 constructs (Fig. 1A) in stably transfected U3A cells. In U3A cells expressing human STAT-1α, IFN-β inhibited PMAinduced MMP-9 promoter activity by 54% (Fig. 1B; U3A-STAT-1α), indicating that 70

79 STAT-1α is necessary for the inhibitory effect of IFN-β. In U3A cells expressing STAT- 1β, IFN-β also inhibited MMP-9 promoter activity (36%) (Fig. 1B; U3A-STAT-1β), although the extent of inhibition was not as strong as that seen with STAT-1α. Tyrosine 701 phosphorylation of STAT-1α is essential for STAT-1α activation, dimerization and nuclear translocation [22]. Introduction of the phosphorylation defective mutant STAT- 1αY701F into U3A cells was incapable of restoring IFN-β-mediated inhibition (Fig. 1B; U3A-STAT-1αY701F), indicating that STAT-1α activation and dimerization are required for the inhibitory effect of IFN-β. Serine 727 phosphorylation of STAT-1α upon IFN-β treatment is essential for the full transcriptional activation activity of GAF. Although the mutant STAT-1αS727A only has 20% transactivation capability compared with wild-type STAT-1α [23], it restored IFN-β-mediated inhibition (Fig. 1B; U3A- STAT-1αS727A) to an extent comparable to wild-type STAT-1α. The expression levels of the reconstituted STATs are shown in Fig. 1C. These data demonstrate that STAT-1 is essential for mediating IFN-β inhibition of MMP-9, but that the transactivation activity of STAT-1 is not required as demonstrated by the results from the STAT-1β and STAT- 1αS727A cell lines. STAT-2 and its transactivation domain are required for IFN-β-meditated inhibition of MMP-9 gene expression We next assessed the potential role of STAT-2 in MMP-9 suppression by IFN-β using U6A cells, which lack endogenous STAT-2 [17]. U6A cells constitutively express modest levels of MMP-9 protein as indicated by gelatin zymography and immunoblotting 71

80 analysis, and mrna as indicated by RNase protection assay (RPA) assays. PMA treatment enhanced both MMP-9 protein and mrna expression (Fig. 2A). IFN-β alone did not modulate MMP-9 expression, and PMA-induced MMP-9 protein and mrna expression were not inhibited in the presence of IFN-β in U6A cells (Fig. 2A). Comparable results were obtained examining MMP-9 promoter activity (Fig. 2B). Transient transfection of increasing amounts of wild-type STAT-2 into U6A cells led to a restoration of IFN-β inhibition of MMP-9 promoter activity (Fig. 2B). The expression of STAT-2 was confirmed by immunoblotting (Fig. 2E). These data confirm that STAT-2 is required for the inhibitory effect of IFN-β. Like STAT-1α, STAT-2 also has a TAD, and this domain is required to mediate the transcriptional activity of ISGF3 [24], (Fig. 2C). We tested whether the TAD of STAT-2 was required for the IFN-β inhibitory effect by generating a plasmid encoding a STAT-2 mutant (STAT-2 800) that lacks the TAD of STAT-2 (Fig. 2C). Increasing amounts of this plasmid were transfected into U6A cells and MMP-9 promoter activity assayed (Fig. 2D). Interestingly, introduction of STAT did not restore IFN-β inhibition in U6A cells, even at the highest concentration tested (Fig. 2D). The expression of STAT was confirmed by immunoblotting (Fig. 2E). Because full-length STAT- 2 (Fig. 2B), but not STAT (Fig. 2D), restored IFN-β-mediated inhibition in U6A cells, these data suggest that the STAT-2 TAD is essential for the inhibitory effect of IFN-β on MMP-9 expression. 72

81 IRF-9 is required for MMP-9 suppression by IFN-β The other major component of the ISGF3 transcriptional complex is IRF-9, which belongs to the IRF family of proteins [11]. To study the function of IRF-9 in IFN-β suppression, we used HT1080 derived U2A cells, which express a non-functional truncated IRF-9 protein [18]. The U2A cells displayed basal expression of MMP-9 protein and mrna (Fig. 3A). PMA enhanced MMP-9 expression, while IFN-β alone had no effect (Fig. 3A). In the presence of both PMA and IFN-β, IFN-β was unable to inhibit MMP-9 enzymatic activity, protein expression and mrna expression (Fig. 3A). Similar results were observed for MMP-9 promoter activity (Fig. 3B). Increasing amounts of the pcdna3-irf-9 expression construct were transfected into U2A cells, and MMP-9 promoter activity examined. Transfection of a low concentration of pcdna3-irf-9 (0.2 µg) re-established IFN-β-mediated inhibition of MMP-9 promoter activity by 80%, which was not significantly changed by further increasing the amount of IRF-9 (Fig. 3B). The expression of IRF-9 was confirmed by immunoblotting (Fig. 3B insert). These results demonstrate the involvement of IRF-9 in IFN-β inhibition of MMP-9. IFN-β does not induce recruitment of ISGF3 components to the MMP-9 promoter We have thoroughly characterized the mechanism of PMA-induced MMP-9 gene expression in HeLa cells, which demonstrates that NF-κB and ERK1/2 signaling pathways, chromatin remodeling, histone modifications, and transcriptional factors and coactivators recruitment are critical for MMP-9 expression in HeLa cells [9]. Therefore, we further explored the mechanism(s) by which IFN-β inhibits MMP-9 expression in HeLa cells. As shown in Fig. 4A, HeLa cells have no basal MMP-9 protein and mrna 73

