Hosoya et al. TRIM28 is essential for erythroblast differentiation in the mouse (supplemental information)

Transcription

1 TaqMan assay Gene TRIM28 GATA-1 Applied Biosystems TaqMan assay Mm _m1 Mm _m1 SYBR Green assay Gene Forward primer Reverse primer Reference adult α-globin CCCGGTGCCTTGTCTGCT GTGAAATCGGCAGGGTGG NM_ SOX6 CAACAGCAGCCACACGGAGT GGGGACCCAGGTTCTCAAAGC McGrath et al. KLF1 CAGCTGAGACTGTCTTACCC AATCCTGCGTCTCCTCAGAC Esteghamat et al. BCL11A CCGGGATGAGTGCAGAATAT ATGAGTGTTCTGTGCGTGTTG Esteghamat et al. ALAS2 TGTCCCAGCCACATCATCCCC GCGCAGTAGCTCCTCACCACG NM_ FECH ACCCCAACCCCTACCGACTGG CTCCCCCGCTCACAAAGCCC NM_ KLF2 CCAAGAGCTCGCACCTAAAG GTGGCACTGAAAGGGTCTGT Alhashem et al. ETS1 AGCAGCACTGTGTGCCCTGG TCTGGGTAGGTAGGGTTGGCTCC NM_ LMO2 GGCTGGGAGAGGTGGGGAGG AGGCACGGATCCGCTTGTCAC NM_ TRP53 AAAGGATGCCCATGCTACAG TATGGCGGGAAGTAGACTGG Lee et al. CASP8 GCCTGCTGGGGAAGATCGAGG GGCGAGTCACACAGTTCCGCC NM_ Table S1. Primers used for qrt-pcr assays. McGrath KE, Frame JM, Fromm GJ, Koniski AD, Kingsley PD, et al. A transient definitive erythroid lineage with unique regulation of the β-globin locus in the mammalian embryo. Blood. 2011;117: Esteghamat F, Gillemans N, Bilic I, van den Akker E, Cantù I, et al. Erythropoiesis and globin switching in compound Klf1::Bcl11a mutant mice. Blood. 2013;121: Alhashem YN, Vinjamur DS, Basu M, Klingmüller U, Gaensler KM, Lloyd JA. Transcription factors KLF1 and KLF2 positively regulate embryonic and fetal beta-globin genes through direct promoter binding. J Biol Chem. 2011;286: Lee JY, Nakada D, Yilmaz OH, Tothova Z, Joseph NM, et al. mtor activation induces tumor suppressors that inhibit leukemogenesis and deplete hematopoietic stem cells after Pten deletion. Cell Stem Cell. 2010;7:

2 Figure S1. Expression profile of EpoR-GFP-Cre. GFP fluorescence expression in immature erythroid cells isolated from Trim28 flox/+ :Epor Cre/+ (red) or Trim28 flox/+ :Epor +/+ (blue) mouse was analyzed by flow cytometry. Erythroidlineage populations were separated by forward scatter and CD44 antigen according to Chen et al (Ref): basophilic erythroblast (r2), polychromatic erythroblast (r3), orthochromatic erythroblast (r4a), reticulocytes (r4b) and RBCs (r5) in the bone marrow. Pro-erythroblast (r1) population was defined as CD71 hi TER119 low shown as gray box in the dot plot. Data represent the representative of five mice of each genotype. EpoR-GFP-Cre is predominantly expressed in r1- r3 stages. Chen K, Liu J, Heck S, Chasis JA, An X, Mohandas N. Resolving the distinct stages in erythroid differentiation based on dynamic changes in membrane protein expression during erythropoiesis. Proc Natl Acad Sci U S A. 2009;106:

3 Figure S2. Erythropoiesis in adult bone marrow in Trim28 loss of function mutant mice using EpoR-Cre. EpoR-Cre is expressed in erythroid lineage, but not in myeloid or lymphoid lineage cells. TEC mutant [Trim28 flox/flox :Epor Cre/+ ] shown as flox/flox:epor(cre/+) and control [Trim28 flox/+ (flox/+), Trim28 flox/flox (flox/flox) and Trim28 flox/+ :Epor Cre/+ (flox/+:epor(cre/+)] mice between five and seven weeks of age were analyzed. (A) Flow cytometric analysis of total bone marrow cells separated on the basis of CD71 and TER119 expression according to Socolovsky et al (Ref). Numbers in the boxed areas indicates the mean 3

