Identification of a Stroma-Mediated Wnt/b-Catenin Signal Promoting Self-Renewal of Hematopoietic Stem Cells in the Stem Cell Niche
|
|
- George May
- 5 years ago
- Views:
Transcription
1 THE STEM CELL NICHE Identification of a Stroma-Mediated Wnt/b-Catenin Signal Promoting Self-Renewal of Hematopoietic Stem Cells in the Stem Cell Niche JIN-A KIM, a YOUNG-JU KANG, a GYEONGSIN PARK, a MYUNGSHIN KIM, a YOUNG-OK PARK, b HANJUN KIM, c SUN-HEE LEEM, d IN-SUN CHU, e JUN-SEONG LEE, b EEK-HOON JHO, c IL-HOAN OH a a Catholic Cell Therapy Center and Department of Cellular Medicine and; b Department of Pediatrics, The Catholic University of Korea, Seoul, Republic of Korea; c Department of Life Science, University of Seoul, Republic of Korea; d Department of Biological Science, Dong-A University, Busan, Republic of Korea; e Medical Genomics Research Center, Korea Research Institute of Bioscience and Biotechnology, Daejeon, Republic of Korea Key Words. Hematopoietic stem cell Self-renewal Wnt Stroma Stem cell microenvironment interactions Disclosure of potential conflicts of interest is found at the end of this article. ABSTRACT With contrasting observations on the effects of b-catenin on hematopoietic stem cells (HSCs), the precise role of Wnt/b-catenin signals on HSC regulation remains unclear. Here, we show a distinct mode of Wnt/b-catenin signal that can regulate HSCs in a stroma-dependent manner. Stabilization of b-catenin in the bone marrow stromal cells promoted maintenance and self-renewal of HSCs in a contactdependent manner, whereas direct stabilization in hematopoietic cells caused loss of HSCs. Interestingly, canonical Wnt receptors and b-catenin accumulation were predominantly enriched in the stromal rather than the hematopoietic compartment of bone marrows. Moreover, the active form of b-catenin accumulated selectively in the trabecular endosteum in Wnt 3a-stimulated or irradiationstressed, but not in steady-state marrows. Notably, notch ligands were induced in Wnt/b-catenin activated bone marrow stroma and downstream notch signal activation was seen in the HSCs in contact with the activated stroma. Taken together, Wnt/b-catenin activated stroma and their cross-talk with HSCs may function as a physiologically regulated microenvironmental cue for HSC self-renewal in the stem cell niche. STEM CELLS 2009;27: INTRODUCTION Hematopoietic stem cells (HSCs) constitute a rare subpopulation in hematopoietic tissues that sustain the production of blood cells throughout life and can reconstitute bone marrow after myeloablation or on transplantation into myeloablated recipients. The properties of homeostatic maintenance and expansion of HSCs are dependent on their unique ability to execute self-renewing divisions [1]. Multiple intrinsic regulators of HSC function are now recognized, including key transcription factors and signaling molecules [2]. Growing evidence also now points to the microenvironment of HSCs in the bone marrow, so-called stem cell niches, as playing a crucial role in the regulation of HSC maintenance and expansion [3, 4]. However, the signals that can activate the stem cell niche in response to physiological requirements for HSC selfrenewal and the downstream molecules involved remain poorly understood. Wnts are secreted glycoproteins associated with the cell surface or extracellular matrix that influence diverse biological processes, including embryonic induction and cell fate specifications. In the canonical Wnt signaling pathway, Wnt binding to seven-pass transmembrane Frizzled (Fz) family receptors and single-pass coreceptors, LDL-receptorrelated protein 5,6 (LRP 5,6), induces b-catenin stabilization and its entry into the nucleus where it activates T-cell factor/ lymphoid enhancer binding factor (TCF/LEF) target genes. In the absence of Wnt, b-catenin is destabilized by a destruction complex composed of Axin and the serine-threonine kinase, glycogen synthase kinase 3b (GSK 3b) [5]. The expression of Wnt and its receptors in hematopoietic tissues and their effects on hematopoietic progenitor cells point to roles for Wnt in hematopoietic function [6]. Recently, studies have provided further evidence that Wnt signaling regulates self-renewal of HSCs. Purified Wnt3a protein [7] and transduction of the constitutively active form of b-catenin into HSCs of transgenic bcl-2 mice [8] caused a phenotypic increase of HSCs during culture in vitro and enhanced reconstitution levels in vivo. Similarly, administration of a GSK 3b inhibitor, which inhibits the b-catenin destabilizing complex, resulted in an enhanced and accelerated repopulation of transplanted HSCs in vivo [9]. However, in a recent study on mice with conditional inactivation of b-catenin, normal Author contributions: J.A.K. and Y.J.K.: performed research, collected data; G.P.: performed research, collected data, interpreted data; M.K.: performed research, collected data; Y.O.P.: designed research; H.K. and S.H.L.: performed research; I.S.C.: analyzed data, performed statistical analysis; J.S.L.: designed research; E.H.J.: collected data, analyzed data; I.H.O.: designed research, analyzed, and interpreted data, wrote the manuscript. J.A.K., Y.J.K., and G.P. contributed equally to this work. Correspondence: Il-Hoan Oh, M.D., Ph.D., Catholic High-Performance Cell Therapy Center, The Catholic University of Korea, 505, Banpo-Dong, Seocho-Ku, Seoul, South Korea, Telephone: þ ; Fax: þ ; iho@catholic.ac. kr Received October 24, 2008; accepted for publication February 16, 2009; first published online in STEM CELLS EXPRESS February 26, VC AlphaMed Press /2009/$30.00/0 doi: /stem.52 STEM CELLS 2009;27:
2 Kim, Kang, Park et al hematopoietic development and repopulating activity was observed, suggesting that b-catenin activity is dispensable for HSC function [10]. Furthermore, mice with in vivo stabilized b-catenin exhibited defective hematopoietic repopulation during steady-state or stimulated conditions in a myeloablated host, which were nevertheless accompanied by expansion of phenotypically defined HSCs and defects in differentiation [11, 12]. Thus, the precise role of b-catenin in hematopoiesis remains unclear. In particular, the possible role of Wnt/b-catenin pathways in the regulation of stem cell niches and resulting influence on HSC self-renewal has not been explored. In this study, by differentially stabilizing b-catenin in hematopoietic versus stromal cells, we identify a new pathway for Wnt/b-catenin signaling that is mediated through the stroma that may function as a physiological cue for HSC self-renewal in the stem cell niche. MATERIALS AND METHODS Animal and Cells C57BL/6J-Ly 5.2 (BL6) mice or C57BL/6J-Pep3b-Ly5.1 (Pep3b) mice were used as recipients or donors in congenic transplantation. Experiments were undertaken with approval from the Animal Experiment Board and the Institutional Review Board of the Catholic University of Korea. 