82 expression, and PMA induced MMP-9 expression. IFN-β alone had no effect on MMP-9 expression, however, both MMP-9 protein and mrna expression were inhibited upon simultaneous addition of IFN-β and PMA (Fig. 4A). These results indicate that IFN-β inhibits MMP-9 expression at the transcriptional level in HeLa cells. ISGF3 recognizes conserved ISRE elements (AGTTTCNNTTCNC/T) within IFN-β inducible gene promoters [11]. However, there are no consensus ISRE elements within the MMP-9 promoter, although some possible half ISRE-like elements exist [25]. To determine if the ISGF3 complex associates with the MMP-9 promoter to inhibit its transcription, Chromatin immunoprecipitation (ChIP) assays were performed using antibodies against STAT-1α, STAT-2 or IRF-9. As a positive control, the recruitment of these three proteins to the IRF-7 promoter, a well-known IFN-β inducible and ISRE containing gene was performed [26]. As shown in Fig. 4B, shortly after IFN-β treatment (0.5 h), STAT-1α, STAT-2 and IRF-9 were simultaneously recruited to the IRF-7 promoter and remained associated with the promoter for up to 4 h. PMA treatment did not induce recruitment of the proteins to the IRF-7 promoter (Fig. 4B). The induction of IRF-7 by IFN-β in HeLa cells was confirmed by IRF-7 immunoblotting (Fig. 4C). Because there is also an NF-κB binding site in the IRF-7 promoter [27], PMA, which activates NF-κB, was also able to slightly induce IRF-7 expression (Fig. 4C). Under the same conditions, none of the three components of ISGF3 was found to associate with the MMP-9 promoter upon either IFN-β or PMA treatment (Fig. 4B). These data indicate that there is no association of STAT-1α, STAT-2, or IRF-9 on the MMP-9 promoter upon IFN-β treatment. 74

83 IFN-β does not inhibit activation of the ERK1/2 or NF-κB pathways Previous studies demonstrated that both the ERK1/2 and NF-κB pathways are involved in PMA-induced MMP-9 gene transcription in HeLa cells because they are important for subsequent chromatin remodeling and recruitment of transcription factors to the MMP-9 promoter [9]. Thus, the transcriptional suppression of MMP-9 expression by IFN-β may result from inhibition of signaling pathways that are normally activated by PMA. Immunoblotting analyses were performed to examine the effect of IFN-β on the activation of ERK1/2 and NF-κB pathways using extracts from HeLa cells treated with PMA, IFN-β or both (Fig. 5). Phosphorylation of ERK1/2 occurred within 15 min of PMA treatment, and persisted for at least 4 h (Fig. 5A). Total ERK1/2 levels were not affected by PMA treatment (Fig. 5A). IFN-β only transiently and slightly activated ERK1/2 at 15 min after treatment (Fig. 5A). ERK1/2 phosphorylation upon simultaneous stimulation with PMA and IFN-β was comparable to that seen with PMA alone (Fig. 5A), indicating that IFN-β does not inhibit PMA-induced ERK1/2 activation. Activation of the NF-κB pathway, in which p65 becomes serine phosphorylated and translocates into the nucleus, was next analyzed. PMA induced phosphorylation of serine residue 276 of p65 at 15 min, which reached maximal levels at 1 h post-stimulation, and persisted for at least 4 h (Fig. 5B). IFN-β alone had no effect on p65 activation. Furthermore, IFN-β did not inhibit PMA-induced p65 phosphorylation and nuclear translocation when normalized to total levels of Sp1 (Fig. 5B). These data collectively illustrate that IFN-β does not interfere with PMA activation of the ERK1/2 and NF-κB pathways. 75

84 IFN-β inhibits PMA-induced transcriptional complex assembly on the endogenous MMP-9 promoter The MMP-9 promoter is packaged into an ordered chromatin structure and occupied by corepressor complexes such as Sin3A/histone deacetylase (HDAC)-1 and nuclear receptor corepressor/hdac-3 in the resting state in HeLa cells [9]. PMA treatment induces activation of AP-1 and NF-κB transcription factors and their binding to the MMP-9 promoter, and induces chromatin remodeling and recruitment of coactivators such as CREB-binding protein (CBP), p300 and RNA polymerase II (RNA Pol II) to the MMP-9 promoter [9]. Therefore, we sought to determine whether IFN-β modifies the PMA-regulated MMP-9 transcriptional program on the endogenous MMP-9 promoter. The MMP-9 promoter is most active in HeLa cells at 4 h after PMA treatment [9]; therefore, we analyzed the influence of IFN-β at this time point. HeLa cells were incubated with serum free media, or treated for 4 h with PMA, IFN-β, or PMA plus IFNβ. ChIP assays were performed with antibodies to p65, Sp1, c-fos, Jun D, RNA polymerase II (RNA Pol II), CBP, p300, acetylated histone 3 (AcH3) and acetylated histone 4 (AcH4) (Fig. 6A). PMA treatment increased the recruitment of transcriptional activators to the MMP-9 promoter, including p65, Sp1, c-fos and Jun D (Fig. 6A). RNA Pol II was recruited to the MMP-9 promoter upon PMA treatment (Fig. 6A). PMA treatment also induced recruitment of the coactivators CBP and p300, which have endogenous histone acetyltransferase (HAT) activity, to the MMP-9 promoter. AcH3 and AcH4 were increased by PMA treatment, which could result from the recruitment of CBP and p300 (Fig. 6A). IFN-β treatment slightly reduced the basal levels of p65, Sp1, RNA Pol II, CBP, AcH3 and AcH4 (Fig. 6A). In the presence of PMA plus IFN-β, there was a 76