4 frequency of cells in that population. (B) The abundance of Trim28 floxed allele in CD71 + TER119 + immature erythroid cells was analyzed by qpcr. An average of the relative amount of the undeleted gene in the control Trim28 flox/flox cell was set to 200, which is the copy number of floxed allele in one hundred cells. Trim28 flox/+ :Epor Cre/+ mouse retains 16.6% of undeleted floxed allele compared to Trim28 flox/flox control, corresponding to 33 versus 200 copies. Therefore Trim28 flox/+ :Epor Cre/+ mouse retains 33% of cells undeleted. Trim28 flox/flox :Epor Cre/+ mouse retains 30% of undeleted floxed allele compared to Trim28 flox/flox control, corresponding to 60 versus 200 copies. Therefore Trim28 flox/flox :Epor Cre/+ mouse retains 30-60% of cells undeleted: either 30% of the cells have both alleles in a germ line configuration, or 60% of the cells have deleted only one allele (or something between these two extremes). (C) The expression level TRIM28 mrna normalized to β-actin in CD71 + TER119 + immature erythroid cells in mice of various genotypes (shown at the bottom) was analyzed by qrt-pcr. Average of relative amount in the pseudo wild type control (Trim28 flox/+ and Trim28 flox/flox ) was set to 1. (D) The expression level of β-type globin gene products normalized to β-actin in CD71 + TER119 + immature erythroid cells was analyzed by qrt-pcr. (E) The absolute number of total bone marrow cells and erythroid cells. Total bone marrow cells were isolated from two femurs plus two tibias. The absolute number of immature (CD71 + TER119 + ) and more mature (CD71 - TER119 + ) erythroid cells in the bone marrow were calculated from the data shown in (A) and the total bone marrow cell number. (F) Hematological parameters of TEC mutant peripheral blood. Each circle represents an individual animal while the black bars represents the averages. * indicates statistically significant, p<0.05. NS: not significant, p>0.05. Data represent the representative (A) or summary (B- F) of four to ten mice of each genotype. Socolovsky M, Nam H, Fleming MD, Haase VH, Brugnara C, Lodish HF. Ineffective erythropoiesis in Stat5a(-/-)5b(-/-) mice due to decreased survival of early erythroblasts. Blood. 2001;98:

5 Figure S3. Erythropoiesis in fetal liver in Trim28 loss of function mutant mice using EpoR-Cre. TEC mutant (Trim28 flox/flox :Epor Cre/+ ) and control Trim28 flox/flox mice at embryonic day 12.5 (e12.5) were analyzed. (A) Flow cytometric analysis of fetal liver cells separated on the basis of CD71 and TER119 expression. (B) Fetal liver cell counts. (C) GFP fluorescence expression in immature erythroid cells isolated from Trim28 flox/flox :Epor Cre/+ (red) or Trim28 flox/flox :Epor +/+ (blue) mouse was analyzed by flow cytometry. CD71 hi TER119 - population includes pro-erythroblast and CD71 + TER119 + population includes more differentiated erythroblast stage cells. (D) The abundance of Trim28 floxed allele in CD71 hi TER119 - pro-erythroblasts and 5

6 CD71 + TER119 + immature erythroid cells was analyzed by qpcr. An average of the relative amount of the undeleted gene in the control Trim28 flox/flox cell was set to 200, which is the copy number of floxed allele in one hundred cells. Amount of undeleted floxed allele was 20% in CD71 hi TER119 - population and 8% in CD71 + TER119 + compared to Trim28 flox/flox control. (E) Frequency of CD71 hi TER119 - pro-erythroblasts and CD71 + TER119 + immature erythroid cells in e12.5 fetal liver. (F) The absolute number of CD71 hi TER119 - pro-erythroblasts and CD71 + TER119 + immature erythroid cells were calculated from the data shown in (B) and (E). Although slight increase of CD71 hi TER119 - proerythroblasts cell number was observed, number and frequency of CD71 + TER119 + immature erythroid were normal. 6

7 Figure S4. Summary of phenotypes observed in TRIM28 loss of function mutant. A model of erythroid-lineage differentiation from progenitors is shown at the top. The first differentiation step of HSC specify multi-potential progenitors (MPP) which develop to common myeloid progenitors (CMP) and lymphoidprimed MPP (LMPP). CMP further develop to megakaryocyte-erythrocyte progenitors (MEP) and granulocyte-macrophage progenitors (GMP). The final commitment of MEP to the erythroid lineage occurs in erythroblasts, and erythroblasts finally differentiate into enucleated reticulocytes in the bone marrow. Reticulocytes that are released from the bone marrow into the vascular network mature into red blood cells while in circulation: pro-erythroblast (r1), basophilic erythroblast (r2), polychromatic erythroblast (r3), orthochromatic erythroblast (r4a), reticulocytes (r4b), RBCs (r5). CD71, TER119 and Globin gene expression profile (Suzuki et al and Gutiérrez et al) are also shown. TMC mutant generates two types of immature erythroid cells: TMC δ retains 5-8% of Trim28 floxed allele compared to Trim28 flox/flox control, while TMC Δ retains 1-4%. TMC Δ cells are 7