293T cells or mouse L cells were cultured in Dulbecco s modified Eagle s medium (DMEM; Gibco, Grand Island, NY, supplemented with 10% fetal bovine serum (FBS). Enrichment of murine bone marrow cells (BMCs) by lineage depletion (Lin ), 5-fluorouracil treatment (5-FU BMCs) or sorting for Lin Sca-1 þ c-kit þ (LSK) cells were performed as described [13]. Mesenchymal stromal cells (MSCs) were obtained from murine bone marrow by serial passage of adherent cells in medium containing 10% FBS until they became negative for CD45 [14], or by flowcytometric sorting for a CD45 population from the adherent cells. Plasmid, Conditioned Medium, and Retroviral Vector The TOPFLASH reporter construct containing eight TCF/LEF binding and FOPFLASH reporter containing mutated TCF/LEF binding sites were previously described [15]. The Wnt 3a conditioned medium (Wnt 3a-CM) was produced from L-cells as previously described [7] and filtered before use. The activity of Wnt 3a-CM was verified by induction and nuclear localization of b- catenin in stromal cells (supporting information Fig. S3C, S3D). A stable form of the b-catenin gene (S37A) [16] was cloned into the murine stem cell virus vector (MSCV) expressing green fluorescent protein (GFP) under the phosphoglycerate kinase (PGK) promoter (MSCV-PGK-GFP, abbreviated as MPG). Retroviral Transduction and Ex Vivo Culture Transduction of the retroviral vectors into hematopoietic cells was performed as previously described [13]. Briefly, cells were prestimulated for 48 hours in the serum-free medium containing BIT VR (Stemcell Technology, Vancouver, Canada) in the presence of 100 ng/ml Flt-3 ligand (FL) (R&D Systems, Minneapolis, MN, ng/ml Stem Cell Factor (SCF) (R&D systems) and 50 ng/ml Thrombopoietin (TPO) (CytoLab/ PeproTech, Rehovort, Israel) followed by three infections in medium containing the same cytokines (FLþSCFþTPO). MSCs expressing the stable form of b-catenin were established by infecting murine MSCs with MPG or MPG-b-catenin, followed by sorting for transduced (GFPþ) cells. MSCs were irradiated (1,500 cgy) before use and cocultures with hematopoietic cells were performed for 5 days as described [14] in the presence or absence of a trans-well filter (Corning, Corning, NY, or c-secretase inhibitor ll (Calbiochem, Darmstadt, Germany). The cell cycle of cocultured hematopoietic cells were analyzed by staining with Hoechst (10 lm) and Pyronin Y (1 lg/ml) as described [17] along with antibodies against CD45 (BD Pharmingen, San Diego, CA, lineage markers (StemCell Technology), Sca-1-PEcy7 (BD Pharmingen), c-kit- APC (ebioscience). In Vivo Repopulation and Competitive Repopulating Unit Assay Repopulation and differentiation of HSCs in congenic mice models was performed as previously described [13]. For quantitative measurements of HSC numbers, competitive repopulating unit (CRU) assays were performed as previously described [18]. Briefly, serial dilution of cells were transplanted into lethally irradiated (900 cgy) mice with helper cells, and recipient mice with 1%, or more, of donor-lymphoid and myeloid engraftments were scored as positive; 1 CRU was defined as the cell dose that resulted in negative engraftment in 37% of the test mice. Microarray Analysis for Gene Expression in b-catenin Transduced MSCs Analysis of gene expression for b-catenin/stroma in comparison to MPG/stroma was performed with Illumina BeadChip array hybridization analysis. Biotin-labeled crna samples were prepared according to Illumina s recommended labeling procedure. Briefly, 500 ng of total RNA was used for cdna synthesis, followed by an amplication/labeling step to synthesize biotin-labeled crna using the Illumina TotalPrep RNA Amplification kit (Ambion, Austin, TX). Labeled, amplified material (1,500 ng per array) was hybridized to a version 2 of the Illumina Mouse-6 BeadChip (48K) according to the manufacturer s instructions (Illumina, San Diego, CA). Arrays were developed by Amersham fluorolink streptavidin-cy3 (GE Healthcare Bio-Sciences, Little Chalfont, U.K.) and scanned with an Illumina Bead Array Reader confocal scanner (BeadStation 500GXDW; Illumina). Array data processing and analysis was performed using Illumina BeadStudio software. Average linkage hierarchical cluster analysis was carried out using a 1-Pearson correlation as similarity metric with the use of GeneCluster/TreeView program ( EisenSoftware.htm). One hundred and thirty-four unique genes were selected by t test (p <.005) with false discovery rate statistical confidence whose expression was induced three-fold or greater in b-catenin/stroma when compared with MPG/stroma. Gene Ontology program ( was then used to categorize genes in subgroups based on their biologic function and on their localization to extracellular regions. Reverse Transcription Polymerase Chain Reaction and Real-Time Quantiative Polymerase Chain Reaction Total RNAs purified from BMCs or MSCs were subjected to the reverse transcription polymerase chain reaction (RT-PCR) using the primer sets described (supporting information Table S2). For real-time quantiative polymerase chain reaction (RQ-PCR), cdna was amplified in the MyiQ icycler (Stratagene, Cedar Creek, TX). The threshold cycle (Ct) value for each gene was normalized to the Ct value of glyceraldehyde 3 phosphate dehydrogenase (GAPDH). The relative mrna expression was calculated by using the formula; 2 DDCt, where DCt ¼ Ct sample Ct GAPDH and DDCt ¼ DCt sample DCt reference group. Western Blotting and Immunostaining Western blots were performed using an anti-active-b-catenin antibody (clone 8E7; Upstate, Lake Placid, NY), an antibody against total b-catenin (Sigma, St. Louis, MI), an anti-human dll-1 antibody (AdipoGen, Seoul, Korea), an anti-murine dlk-1 antibody (clone 105B, AdipoGen) or an antibody against jagged-1 (Cell