85 reduction in recruitment of p65, Sp1, CBP and p300, and a decrease in H3 and H4 acetylation (Fig. 6A). Recruitment of RNA Pol II was slightly reduced. However, recruitment of AP-1 components c-fos and Jun D were not affected by IFN-β (Fig. 6A). As a negative control, ChIP assays were also performed with primers targeting the 3 - UTR of the MMP-9 gene as described by Ma et al. [9], and no specific binding of the transcription factors was detected (data not shown). Thus, these data indicate that IFN-β inhibits MMP-9 gene expression by interfering with MMP-9 transcriptional complex assembly in vivo. Because PMA-induced recruitment of p65 to the MMP-9 promoter was inhibited by IFN-β (Fig. 6A), whereas p65 activation and nuclear translocation were not affected by IFN-β (Fig. 5), it is possible that the DNA binding ability of p65 is affected by IFN-β treatment. To address this possibility, the association of p65 with the IRF-7 promoter was analyzed by ChIP. As mentioned previously, IRF-7 is a NF-κB inducible gene, and p65 binds to the NF-κB site of the IRF-7 promoter upon activation by PMA or TNF-α [27]. PMA treatment led to the recruitment of p65 to the IRF-7 promoter, and IFN-β did not affect this event (Fig. 6B). This indicates that IFN-β treatment does not globally inhibit the DNA binding ability of p65. 77

86 Discussion In the present study, we demonstrate that IFN-β is able to inhibit MMP-9 gene expression at the transcriptional level, and that this inhibition requires the IFN-βactivated ISGF3 complex composed of STAT-1, STAT-2 and IRF-9. IFN-β treatment inhibits the recruitment of transcriptional activators and coactivators, and reduces histone acetylation at the endogenous MMP-9 promoter; however, the ISGF3 components STAT- 1, STAT-2 and IRF-9 are not associated with the MMP-9 promoter. These results suggest that IFN-β treatment interferes with MMP-9 transcriptional complex assembly on the endogenous MMP-9 promoter. We first confirmed that STAT-1 is required for IFN-β inhibition in HT1080 human fibrosarcoma cells (Fig. 1B). Here, we extended this observation to show that when tyrosine 701 (Y701) of STAT-1α is mutated, IFN-β no longer inhibits MMP-9 expression (Fig. 1B). Because phosphorylation of Y701 is critical for STAT-1α activation, homo-dimerization or dimerization with STAT-2, these results suggest that such events are essential for IFN-β-mediated inhibition. By contrast, when STAT-1α serine 727 (S727) is mutated, IFN-β retains its ability to inhibit MMP-9 expression (Fig. 1B). Because STAT-1α S727 phosphorylation is only required for GAF activity, and not that of ISGF3 [28], these data suggest that GAF is not involved in the inhibitory effect of IFN-β. In cells expressing STAT-1β, IFN-β also inhibited MMP-9 expression (Fig. 1B). In cells that only express STAT-1β, the ISGF3 complex, but not the GAF complex, is 78

87 still functional, indicating that a functional ISGF3 complex is necessary for inhibition of MMP-9 expression by IFN-β. In the absence of STAT-2, IFN-β was unable to inhibit MMP-9 gene expression (Fig. 2A,B). Because the function of GAF is not affected by the lack of STAT-2, this again suggests that inhibition of MMP-9 by IFN-β is not mediated by GAF. The STAT mutant, which lacks the TAD of STAT-2, could not restore IFN-β inhibition of MMP-9 expression (Fig. 2D). Because the STAT-2 TAD is required for the full activity of a functional ISGF3 complex [24], these data indicate that either the TAD domain of STAT-2, a functional ISGF3, or both are required for the inhibitory effect of IFN-β. IRF- 9 is also essential for IFN-β-mediated inhibition of MMP-9 expression (Fig. 3). Because U2A cells possess an intact GAF, these results further support the notion that IFN-β inhibition is not mediated by GAF. Therefore, several lines of evidence suggest that IFNβ inhibition of MMP-9 is mediated by the ISGF3 complex, whereas the GAF complex is not involved in the inhibitory response. We further explored how IFN-β and the ISGF3 complex mediate inhibition of MMP-9. The MMP-9 promoter does not contain either ISRE or GAS elements [29], and we demonstrated that ISGF3 components do not associate with the MMP-9 promoter upon either IFN-β or PMA treatment (Fig. 4B). In addition, PMA activation of the NFκB and ERK1/2 pathways, which are involved in induction of MMP-9 expression [9], were not inhibited by IFN-β (Fig. 5). Finally, we determined that IFN-β has a direct inhibitory effect on the transcriptional activation program of the MMP-9 promoter by 79

88 reducing the levels of p65, Sp1, CBP, p300 and histone acetylation at the MMP-9 promoter (Fig. 6A). The MMP-9 promoter is wrapped into nucleosomes in the unstimulated state with only general transcription factors (GTFs) and corepressors complexes Sin3A/HDAC-1 and nuclear receptor corepressor/hdac-3 bound [9], (Fig. 7A). In response to PMA treatment, binding of transcription activators such as p65, Sp1 and AP-1 components c-fos and Jun D to the MMP-9 promoter occurs [9], (Fig. 7B). At the same time, coactivators such as the HATs CBP/p300 are recruited to modify histone tails. The MMP-9 promoter then becomes accessible to more transcription activators and coactivators, which recruit RNA Pol II to eventually promote mrna synthesis of the MMP-9 gene [9], (Fig. 7B). However, in the presence of IFN-β, there is a reduction in the recruitment of p65, Sp1, CBP and p300 to the MMP-9 promoter, which likely results in less histone acetylation, and therefore the promoter is less accessible to further binding of coactivators, activators and RNA Pol II (Fig. 7C). ISGF3 mediates the inhibitory effect of IFN-β on MMP-9 expression; however, the ISGF3 components do not associate with the MMP-9 promoter. Therefore, how does ISGF3 regulate the transcriptional program of the MMP-9 gene? There are several possibilities; one is that ISGF3 may induce the expression of downstream genes which mediate MMP-9 inhibition. This has been proposed as the mechanism by which interferons inhibit TNF-α-mediated MMP-9 activation in EW-7 cells [30]. The authors determined that interferons, both IFN-γ and IFN-β, induced interferon regulatory factor 1 (IRF-1) expression after 18 h of stimulation, which then competed with NF-κB for binding an IFN-responsive-like element overlapping the NF-κB site within the MMP-9 80