8 morphologically erythroid cell but fail to express TER119-glycophorin A complex. TEC mutant mouse retains 30% of undeleted floxed allele in CD71 + TER119 + immature erythroid cells. The TEC mutant mouse showed normal erythropoiesis and β-type globin gene expression (Figure S2). Further analysis is required to demonstrate the reason why the TEC mutant exhibits normal erythropoiesis and the TMC mutant is anemic: one possibility is that this is due to the difference in timing and/or abundance of Cre enzyme expression; a second possibility is that TRIM28 is required to reach a specific threshold of activity in erythroid cells, and the TEC mutants achieve that threshold while the TMC mice do not. Suzuki N, Suwabe N, Ohneda O, Obara N, Imagawa S, et al. Identification and characterization of 2 types of erythroid progenitors that express GATA-1 at distinct levels. Blood. 2003;102: Gutiérrez L, Tsukamoto S, Suzuki M, Yamamoto-Mukai H, Yamamoto M, et al. Ablation of Gata1 in adult mice results in aplastic crisis, revealing its essential role in steady-state and stress erythropoiesis. Blood. 2008;111:

9 Figure S5. Expression profile of erythroid related genes in immature erythroid cells of Trim28 mutant mice. Cells were isolated as describe in Figure 5. Total RNA (50 ng) was used for RT reaction and 1 ng RNA-equivalent 9

10 of RT product was used for qpcr analysis per well. Samples were analyzed in duplicate. Average of pseudo wild type was set to 1. Each circle represents an individual animal while the black bars represents the averages. Cells were isolated from two independent experiments and qrt-pcr assay was performed at same time for all samples (total 16). *: p<0.05. NS: not significant, p>0.05. All genes analyzed by qrt-pcr showed basically similar pattern compared to RNA- Seq data except for βh1-globin transcript (discussed in the manuscript). 10

11 Figure S6. RNA-Seq reads mapped on Trim28 locus. RNA-Seq reads ( million reads per one sample) mapped on mouse genome mm10 using TopHat 11

12 was visualized on IGV browser ( (Thorvaldsdóttir et al). A grey line represents one read mapped around Trim28 gene locus, and reads mapped on each region was displayed as collapsed view. Reads that span junctions are connected with thin blue lines. TRIM28 mrna expression was 26% in TMC δ and 18% in TMC Δ compared to control in the RNA-Seq experiment (Figure 5), while 0.4% and 0.4% in qrt-pcr assay (Figure S5). Most reads were mapped on 3 -UTR of Trim28 gene. Significant reduction of mapped reads on Trim28 coding exons was confirmed visually. TRIM28 TaqMan qrt-pcr assay (Applied Biosystems, Mm _m1) used in Figure S5 was designed on exon 2 and 3. Human 293T and mouse erythroleukemia (MEL) cell lines generated clear Western bands (approximately 100 kda) in our hands, whereas we were unable to generate a clear signal from mouse total bone marrow cells or sorted CD71 + TER119 + immature erythroid cells (data not shown). Therefore, we failed to demonstrate a difference in TRIM28 protein levels in the mutant. Thorvaldsdóttir H, Robinson JT, Mesirov JP. Integrative Genomics Viewer (IGV): highperformance genomics data visualization and exploration. Brief Bioinform. 2013;14:

13 Figure S7. Expression profile of typical internal standard genes analyzed by RNA-Seq. Genes found in QIAGEN mouse Housekeeping Genes PCR Array are shown at the top. Typical internal standard genes are shown at the middle. Novel candidate housekeeping genes for normalization proposed by Jonge et al 13

14 (Ref) are shown at the bottom. Only major isoforms in immature erythroid cells are shown for α- and β-tubulin. Only ACTB, TBP and UBC (marked as green circle) showed relatively stable expression profile in the TMC mutants. ACTB (βactin), which exhibited more stable FPKM levels in control and two TMC immature erythroid cells, was used to normalize qrt-pcr data in this manuscript. de Jonge HJ, Fehrmann RS, de Bont ES, Hofstra RM, Gerbens F, et al. Evidence based selection of housekeeping genes. PLoS One. 2007;2:e