3 1320 Stromal Wnt Signal for Stem Cell Self-Renewal Signaling, Danvers, MA). The Annexin V assay was performed according to the manufacturer s instructions. For bone marrow immunohistochemistry, femurs in a paraffin block (5 lm) were deparaffinized and pretreated with proteinase-k for 5 minutes for antigen retrieval. Endogenous peroxidase was blocked with 0.3% hydrogen peroxide for 5 minutes. The slides were then incubated with each antibody overnight at 4 C, washed and incubated with a secondary antibody (horseradish peroxidase) for 30 minutes at room temperature and visualized with DAKO REAL EnVision Detection System (DAKO, Glostrup, Denmark, com) and diaminobenzidine (DAB), followed by hematoxylin counterstaining. For double staining, slides that had been visualized with DAB were rinsed with PBS/Tween-20, denatured, then stained for a second antigen by incubating with rabbit polyclonal anti-n-cadherin (Abcam, Cambridge, U.K., com) or rat anti-mouse CD45 (BD Biosciences, Flanklin Lakes, NJ; 1:20) for 60 minutes. Staining for N-cadhrein was visualized with the Universal Alkaline Phosphatase Immunostaining Kit (Diagnostic Biosystem, Pleasanton, CA) and for CD45, with Rat on Mouse AP-Polymer Kit (Biocare Medical) using Vector Blue Alkaline Phosphatase Substrate Kit III (Vector Laboratory, Burlingame, CA). Statistical Analysis The significance of the differences between groups was analyzed using the Student s t test (p <.05). RESULTS b-catenin Activation is Compartmentalized in the Stroma Under Physiological Conditions Stimulating Hematopoiesis To gain insight on the possible role of the hematopoietic microenvironment in Wnt/b-catenin mediated regulation, we were first interested to see whether Wnt/b-catenin signals can target the stromal compartment of the microenvironment in the normal regulatory process of hematopoiesis. Therefore, we first examined the distribution of Wnt/b-catenin signaling molecules in the stromal and hematopoietic compartments of bone marrow by comparing expression patterns of genes in nonhematopoietic (CD45 ) bone marrow MSCs and hematopoietic cells. To our surprise, receptors for Wnt/b-catenin signals (Fz 1, 2, 7, 8) [19] were predominantly expressed in stromal cells rather than in hematopoietic cells, whereas canonical Wnt ligands (Wnt 1, 2b, 4, 10b) that activate b-catenin signaling [5] were predominantly expressed in the hematopoietic compartment (Fig. 1A and 1B and supporting information Fig. S1). In contrast, Wnt 5a, a noncanonical Wnt ligand related to the inhibition of canonical pathways [20], was enriched in stromal cells and the receptors Fz 4, 6 that are involved in noncanonical protein kinase-c activation [21] were enriched in 5-FU BMCs. Furthermore, a subset of genes involved in canonical Wnt-signal reception, LRP5, LRP6 [22], Ryk [23], Dickkopf2 [24], and Ror2 [25], was more highly expressed in stromal cells, whereas the Dickkopf4 [26], SFRP1, and SFRP2 genes [27] that inhibit the signaling, were enriched in 5-FU BMCs. These results reveal a compartmentalization of Wnt signaling molecules in the hematopoietic microenvironment where canonical Wnt signals preferentially localize to stromal cells. To further examine compartmentalization of Wnt/b-catenin signaling molecules under in vivo conditions, we looked at b-catenin accumulation in the trabecular region of bone marrows where most long-term HSCs reside and their selfrenewal occurs [3, 4]. As shown in Figure 1C 1E, accumulation of b-catenin (total form) was predominantly observed in the endosteal lining of the bone marrows and colocalized with the non-hematopoietic (CD45 ) N-cadherin þ cell population. This indicates that the endosteal osteoblastic niche, referred to as SNO (spindle shaped, CD45 N-cadherin þ osteoblast) [3, 4] may function as a primary target of Wnt/b-catenin signaling in the bone marrow microenvironment. Of note, accumulation of the active form (unphosphorylated) of b-catenin was selectively observed in the endosteal stroma of bone marrows in stimulated (by systemic injection of Wnt-3a) and stressed (by radiation) marrows, and not in homeostatic steady-state marrows (Fig. 2). These results reveal that b- catenin activation occurs in a compartmentalized fashion in the bone marrow microenvironment in conditions associated with stimulating HSC self-renewal suggesting that b-catenin is stabilized in the stroma during the physiological regulation of hematopoiesis. Distinct Effects of b-catenin Stabilization on HSCs Depending on Their Targeting Site On the basis of the physiological compartmentalization of b- catenin in the stromal component, we hypothesized that the regulatory effect of Wnt/b-catenin signals may be exerted through the stroma and therefore, that the effect may be distinct depending on whether Wnt/b-catenin signals are stabilized in the hematopoietic or stromal compartments. To test our hypothesis, we decided to compare the effects on HSCs of stabilizing b-catenin in stroma with those of stabilizing b- catenin in hematopoietic cells. For this, a retroviral vector (MPG) encoding a stable form of (S37A) b-catenin [16] gene was constructed and its ability to transactivate TCF/LEF target genes was confirmed with the TOPFLASH reporter [15] (supporting information Fig. S2). Using these retroviral vectors, we first examined the effect of expressing stable form b-catenin in bone marrow MSCs in coculture with HSCs. The established bone marrow stromal cells retained the ability to support HSCs without their own hematopoietic contribution in coculture, as well as the ability to reconstitute bone marrow stroma after intrafemoral injection into irradiated mice marrow as previously shown [28] (supporting information Fig. S3A, S3B). Their ability to respond to canonical Wnt signals was also confirmed as induction and nuclear localization of b-catenin following stimulation with Wnt-3a CM were readily detectable (supporting information Fig. S3C, S3D). After transduction of these stromal cells with control vector (MPG/stroma) or b-catenin (b-catenin/stroma), the surface phenotypes of the transduced cells revealed no phenotypic difference between MPG/stroma and b-catenin/ stroma cells (supporting information Fig. S4A). Although b- catenin/stroma exhibited a modest increase in chemically induced osteogenic differentiation compared to MPG/stroma, no significant alteration was seen in the composition of osteoblastic cells in the transduced cells during culture (supporting information Fig. S4B S4G). When 5-FU BMCs were cocultured on the stromal feeder cells for 5 days, the hematopoietic cells cocultured with b-catenin/stroma cells compared to MPG/stroma exhibited a higher frequency of phenotypically defined HSCs (Lin Sca-1 þ c-kit þ ) and increased LSK cell expansion relative to the input cells (0.5% 0.04% vs. 1.2% 0.1% for frequency, and vs folds expansion of input cells for MPG/stroma versus b-catenin/ stroma group, respectively; p <.05; Fig. 3A, 3B). When examined for LSK cell population, no significant difference in apoptosis was seen (Fig. 3C), but higher proportions of LSK cells were in G 0 state in the coculture with b-caten/stroma (52.2% 4.6% vs. 74.2% 2.7% for MPG/stroma vs. b-catenin/stroma group, respectively; p <.05; Fig. 3D, 3E).