89 promoter [30]. We observe IFN-β inhibition of transcription factor recruitment to the MMP-9 promoter as early as 4 h post-stimulation, thus it is unlikely that IRF-1 mediates this early inhibition. However, it is possible that other unidentified IFN-β inducible gene products may contribute to the inhibitory effect of IFN-β on MMP-9 expression. The second possibility is that ISGF3 interacts with nuclear proteins to affect MMP-9 transcription. Candidate proteins include CBP/p300 which interact with numerous transcription factors [31]. The amount of CBP/p300 is limited in cells, and they are required by numerous transcription factors involved in multiple signaling pathways [32]. For example, IFN-α inhibits TNF-α-induced HIV gene expression by competing for p300 [33]. The competition for limited p300 between the IFN-γ and TGF-β pathways mediates the antagonistic regulation of type I collagen gene expression by these cytokines [34]. Moreover, previous studies on the inhibition of MMP-9 expression also demonstrate that CIITA and IFN-γ, through STAT-1α, inhibit MMP-9 expression by sequestration of CBP/p300 [29, 35]. In the present study, we demonstrate that IFN-β inhibits the recruitment of CBP and p300 to the MMP-9 promoter (Fig. 6A) and that IFN-β enhances the in vivo association of STAT-1α and STAT-2 with CBP (data not shown), possibly because there is more nuclear accumulation of STAT-1α and STAT-2 after IFN-β treatment. Furthermore, overexpression of CBP and p300 completely reversed the IFN-βmediated inhibition of MMP-9 expression (data not shown). These data suggest that IFNβ induces the binding of the ISGF3 complex to CBP/p300, which may compete or interfere with the binding of CBP/p300 to the MMP-9 promoter. A recent study showed that phosphorylation of CBP by IKKα switched the binding preference of CBP from p53 81

90 to NF-κB, thereby promoting cell growth [36]. Thus, it is also possible that IFN-β treatment may modify CBP/p300 in a manner to promote its binding preference from the MMP-9 promoter to ISGF3 regulated gene promoters. Our laboratory has previously studied the mechanism(s) of IFN-γ-mediated suppression of MMP-9 gene expression [29, 35], demonstrating that IFN-γ utilizes at least two ways to inhibit MMP-9 gene expression. One is via IFN-γ-activated STAT-1α, which induces expression of the CIITA protein, which then sequesters CBP to reduce the available levels of CBP and also the levels of acetylated H3 at the MMP-9 promoter [35]. Another way is that IFN-γ-activated STAT-1α directly interacts with CBP/p300 to reduce their levels and the levels of acetylation of H3 and H4 at the MMP-9 promoter [29]. As such, IFN-γ and IFN-β act similarly because both reduce the levels of CBP and/or p300 at the MMP-9 promoter. However, IFN-β inhibition of MMP-9 expression has unique features with respect to reducing the levels of NF-κB p65 and Sp1 at the MMP-9 promoter, which does not occur upon IFN-γ treatment. The reduced recruitment of NFκB p65 is not due to an inhibitory effect of IFN-β on NF-κB activation, nuclear translocation, or DNA binding ability (Figs. 5 & 6B). The molecular basis for the IFN-β effect on these two transcription factors, NF-κB p65 and Sp1, remains unknown. The MMP-9 gene is subject to negative regulation by a variety of mechanisms [4]. Yan et al., have shown that the metastases suppressor KiSS-1 inhibits MMP-9 expression by blocking NF-κB nuclear translocation and subsequent binding to the MMP-9 promoter [37]. Another metastases associated protein, MTA1, suppresses MMP-9 expression by 82

91 recruitment of HDAC2 to the MMP-9 promoter, resulting in diminished histone H3 and H4 acetylation [38]. Recently, a novel repressor of MMP-9 expression was identified, that being transgelin (SM22) [39]. SM22 inhibits MMP-9 expression by interfering with activation of the ERK signaling pathway, and subsequent AP-1 dependent MMP-9 gene transcription. The results from our study describe how IFN-β inhibits MMP-9 gene transcription, which is mediated by the IFN-β-activated ISGF3 complex. Taken together, all of these studies indicate that the transcriptional program of MMP-9 gene expression is a target for suppression, which may have implications for regulating MMP-9 expression in pathological conditions. 83

92 Materials and methods Materials and reagents PMA was purchased from Calbiochem (San Diego, CA, USA) and human recombinant IFN-β was purchased from R & D Systems (Minneapolis, MN, USA). The secondary peroxidase-conjugated antibody and ECL reagents were purchased from Pierce (Rockford, IL, USA). Anti-MMP-9 serum was purchased from Neomarker (Fremont, CA, USA) and anti-actin serum was purchased from Sigma (St. Louis, MO, USA). Anti- STAT-1α, anti-stat-1α/β, anti-stat-2, anti-irf-9, anti-cbp, anti-p300, anti-sp1, anti-c-fos and anti-jun D sera were purchased from Santa Cruz Biotechnology (Santa Cruz, CA, USA). Anti-p65 serun was purchased from Abcam (Cambridge, MA, USA). Anti-AcH3 and anti-ach4 sera were purchased from Upstate Cell Signaling Solution (Charlottesville, VA, USA), and anti-rna Pol II serum was purchased from Covance (Berkeley, CA, USA). Normal rabbit and mouse IgG, and protein A/G agarose/salmon sperm DNA for the ChIP assays were purchased from Upstate Cell Signaling Solution. Anti-phospho-ERK1/2 (p44/42 MAP Kinase), ERK1/2, phospho-nf-κb p65 (Ser276) sera were purchased from Cell Signaling Technology (Danvers, MA, USA). Anti- GAPDH serum was purchased from Abcam and anti-p65 (used in immunoblotting) serum were purchased from Santa Cruz. Plasmids The MMP-9-Luc luciferase reporter plasmid containing 670 bp of the human MMP-9 promoter was a generous gift from Dr. D. Boyd (MD Anderson Cancer Center, Houston, TX, USA) [7]. pcdna3.1 was purchased from Promega (Madison, WI, USA). 84