4 Kim, Kang, Park et al Figure 1. Stromal compartmentalization of Wnt/b-catenin receptor molecules and b-catenin in bone marrow. (A): Compartmentalized expression pattern of Wnt-related genes in hematopoietic and stromal cells. Reverse transcription polymerase chain reaction (RT-PCR) analysis of indicated molecules in normal BM, 5-FU BMCs, and MSCs sorted for CD45( ). (B): Real-time PCR analysis of expression levels. Relative expression levels of indicated genes in untreated normal BM, 5-FU BM, and CD45( ) MSCs were calculated by normalization to the levels in normal BM. Shown are the mean folds with SEM from three experiments. (C): Localization of b-catenin in the non-hematopoietic CD45( ) stromal component of bone marrows. Bone marrow trabecular regions were double stained with b-catenin (brown, DAB), CD45 (blue, vector blue) and hematoxylin eosin counterstain (cobalt). (D, E): Colocalization of N-cadherin and b-catenin in the endosteal stroma of bone marrow. Bone marrows were single stained with b-catenin or N-cadherin (DAB) (D), or double stained with b-catenin (DAB) and N-cadherin (vector blue) (E). Abbreviations: BM, bone marrow; 5-FU BM, 5-fluorouracil-treated bone marrow; MSCs, mesenchymal stromal cells; PC, positive control for each molecule obtained from RNA mixture of mouse brain and testis. However, there was no significant difference in the S/G 2 /M phase of LSK cells or total cell numbers in the culture (supporting information Fig. S5), showing b-catenin/stroma enhanced the maintenance of an undifferentiated state during the mitotic division of cocultured cells. Similarly, the ex vivo maintenance of HSCs, as defined by CRU [18] was higher when 5-FU BMCs were cocultured with b-catenin/stroma than with MPG/stroma, as assessed by a two-fold higher recovery of CRUs in the limiting dilution assays performed immediately after a 5-day short-term culture, a period set to minimize accessory cell effects during the culture [17] (1/37,200 vs. 1/ 82,900 for MPG/stroma vs. b-catenin/stroma group, respectively; Fig. 4A). To further characterize the effects of b-catenin/stroma on the repopulating activity of HSCs, 5-FU BMCs were cocultured with transduced stroma and transplanted into irradiated recipient mice at a nonlimiting dose to assess average reconstitution levels. As shown, transplants from the b- catenin/stroma coculture displayed significantly higher levels of repopulation than those from the MPG/stroma coculture, for up to 24 weeks post-transplantation (Fig. 4B, 4C). The enhanced repopulation was not associated, however, with significant alteration in lymphomyeloid differentiation (Fig. 4D), suggesting the enhancement of repopulation occurs at the level of multilineage repopulating cells. Limiting dilution transplantation of reconstituted mice marrows into secondary recipients provided further support for this possibility, as it revealed an 18-fold higher number of regenerated CRUs in marrows that had received cells cocultured on b-catenin/ stroma than in marrows receiving cells on control stroma (1,155 CRUs vs. 65 CRUs for b-catenin/stroma and control stroma, respectively; Fig. 4E). However, the enhancing effect of b-catenin on hematopoietic reconstitution was not seen when HSCs were cocultured with stroma separated by a transwell filter, suggesting that the effect was dependent on direct cell-to-cell contact between HSCs and b-catenin activated stroma (Fig. 4F). Taken together, these results show that the stabilization of b-catenin in the stromal compartment leads to a higher maintenance of the undifferentiated state and/or increased self-renewal of HSCs in contact with the stroma. We next examined the effect of expressing the stable form of b-catenin in the hematopoietic compartment. Gene transfer efficiency into 5-FU BMCs reached 70% 80%, as determined by the percent of green fluorescent protein GFP(þ) cells 2 days after transduction. Accumulation of the stable form of b-catenin protein was detected in cells transduced with b-catenin and not in the control transduced (MPG) cells (Fig. 5A). There was no observed difference in apoptotic cells as determined by Annexin V binding to the undifferentiated fraction (Lin Sca-1 þ ), nor increase in the percent LSK cells in b-catenin transduced cells when
5 1322 Stromal Wnt Signal for Stem Cell Self-Renewal Figure 2. Physiological regulation of stromal b-catenin accumulation in bone marrow. (A): Endosteal accumulation of the active form of b- catenin with Wnt 3a stimulation. Mice were intravenously injected with Wnt 3a-CM or control-cm at indicated time (12 hours interval) before examination and their trabecular bone marrows were immunostained with antibody against active form (unphosphorylated) b-catenin, counterstained, and visualized by DAB (brown color). Images at low (100) and higher (400) magnification of the dotted inlets are shown. (B): Selective accumulation of the active form of b-catenin in the marrows under stressed condition. The trabecular region of femurs from steady-state or irradiated (5 days prior) mice were immunostained with antibody against the active form of b-catenin protein, counterstained and visualized with DAB (brown color). Shown are the representative images at low magnification (40) and higher magnification (200) of the dotted inlets and 400 magnification. Note the high basal level of red blood cells in the irradiated BM. Abbreviations: BM, bone marrow; DAB, diaminobenzidine. compared with control transduced cells (Fig. 5B, 5C). Nevertheless, when b-catenin transduced cells were transplanted into lethally irradiated recipients, levels of donor-derived transduced (GFPþ) cells were dramatically decreased compared to the levels of GFP(þ) cells in recipients of equivalent numbers of control transduced (MPG) cells (Fig. 5D). This decrease corresponded to an 11-fold lower frequency of CRUs for the b-catenin transduced cells when compared with the control transduced cells at the time of transplant (1/ 550,000 vs. 1/48,000 for b-catenin and MPG transduced, respectively; Fig. 5E). Thus, the predominant effect of directly expressing the stable form of b-catenin in hematopoietic cells was the loss of HSCs; this loss was not accompanied by the increase in the % of LSK cells that had been observed when b-catenin was stabilized in vivo [11, 12]. Taken together, our results reveal a distinct regulatory effect of b-catenin on HSCs depending on the primary site of activation and suggest that the regulatory effect of Wnt/b-catenin signals to promote maintenance or self-renewal of HSCs, as reflected by their compartmentalization in the microenvironment, are predominantly stroma-mediated. Wnt/b-Catenin Activation in Stroma Induces Notch Signal Activation in HSCs The observed stroma-mediated effect of b-catenin stabilization on HSCs in the specific conditions associated with stimulating HSCs suggested that a cross-talk may occur between stroma and HSCs, in which stromal cells activated by b-catenin may, in turn, stimulate HSCs. Therefore, we next explored the downstream effect of Wnt/b-catenin activated stroma in the microenvironment. A recent study demonstrated that induction of jagged-1, a serrate family notch ligand in the osteoblastic niche leads to self-renewal and expansion of HSCs in contact with stroma [3]. Promoters of jagged-1 and d-like one have also been shown to be targeted by b-catenin [29, 30]. Therefore, we were interested to see whether Wnt/b-catenin signals activated in stroma also lead to a corresponding activation of notch in the hematopoietic microenvironment. As shown, both the transcript and protein levels of jagged-1 were induced in b-catenin stabilized stromal cells compared to control transduced stroma (Fig. 6A). Similarly, induction of jagged-1 was observed when stromal cells were stimulated in vitro with Wnt3a-CM compared to cells that had been stimulated with control-cm (Fig. 6B). Moreover, the d-family notch ligand, d-like one (dll-1) was also induced in b-catenin transduced cells and in the Wnt3a-CM stimulated cells (Fig. 6C, 6D). To further test induction of notch ligands under in vivo conditions, we examined mice bone marrows injected with Wnt3a- CM. As shown, significant induction of jagged-1 and dll-1 were seen in the trabecular endosteum of Wnt3a injected mice compared to marrows from mice injected with control CM (Fig. 6E, 6F). These results indicate that stromal cells activated by Wnt/b-catenin signals induce notch ligands and that notch signal activation may be involved in a microenvironmental cross-talk between activated stroma and HSCs. To identify other possible factors involved in this crosstalk, we also performed a microarray-based bioinformatics screen to identify extracellular genes that are induced in b- catenin/stroma compared to MPG/stroma. Although group of genes encoding for soluble growth factors for HSCs such as growth arrest-specific 6 (Gas-6) [31], CXCL5 [32] and proliferin-2 [33] were also induced in the b-catenin transduced stroma, we sought for membrane-bound or extracellular
6 Kim, Kang, Park et al Figure 3. Effect of b-catenin stabilization in stromal cells on the in vitro hematopoietic activity of cocultured HSCs. (A, B): 5-Fluorouraciltreated bone marrow cells (5-FU BMCs) were cocultured on MPG/stroma or b-catenin/stroma for 5 days and analyzed for LSK cell population. Shown are the % LSK cells of the hematopoietic (CD45 þ ) cells after coculture (A) and the ratio of absolute numbers of LSK cells in each culture relative to the initial input LSK cell numbers (B) with an error bar indicating SEM (three experiments; *, p <.05). (C): Effects of coculture on the apoptosis of LSK cells. After 4 day s coculture, CD45þLSK cells were gated and AnnexinV (þ) inpi( ) cells were examined. Shown are the mean with error bar indicating SEM (n ¼ 3). (D, E): Effect on the cell cycle of cocultured hematopoietic cells. After coculture for 4 days, cells were stained for CD45 and LSK markers, followed by staining with Hoechst 33,342 and pyronin Y. The cell cycling status (G 0 or S/ G 2 /M) was examined for gated CD45 þ LSK populations. Shown are the representative flow cytometry plots (D) and % of CD45 þ LSKcells in G 0 populations or S/G2/M population (E) (two experiments, n ¼ 5; **, p <.01). Abbreviations: HSCs, hematopoietic stem cells; LSK, Lin Sca-1 þ c-kit þ ; MPG, murine stem cell virus vector (MSCV) expressing green fluorescent protein (GFP) under the phosphoglycerate kinase (PGK) promoter (MSCV-PGK-GFP); PI, propidium iodide. matrix-associated molecules as a candidate factor to mediate the contact-dependent effects. We identified one trans-membrane growth factor, d-like one homolog (dlk-1) that was significantly induced by b-catenin activation (supporting information Table S1, Fig. 7A). Dlk-1 has been shown to exert a cis-inhibitory effect on cells expressing its protein products [34] but to activate notch signals in neighboring cells [35]. We also observed induction of dlk-1 in the Wnt3a-CM stimulated stroma and trabecular endosteum injected with Wnt 3a- CM (supporting information Fig. S6A, S6B). Another gene, microfibril-associated glycoprotein2 (MAGP-2/MFAP-5), that encodes for an extracellular matrix protein that can facilitate shedding of jagged-1 in the cell membrane [36] was also induced in our screen for genes induced in b-catenin transduced stromal cells (supporting information Table S1, Fig. 7A). Taken together, these results show that Wnt/b-catenin activation in the stroma leads to induction of several genes encoding for notch ligands and for molecules involved in notch signal regulation. This suggests that Wnt/b-catenin activated stroma may trigger downstream activation of notch signals in adjacent HSCs. To test this possibility, we examined notch signal activation in HSCs in contact with activated stroma. As shown in Figure 7B, the undifferentiated hematopoietic cell population (CD45 þ Lin Sca-1 þ ) purified from a coculture with b-catenin/ stroma showed significant induction of the notch down-stream genes Hes-1 and deltex-1 [37] as well as induction of bmi-1, a gene whose expression level is tightly linked to HSC selfrenewal [38, 39]. Moreover, inhibition of notch signals with the c-secretase inhibitor abrogated the phenotypic changes of HSCs induced by b-catenin activated stroma, suggesting that the effects of b-catenin activated stroma on HSCs are dependent on functional down-stream notch signals (Fig. 7C). Activation of notch signals has previously been shown to enhance self-renewal of HSCs [40], whereas their inhibition leads to a failure to maintain the undifferentiated state and the selfrenewal properties of HSCs [3, 41]. Taken together, our results show that Wnt/b-catenin signals activated in the stromal compartment leads to induction of notch ligands and that cross-talk between activated stroma and HSCs results in activation of notch signals and enhanced maintenance of HSCs. DISCUSSION There is a major interest in understanding the microenvironmental regulation of stem cell behavior and its physiological significance. In the current study, we show that canonical Wnt/b-catenin signals target the stromal compartment of the hematopoietic microenvironment and trigger distinct regulatory effects on HSCs. We show that physical contact between HSCs and b-catenin-activated stroma caused enhanced