93 prc/cmv STAT-1αY701F and STAT-1αS727A were obtained from Dr. J. E. Darnell (Rockefeller University, New York, NY, USA). Human STAT-2 and IRF-9 cdnas were purchased from Open Biosystems (ATCC IMAGE clone ID and , respectively; Huntsville, AL, USA) and sequenced to confirm their identities. The STAT- 2 and IRF-9 ORF were excised by EcoRI and XhoI digestion, and then subcloned individually into the appropriate sites of the pcdna3.1 vector to create pcdna3.1/stat-2 and pcdna3.1/irf-9, respectively. To create STAT-2 800, pcdna3.1/stat-2 was digested with BamHI to remove the C-terminal portion of the STAT-2 ORF, and then re-ligated. Sequencing confirmed the integrity of the STAT-2 ORF and a new translational stop site. The carboxyl-terminus TAD of STAT-2 was therefore deleted in STAT [24]. Cell lines HeLa cells and HT1080 fibrosarcoma-derived cells were maintained in DMEM with 2 mm L-glutamine, 100 U ml -1 penicillin, 100 µg ml -1 streptomycin, and 10% FBS. The U3A [21], U6A [17] and U2A [20] cell lines were the generous gift of Dr G. R. Stark (Cleveland Clinic, Cleveland, OH, USA). U3A-STAT-1α, U3A-STAT-1β, U3A- STAT-1αY701F and U3A-STAT-1αS727A stable transfectants were generated as described previously [13, 40]. Total RNA isolation and RPA Experiments were performed and analyzed as previously described [13]. Total cellular RNA was isolated from cells and 20 µg was hybridized with human MMP-9 and 85

94 GAPDH riboprobes at 56 C overnight. The hybridized mixture was then treated with RNase A/T1 (1:100) at 37 C for 30 min, and analyzed by 5% denaturing (8 M urea) PAGE. MMP-9 mrna expression was normalized to GAPDH mrna levels for each experimental condition. Band intensity was quantified using the PHOSPHORIMAGER (Molecular Dynamics, Sunnyvale, CA, USA), and the intensity of the untreated sample was arbitrarily set at 1 for calculation of fold induction upon PMA and/or IFN-β treatment. Gelatin substrate gel zymography Zymography was performed as described previously [13]. In brief, cells were treated and supernatants collected after h and concentrated. Concentrated supernatants were mixed with SDS sample buffer without reducing agent, and subjected to 8% SDS-PAGE which was copolymerized with 1 mg ml -1 of gelatin. After electrophoresis, the gels were washed, developed, stained and then destained. Enzymatic activity of MMP-9 was shown as clear bands (zones of gelatin degradation) against the blue background of stained gelatin. Immunoblotting Whole cell lysates or concentrated supernatants were separated on 8% SDS- PAGE, and probed with specific antibodies, as previously described [13]. Cytoplasmic and nuclear fractions were extracted with NE-PER Nuclear and Cytoplasmic Extraction Reagents (Pierce) according to the manufacturer s instructions. The nuclear fraction was analyzed by 8% SDS-PAGE and probed with specific antibodies. 86

95 ChIP ChIP assays were performed as previously described [9]. Nuclei from crosslinked cells were resuspended in TE buffer (10 mm Tris/HCl, 1 mm EDTA) and sonicated. The soluble chromatin was precleared and then was immunoprecipitated with 2-5 µg of appropriate antibodies, and the immune complexes were absorbed with protein A/G beads blocked with BSA and salmon sperm DNA. Immunoprecipitated purified DNA was analyzed by semiquantitative PCR and densitometry was used to quantify the PCR results. The human MMP-9 promoter was analyzed using the following primers: forward 5 -GAC CAA GGG ATG GGG GAT C-3 and reverse 5 -CTT GAC AGG CAA GTG CTG AC-3. The human IRF-7 promoter was analyzed using the following primers for the ISRE element: forward 5 -AGC GCC ACT GTT TAG GTT TC-3 and reverse 5 - GTG TCA CAG GTG TCC ACA GG-3 ; and for the NF-κB element: forward 5 - CCT CCA CTC CTC CCT ACT CC -3 and reverse 5 - CCC AGC TCT TGG CTC TAC C - 3. Transient transfection and luciferase assay The MMP-9-Luc luciferase reporter plasmid was used as previously described [7, 29]. Transient transfection was performed as previously described [13] using the Fugene 6 reagent (Roche, Basel, Switzerland) for HeLa cells, and Lipofectamine Plus (Invitrogen, Carlsbad, CA, USA) for HT1080 derived cells. Cell extracts were assayed in triplicate for luciferase activity as described previously and normalized to total protein [13]. Luciferase activity from PMA alone stimulated cells was arbitrarily set at 100% for calculation of relative activity. 87

96 Statistical analysis Data are presented as the mean ± S.D., and the Student s t-test was used to determine statistical difference. P 0.05 were considered to be statistically significant. 88

97 Acknowledgements We are grateful to Drs. D. Boyd, J. E. Darnell and G. R. Stark for providing valuable reagents for this study. This work was supported in part by National Institutes of Health grants CA (to ENB.) and NS (to ENB and SN). SN was supported by a National Institutes of Health Postdoctoral Fellowship T32 AI

98 Figure legends Fig. 1. STAT-1 is required for IFN-β-mediated MMP-9 inhibition, and the differential effect of STAT-1 mutants on IFN-β-mediated MMP-9 inhibition. (A) Schematic diagram of functional domains of different STAT-1 constructs. SH2: Src homology 2 domain; TAD: transactivation domain. (B) U3A cells or U3A cells stably transfected with STAT- 1α, STAT-1β, STAT-1αY701F or STAT-1αS727A were used for this study. 0.2 µg of the MMP-9-Luc promoter construct was transiently transfected into cells by Lipofectamine Plus for 3 h. After an overnight recovery, the cells were serum starved for 6 h and then left untreated (UT) or treated with PMA (50 ng ml -1 ), IFN-β (500 U ml -1 ), or both for 16 h. Cell lysates were assayed for luciferase activity in triplicate and normalized to the total protein concentration. The induction of promoter activity by PMA was set as 100%. The results are the mean ± S.D. of three independent experiments. * p 0.01 compared to PMA alone treated samples; NS, not significant. (C) Whole cell lysates of U3A cells or the stable transfectants were isolated and subjected to immunoblotting analysis for STAT-1 expression. Actin was utilized as a loading control. Fig. 2. STAT-2 and its transactivation domain are required for IFN-β-mediated inhibition of MMP-9 gene expression. (A) U6A cells were incubated in serum-free media, PMA (50 ng ml -1 ), IFN-β (500 U ml -1 ), or PMA and IFN-β simultaneously for 24 h. The supernatants were harvested and subjected to gelatin zymography (ZY) and immunoblotting analysis (IB), and total RNA was isolated and subjected to RPA analysis with GAPDH mrna as a loading control. Fold induction of MMP-9 mrna levels is shown. Representative of three independent experiments. (B) U6A cells were transiently 90

99 transfected with 0.2 µg of the MMP-9-Luc promoter construct with increasing amounts of pcdna3-stat-2 (0, 0.2, 0.4, 0.6 µg). Empty pcdna3 vector was used to normalize the amount of DNA transfected per experiment. After recovery, the cells were treated as indicated for 16 h, and MMP-9 promoter activity was determined. The results are the mean ± S.D. of five independent experiments. * p 0.01 compared to PMA alone treated samples. NS, not significant. (C) Schematic diagram of wild type STAT-2 and STAT , which lacks the transactivation domain (TAD). (D) U6A cells were transiently transfected with 0.2 µg of the MMP-9-Luc promoter construct with increasing amounts of pcdna3-stat (0, 0.2, 0.4, 0.6 µg). Empty pcdna3 vector was used to normalize the amount of DNA transfected per experiment. After recovery, the cells were treated as indicated for 16 h, and MMP-9 promoter activity was determined. The results are the mean ± S.D. of five independent experiments. (E) U6A cells were transiently transfected with 0.6 µg of pcdna3, pcdna3-stat-2, or pcdna3-stat-2 800, and after 48 h, whole cell lyastes were isolated and subjected to immunoblotting analysis for STAT-2 expression. Actin was utilized as a loading control. Fig. 3. IRF-9 is required for IFN-β-mediated inhibition of MMP-9 gene expression. (A) U2A cells were incubated in serum-free media, PMA (50 ng ml -1 ), IFN-β (500 U ml -1 ), or PMA and IFN-β simultaneously for 24 h. The supernatants were harvested and subjected to gelatin zymography (ZY) and immunoblotting analysis (IB), and total RNA was isolated and subjected to RPA analysis with GAPDH mrna as a loading control. Fold induction of MMP-9 mrna levels is shown. Representative of three independent experiments. (B) U2A cells were transiently transfected with 0.2 µg of the MMP-9-Luc 91

100 promoter construct with increasing amounts of pcdna3-irf-9 (0, 0.2, 0.4, 0.6 µg). Empty pcdna3 vector was used to normalize the amount of DNA transfected per experiment. After recovery, the cells were treated as indicated for 16 h, and promoter activity was determined. The results are the mean ± S.D. of six independent experiments. * p 0.01 compared to PMA alone treated samples. Insert, U2A cells were transiently transfected with 0.6 µg of pcdna3 or pcdna3-irf-9, and after 48 h, whole cell lyastes were isolated and subjected to immunoblotting analysis for IRF-9 expression. Actin was utilized as a loading control. Fig. 4. The ISGF3 complex is recruited to the IRF-7 promoter but not to the MMP-9 promoter. (A) HeLa cells were incubated in serum-free media, PMA (50 ng ml -1 ), IFN-β (500 U ml -1 ), or PMA and IFN-β simultaneously for 10 h (RNA) or 36 h (protein). The supernatants were harvested and subjected to gelatin zymography (ZY) and immunoblotting analysis (IB), and total RNA was isolated and subjected to RPA analysis with GAPDH mrna as a loading control. Fold induction of MMP-9 mrna levels is shown. Representative of three independent experiments. (B) HeLa cells were left untreated (UT) or treated with IFN-β (500 U ml -1 ) or PMA (50 ng ml -1 ) for 0.5 h to 4 h. ChIP assays, using antibodies specific for STAT-1α, STAT-2 or IRF-9, were performed followed by PCR with primers specific to the IRF-7 ISRE element or MMP-9 primers, as described in Materials and methods. Input chromatin was subjected to PCR to control for variations in immunoprecipitation starting material. Polyclonal rabbit IgG was used as a negative immunoprecipitation control for nonspecific binding. (C) HeLa cells were left untreated, treated by PMA (50 ng ml -1 ), IFN-β (500 U ml -1 ) or both for 24 h, and whole 92