7 1324 Stromal Wnt Signal for Stem Cell Self-Renewal Figure 4. Effect of stromal b-catenin stabilization on the hematopoietic activity in vivo. (A): CRU frequencies of hematopoietic cells immediately after 5 days culture in vitro. 5-Fluorouracil-treated bone marrow cells (5-FU BMCs) cocultured on each stromal feeder cells were transplanted into lethally irradiated mice together with recipient marrow cells ( cells) at serial dilution doses as indicated. Twelve weeks after transplantation, repopulation in the recipient blood was analyzed and Poisson statistics were applied on a percentage of mice with negative engraftments to determine CRU frequencies. Upper and lower limits within a 95% confidence interval (CI) of CRU frequencies are shown to represent 2 SEM. (B, C): Effect of b-catenin-activated stroma on the repopulating activity of cocultured hematopoietic stem cells. 5-FU BMCs (Ly5.1) were cocultured on stromal cells transduced with MPG or MPG-b-catenin for 5 days. Cultured cells (equivalent to input cells) were then transplanted into lethally irradiated recipient mice (Ly5.2). Shown are the representative flow cytometry profiles (B) and mean % donor-derived leukocytes (Ly5.1þ) cells in the recipient blood at the time indicated after transplantation (C) (n ¼ 4 for each). *, p <.05. (D): The myeloid (Mac-1/Gr- 1) and lymphoid (B220) lineages of donor-derived reconstituted cells in (C) were analyzed and the percent of each lineage in reconstituted cells are shown with SEM. (E): Number of donor-derived CRUs regenerated in the recipient bone marrows. The reconstituted primary recipient mice in (C) were pooled and transplanted by serial dilution into secondary recipient mice. Each CRU frequency was determined 16 weeks after secondary transplantation by applying Poisson statistics and total CRU numbers were calculated assuming that the two femurs and tibiae represent 25% of total marrow [13]. Values are the mean for the total number of donor-derived (Ly5.1) CRUs per mouse with error bars representing the upper and lower limits of a 95% CI. (F): Effect of transwell filter separation during coculture. Lin( ) BMCs were plated on the transwell filter ( cells per ml) in the coculture with each transduced stroma (MPG/non-contact (NC) or b-catenin/nc) for 5 days and transplanted into irradiated mice (transplant of initial cells per mouse). Shown are the mean % donor-derived cells 2 SEM of donor cells in the recipient blood 16 weeks after transplantation (two experiments; n ¼ 10 each). Abbreviations: CRU, competitive repopulating unit; MPG, murine stem cell virus vector (MSCV) expressing green fluorescent protein (GFP) under the phosphoglycerate kinase (PGK) promoter (MSCV-PGK-GFP). maintenance and expansion of HSCs as shown in phenotypic (LSK cells) and functional (in vivo competitive repopulating cells) assays. Higher maintenance of HSCs in b-catenin-activated stroma was most evident during in vivo reconstitution in a myeloablated host environment. Only limited selfrenewal and moderately higher frequencies of HSCs were detected during short-term in vitro culture, possibly because of less optimal conditions for maintenance of HSCs in vitro and limited mitotic division of the cells under these conditions [42]. Alternatively, it is also possible that HSCs in contact with b-catenin-activated stroma are maintained in an undifferentiated but primed state for self-renewal such that under the in vivo conditions stimulating reconstitution they exhibit a higher level of self-renewal. In contrast, direct stabilization of b-catenin in hematopoietic cells resulted in the loss of HSCs. These results reveal a clear difference in the effects on HSCs of stabilized b-catenin depending on the site of activation in stromal or hematopoietic compartments. Although contrasting effects of b-catenin on HSC was also reported in a study model using bcl-2 transgenic mice [8], it should be considered that bcl-2 expression was shown to cause an expansion of HSCs and increase of their repopulating activities [43]. Furthermore, consistent with our finding that the effect of Wnt/b-catenin to promote the maintenance or selfrenewal of HSCs is stroma-mediated, we detected compartmentalization of Wnt/b-catenin signal molecules in the hematopoietic microenvironment. Analysis of the gene expression patterns of Wnt signaling molecules revealed that canonical Wnt receptors were predominantly compartmentalized on stromal cells. Moreover, Wnt signaling molecules, such as the coreceptors LRP 5,6 [22], Ryk, a tyrosine kinase coreceptor of Wnt1, 3a [23], dickkopf-2, a molecule that binds to LRP 6 and activates canonical Wnt signaling [24], and Ror-2, an orphan receptor tyrosine kinase that potentiates canonical pathway signaling [25] were also enriched in stromal cells compared to 5-FU BMCs. In contrast, Wnt ligands involved in canonical pathways (Wnt1, 2b, 4, 10b) were enriched in hematopoietic cells of 5-FU BMCs. Interestingly, molecules involved in the noncanonical Wnt pathway that have been shown to have inhibitory effects on the canonical pathways
8 Kim, Kang, Park et al Figure 5. Effect on hematopoietic function of b-catenin stabilized directly in hematopoietic cells. (A): Accumulation of the stable form of b- catenin protein after retroviral transduction of 5-fluorouracil treated bone marrow cells (5-FU BMCs) as detected by antibody against total form of b-catenin or HA tag. (B, C): Effects of b-catenin transduction on survival and differentiation. Lin bone marrow cells were transduced with each retroviral vector and cultured in medium containing identical cytokines without virus for an additional 48 hours. These cultured cells were then analyzed for % LSK cells of transduced (GFP þ ) or AnnexinV binding in GFP þ Lin Sca-1 þ cells. Shown are the mean SEM obtained from four independent experiments. (D, E): Comparison of engraftment levels of 5-FU BMCs transduced with MPG or b-catenin. 5-FU BMCs from Pep3b (Ly5.1) mice were transduced with one of the retroviral vectors and transplanted into lethally irradiated recipient mice (Ly5.2) and analyzed for engraftment. Shown are the representative flow cytometry plots for mice transplanted with of BMCs (D), and CRU frequencies in the transduced BMCs calculated by employing Poisson statistics on percent negatively engrafted mice with 95% CI to represent 2 SEM (E). Abbreviations: CRU, competitive repopulating unit; GFP, green fluorescent protein; HA, hemagglutinin; LSK, Lin Sca-1 þ c-kit þ. [20] were reciprocally localized from those molecules involved in canonical pathways. However, the significance of this finding needs further studies, since it is possible that Wnt interacts with multiple Fz receptor families and their effects could be dependent on the receptor context [44, 45]. Nonetheless, consistent with compartmentalized gene expression patterns, immunohistochemical examination of trabecular bone marrows showed b-catenin localization predominantly to the endosteal lining of CD45 N-cadherin þ cells, suggesting that the stromal microenvironment serves as a primary target site of b-catenin activation. Importantly, endosteal accumulation of the active form of b-catenin was detected selectively under the stimulated and stressed conditions that can stimulate HSCs in vivo. The regulated accumulation of b-catenin to the stroma suggested that cross-talk occurs between b-catenin-stabilized stroma and HSCs to transmit stromal activation signals to HSCs. In a search for the factors that mediate such a cross-talk we found that jagged-1 and dll- 1, notch ligands with TCF/LEF binding sites in their promoters [29, 30], were induced by b-catenin activation. Furthermore, demonstration that dll-1 and jagged-1 were specifically induced in the trabecular endosteum of mice injected with Wnt3a-CM provided further evidence of a link between physiological activation of Wnt/b-catenin signals and induction of notch ligands. Interestingly, a microarray-based bioinformatics screen for membrane-associated genes induced in b- catenin activated stroma provided further support for the involvement of notch signal activation in the cross-talk between stroma and HSCs as two membrane-associated genes related to notch activity, dlk-1 and MAGP-2 were identified in the screen. The protein products of dlk-1 do not have a receptor binding [delta/serrate/lag2 (DSL)] domain and their function remains poorly understood. However, in a recent study, dlk-1 was shown to exert a cis-inhibitory effect on autonomous notch activity in cells expressing dlk-1 protein during drosophila development [34], but to associate with notch signal activation in neighboring cells during mammalian thymus development [35]. In addition, stromal expression of dlk- 1 was shown to increase primitive hematopoietic cells during coculture [46]. Moreover, the extracelluar matrix protein, MAGP-2, was shown to facilitate specific shedding of membrane-bound jagged-1 and its oligomerization to activate notch signals [36]. Therefore, it is possible that stabilization of b-catenin in the bone marrow stroma leads to an induction of notch ligands in the stroma in a regulated manner. Interestingly, recent study have shown that notch signals are dispensable for normal maintenance of HSCs and that only basal levels of notch signals are exposed to HSCs in the bone marrow environment [47]. Consistent to the observation, we observed almost undetectable levels of notch ligands in the in situ bone marrow sections examined, unless stimulated by Wnt 3a ligand (Fig. 6E, 6F). In contrast, activation of notch signals in HSCs [40, 48] or induction of notch ligands in the stroma [3] could enhance self-renewal of HSCs. Therefore, it is possible that the phenotypes detected following Wnt/b-catenin activation of stroma are mediated by up-regulation of
9 1326 Stromal Wnt Signal for Stem Cell Self-Renewal Figure 6. Induction of notch ligands in the stroma activated by Wnt/b-catenin signal. (A, C): Induction of jagged-1 (A) and dll-1 (C) in b-catenin transduced stromal cells as determined by Western blot and real-time polymerase chain reaction (PCR) analysis. Shown are the representative immunoblots (left) and the real-time PCR analysis (right) for relative expression levels of the indicated genes in b-catenin/stroma relative to the MPG/stroma calculated by normalizing each gene expression against glyceraldehyde 3 phosphate dehydrogenase (GAPDH) using the formula described in Material and Methods. (B, D): Induction of jagged-1 (B) and dll-1 (D) in stroma by stimulation with Wnt-3a CM. Stromal cells were stimulated with Wnt-3a CM or control-cm and expression of jagged-1 or dll-1 was examined by Western blot 24 hours after or by realtime PCR analysis 6 hours after stimulation. Shown are the representative immunoblots (left) and real-time PCR analysis (right) for relative expression levels of indicated genes in Wnt 3a-CM-stimulated cells relative to the cells stimulated with control-cm (Right) (n ¼ 3). (E, F): Selective induction of jagged-1 (E) and dll-1 (F) in the endosteum of trabecular bone marrows of mice stimulated with Wnt 3a. Mice were intravenously injected with Wnt3a-CM or control CM and their bone marrows were examined 24 hours after for indicated notch ligand by immunohistochemistry. Shown are the representative images at indicated low and higher magnification (400) of the dotted insets. Arrows indicate positive staining (brown color, DAB) of each antibody in the endosteum of trabecule. Abbreviation: CM, conditioned medium. notch ligands and activation of notch signaling in HSCs. In support of this model, significant induction of the downstream notch signals, Hes-1 and deltex-1, was seen in the hematopoietic cells in contact with b-catenin-activated stroma, and the phenotypic change to these hematopoietic cells, higher maintenance of undifferentiation, was abrogated by inhibition of down-stream notch signals, indicating that the phenotype is dependent on the notch signal activation in HSCs. However, possible influence of c-secretase type ll inhibitor for signals other than notch signals should be also considered and in vivo effects of notch signals on the phenotypic or functional changes of HSCs should be explored. Similarly, at present, we can not completely rule out the possibility that other growth factors induced by b-catenin in the stroma were also involved in the cross-talk with HSCs, since growth factors such as Gas-6 [31], CXCL5 [32] and proliferin-2 [33] had been shown to maintain HSCs in the stroma-based culture. Further studies are necessary to elucidate the underlying signals involved in the cross-talk in the microenvironment. Of note, recent studies have shown that, in addition to endosteal niche, perisinusoidal vascular niche constitute another microenvironment for HSCs, since large part of phenotypically defined HSCs were shown to reside in the vicinity of MECA-32 þ sinusoidal cells in the bone marrow [49, 50]. Although the functional distinction between the endosteal and perisinusoidal niche remains unclear, subsets of human perisinusoidal stroma(cd45 MCAM/CD146 þ ) or cultured stromal cells could reconstitute both endosteal and perivascular niche [28, 51]. Interestingly, we observed similar b- catenin expression in the subset of perisinusoidal stroma and MCAM/CD146 þ cells in the perisinusoidal (MECA-32 þ ) region of murine bone marrows and (supporting information Fig. S7A, S7B). In addition, we observed that these perisinusoidal stromal cells (Lin CD45 CD31 CD146 þ ) also responded to in vitro and in vivo stimulation with Wnt 3a (supporting information Fig. S7C S7F). Therefore, it is possible that stromal targeting of Wnt-b-catenin signals in the bone marrow may include both the perisinusoidal and the endosteal compartments of the microenvironment. Further studies on the specific role of each niche for HSCs are necessary to better evaluate the biological effects of Wnt /b-catenin signals on the perisinusoidal and endosteal microenvironments.