101 cell lysates were isolated and subjected to immunoblotting analysis for IRF-7. Actin was utilized as a loading control. Representative of two independent experiments. Fig. 5. IFN-β does not inhibit activation of the ERK1/2 and NF-κB pathways. HeLa cells were treated with PMA, IFN-β or both for the indicated times (0-4 h). (A) Whole cell lysates were isolated and subjected to immunoblotting analysis with antibodies recognizing phosphorylated ERK1/2 (perk1/2), total ERK1/2 and actin, as a loading control. (B) Nuclear fractions were analyzed by immunoblotting with antibodies recognizing phosphorylated-serine 276 of p65 (ps276 p65), total p65, GAPDH and Sp1. GAPDH and Sp1 were used as controls for the nuclear fractionation procedure. Representative of three experiments. Fig. 6. IFN-β inhibits PMA-induced transcriptional activation of the MMP-9 promoter. (A) HeLa cells were incubated in serum free media, PMA (50 ng ml -1 ), IFN-β (500 U ml -1 ), or both for 4 h. ChIP assays, using antibodies specific for p65, Sp1, c-fos, Jun D, RNA Pol II, CBP, p300, AcH3 and AcH4 were performed followed by PCR. Input chromatin was subjected to PCR to control for variations in immunoprecipitation starting material. Polyclonal rabbit IgG was used as a negative immunoprecipitation control for nonspecific binding. Fold induction is shown below each column. Representative of three independent experiments. (B) The same samples immunoprecipitated with p65 antibodies were analyzed by PCR using the IRF-7 primers targeting the NF-κB element, as described in Materials and methods. Fold induction is shown below each column. 93

102 Fig. 7. Proposed model of IFN-β-mediated MMP-9 gene suppression. (A) In unstimulated cells (UT), the MMP-9 gene promoter is in a basal state, to which only the GTFs and corepressor complexes are binding. (B) PMA induces the recruitment of transcriptional activators such as NF-κB (p65), Sp1 and AP-1 (c-fos and Jun D), coactivators such as CBP/p300, and RNA Pol II to the MMP-9 promoter, increases histone acetylation and releases the corepressor complexes. MMP-9 mrna is synthesized through RNA Pol II. (C) In the presence of both PMA and IFN-β, IFN-β reduces the binding of p65, Sp1, RNA Pol II, CBP and p300 on the MMP-9 promoter (indicated by smaller size and faded color) and decreases histone acetylation, which ultimately leads to less synthesis of MMP-9 mrna. See text for detail. 94

103 References 1. Van den Steen PE, Dubois B, Nelissen I, Rudd PM, Dwek RA & Opdenakker G (2002) Biochemistry and molecular biology of gelatinase B or matrix metalloproteinase-9 (MMP-9). Crit Rev Biochem Mol Biol 37, Rao JS, Yamamoto M, Mohaman S, Gokaslan ZL, Fuller GN, Stetler-Stevenson WG, Rao VH, Liotta LA, Nicolson GL & Sawaya RE (1996) Expression and localization of 92 kda type IV collagenase/gelatinase B (MMP-9) in human gliomas. Clin Exp Metastasis 14, Egeblad M & Werb Z (2002) New functions for the matrix metalloproteinases in cancer progression. Nat Rev Cancer 2, Yan C & Boyd DD (2007) Regulation of matrix metalloproteinase gene expression. J Cell Physiol 211, Sato H, Kita M & Seiki M (1993) v-src activates the expression of 92-kDa type IV collagenase gene through the AP-1 site and the GT box homologous to retinoblastoma control elements: a mechanism regulating gene expression independent of that by inflammatory cytokines. J Biol Chem 268, Sato H & Seiki M (1993) Regulatory mechanism of 92 kda type IV collagenase gene expression which is associated with invasiveness of tumor cells. Oncogene 8, Gum R, Lengyel E, Juarez J, Chen JH, Sato H, Seiki M & Boyd D (1996) Stimulation of 92-kDa gelatinase B promoter activity by ras is mitogen-activated protein kinase kinase 1-independent and requires multiple transcription factor binding sites including closely spaced PEA3/ets and AP-1 sequences. J Biol Chem 271,

104 8. Farina AR, Tacconelli A, Vacca A, Maroder M, Gulino A & Mackay AR (1999) Transcriptional up-regulation of matrix metalloproteinase-9 expression during spontaneous epithelial to neuroblast phenotype conversion by SK-N-SH neuroblastoma cells, involved in enhanced invasivity, depends upon GT-box and nuclear factor κb elements. Cell Growth Differ 10, Ma Z, Shah RC, Chang MJ & Benveniste EN (2004) Coordination of cell signaling, chromatin remodeling, histone modifications, and regulator recruitment in human matrix metalloproteinase 9 gene transcription. Mol Cell Biol 24, Billiau A (2006) Anti-inflammatory properties of Type I interferons. Antiviral Res 71, Platanias LC (2005) Mechanisms of type-i- and type-ii-interferon-mediated signalling. Nat Rev Immunol 5, Nozell S, Laver T, Patel K & Benveniste EN (2006) Mechanism of IFN-β-mediated inhibition of IL-8 gene expression in astroglioma cells. J Immunol 177, Ma Z, Qin H & Benveniste EN (2001) Transcriptional suppression of matrix metalloproteinase-9 gene expression by IFN-γ and IFN-β: critical role of STAT-1α. J Immunol 167, Billiau A, Kieseier BC & Hartung HP (2004) Biologic role of interferon β in multiple sclerosis. J Neurol 251 Suppl. 2, II Parks WC, Wilson CL & Lopez-Boado YS (2004) Matrix metalloproteinases as modulators of inflammation and innate immunity. Nat Rev Immunol 4, Opdenakker G, Van den Steen PE & Van Damme J (2001) Gelatinase B: a tuner and amplifier of immune functions. Trends Immunol 22,

105 17. Leung S, Qureshi SA, Kerr IM, Darnell JE, Jr. & Stark GR (1995) Role of STAT2 in the alpha interferon signaling pathway. Mol Cell Biol 15, Darnell JE, Jr., Kerr IM & Stark GR (1994) Jak-STAT pathways and transcriptional activation in response to IFNs and other extracellular signaling proteins. Science 264, Pellegrini S, John J, Shearer M, Kerr IM & Stark GR (1989) Use of a selectable marker regulated by alpha interferon to obtain mutations in the signaling pathway. Mol Cell Biol 9, John J, McKendry R, Pellegrini S, Flavell D, Kerr IM & Stark GR (1991) Isolation and characterization of a new mutant human cell line unresponsive to alpha and beta interferons. Mol Cell Biol 11, McKendry R, John J, Flavell D, Muller M, Kerr IM & Stark GR (1991) Highfrequency mutagenesis of human cells and characterization of a mutant unresponsive to both alpha and gamma interferons. Proc Natl Acad Sci USA 88, Shuai K & Liu B (2003) Regulation of JAK-STAT signalling in the immune system. Nat Rev Immunol 3, Wen Z, Zhong Z & Darnell JE, Jr. (1995) Maximal activation of transcription by Stat1 and Stat3 requires both tyrosine and serine phosphorylation. Cell 82, Qureshi SA, Leung S, Kerr IM, Stark GR & Darnell JE, Jr. (1996) Function of Stat2 protein in transcriptional activation by alpha interferon. Mol Cell Biol 16, Hujanen ES, Vaisanen A, Zheng A, Tryggvason K & Turpeenniemi-Hujanen T (1994) Modulation of M(r) 72,000 and M(r) 92,000 type-iv collagenase (gelatinase A 97

106 and B) gene expression by interferons α and γ in human melanoma. Int J Cancer 58, Lu R, Au WC, Yeow WS, Hageman N & Pitha PM (2000) Regulation of the promoter activity of interferon regulatory factor-7 gene: activation by interferon and silencing by hypermethylation. J Biol Chem 275, Lu R, Moore PA & Pitha PM (2002) Stimulation of IRF-7 gene expression by tumor necrosis factor α: requirement for NFκB transcription factor and gene accessibility. J Biol Chem 277, Varinou L, Ramsauer K, Karaghiosoff M, Kolbe T, Pfeffer K, Muller M & Decker T (2003) Phosphorylation of the Stat1 transactivation domain is required for full-fledged IFN-γ-dependent innate immunity. Immunity 19, Ma Z, Chang MJ, Shah RC & Benveniste EN (2005) Interferon-γ-activated STAT-1α suppresses MMP-9 gene transcription by sequestration of the coactivators CBP/p300. J Leukoc Biol 78, Sanceau J, Boyd DD, Seiki M & Bauvois B (2002) Interferons inhibit tumor necrosis factor-α-mediated matrix metalloproteinase-9 activation via interferon regulatory factor-1 binding competition with NF-κB. J Biol Chem 277, Chan HM & La Thangue NB (2001) p300/cbp proteins: HATs for transcriptional bridges and scaffolds. J Cell Sci 114, Vo N & Goodman RH (2001) CREB-binding protein and p300 in transcriptional regulation. J Biol Chem 276,

107 33. Hottiger MO, Felzien LK & Nabel GJ (1998) Modulation of cytokine-induced HIV gene expression by competitive binding of transcription factors to the coactivator p300. EMBO J 17, Ghosh AK, Yuan W, Mori Y, Chen S & Varga J (2001) Antagonistic regulation of type I collagen gene expression by interferon-γ and transforming growth factor-β: integration at the level of p300/cbp transcriptional coactivators. J Biol Chem 276, Nozell S, Ma Z, Wilson C, Shah R & Benveniste EN (2004) Class II major histocompatibility complex transactivator (CIITA) inhibits matrix metalloproteinase-9 gene expression. J Biol Chem 279, Huang WC, Ju TK, Hung MC & Chen CC (2007) Phosphorylation of CBP by IKKα promotes cell growth by switching the binding preference of CBP from p53 to NF-κB. Mol Cell 26, Yan C, Wang H & Boyd DD (2001) KiSS-1 represses 92-kDa type IV collagenase expression by down-regulating NF-κB binding to the promoter as a consequence of IκBα-induced block of p65/p50 nuclear translocation. J Biol Chem 276, Yan C, Wang H, Toh Y & Boyd DD (2003) Repression of 92-kDa type IV collagenase expression by MTA1 is mediated through direct interactions with the promoter via a mechanism, which is both dependent on and independent of histone deacetylation. J Biol Chem 278, Nair RR, Solway J & Boyd DD (2006) Expression cloning identifies transgelin (SM22) as a novel repressor of 92-kDa type IV collagenase (MMP-9) expression. J Biol Chem 281,

108 40. Wesemann DR & Benveniste EN (2003) STAT-1α and IFN-γ as modulators of TNFα signaling in macrophages: regulation and functional implications of the TNF receptor 1:STAT-1α complex. J Immunol 171,

109 Figure 1 101

110 Figure 2 102

111 Figure 3 103

112 Figure 4 104

113 Figure 5 105

114 Figure 6 106

115 Figure 7 107