10 Kim, Kang, Park et al Figure 7. Notch signal activation in the microenvironmental cross-talk with HSC. (A): Real-time polymerase chain reaction (PCR) confirmation of the indicated notch-related genes identified in the microarray-based screening. Shown are the relative expression levels of the indicated genes in b-catenin/stroma relative to the MPG/stroma calculated as described in Material and Methods (three experiments). (B): Activation of notch signals in cocultured hematopoietic cells. 5-Fluorouracil-treated bone marrow cells (5-FU BMCs) cocultured on each indicated stroma for 5 days were sorted for CD45 þ Lin Sca-1 þ cells and induction of the indicated genes was examined by real-time PCR. Shown are the expression levels in the coculture with b-catenin/stroma relative to the MPG/stroma with SEM obtained from three independent experiments. (C): Effect of notch signal inhibitor on the cocultured hematopoietic cells. 5-FU BMCs were cocultured on each indicated stroma for 5 days in the presence of c-secretase inhibitor ll (30 lm) or control solvent dimethyl sulfoxide. The cultures were then analyzed for LSK phenotype in the cocultured hematopoietic cells (CD45 þ ). Shown are the ratios of the total numbers of LSK cells in each culture relative to the initial input LSK cell numbers with an error bar indicating SEM (four experiments; *, p <.05). (D): Proposed model integrating the observations for Wnt/b-catenin effects on HSCs. Activation of b-catenin may exert a positive regulatory effect on HSCs through the stroma with notch activation, but cause a negative effect when directly stabilized in HSCs (models 1 and 2). Glycogen synthase kinase 3b (GSK 3b) inhibitor administered in vivo may cause both a positive effect on stroma and a negative effect on HSC, thereby causing a mixed phenotype (model 3). Similarly, mice with conditional accumulation of b-catenin may display the results of both a positive effect on stroma during stromal contact in the trabecule (expansion of LSK) and a negative effect on HSCs when contact is lost in the marrow (loss of HSCs) (model 4). Abbreviations: HSCs, hematopoietic stem cells; LSK, Lin Sca- 1 þ c-kit þ ; MPG, murine stem cell virus vector (MSCV) expressing green fluorescent protein (GFP) under the phosphoglycerate kinase (PGK) promoter (MSCV-PGK-GFP). Of note, our results demonstrating distinct biological effects for stroma-mediated Wnt/b-catenin signals may allow the integration of findings from previous studies (schematic illustration in Fig. 7D). For example, the different effects observed following administration of GSK 3b in vivo and those observed in mice with conditional in vivo stabilization of b-catenin may reflect both positive regulatory effects on HSCs through the stroma and negative effects on HSCs from direct b-catenin stabilization. However, the effect of b-catenin disruption in the microenvironment, unfortunately, could not be determined since mice die within 23 days of induction [10], whereas the effect on HSCs resulted contrasting level of competitive repopulation of HSCs depending on the study model [10, 52]. Further studies are needed to evaluate both the autonomous and paracrine actions of Wnt/b-catenin signals in the hematopoietic microenvironment. Importantly, our findings on the stroma-mediated effect of Wnt/b-catenin signals on HSCs provide new insight on the significance of the microenvironment as a mediator of regulatory signals for HSCs. Therefore, the stem cell niche may be an attractive target for stem cell manipulation as inferred from recent success in HSC expansion and mobilization by using a hormone, parathyroid hormone, that selectively target stroma [53] Further studies are also warranted to study the role of the microenvironment in various disease conditions. SUMMARY In summary, our findings provide new insight on a mode of Wnt-b-catenin signaling that is mediated by stroma and the
Hematopoiesis. - Process of generation of mature blood cells. - Daily turnover of blood cells (70 kg human)
Hematopoiesis - Process of generation of mature blood cells - Daily turnover of blood cells (70 kg human) 1,000,000,000,000 total cells 200,000,000,000 red blood cells 70,000,000,000 neutrophils Hematopoiesis
More informationMeeting Report. From December 8 to 11, 2012 at Atlanta, GA, U.S.A
Meeting Report Affiliation Department of Transfusion Medicine and Cell Therapy Name Hisayuki Yao Name of the meeting Period and venue Type of your presentation Title of your presentation The 54 th Annual
More informationNature Immunology: doi: /ni Supplementary Figure 1. Huwe1 has high expression in HSCs and is necessary for quiescence.
Supplementary Figure 1 Huwe1 has high expression in HSCs and is necessary for quiescence. (a) Heat map visualizing expression of genes with a known function in ubiquitin-mediated proteolysis (KEGG: Ubiquitin
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION Pleiotrophin Regulates the Expansion and Regeneration of Hematopoietic Stem Cells Heather A Himburg 1, Garrett G Muramoto 1 *, Pamela Daher 1*, Sarah K Meadows 1, J. Lauren Russell
More informationHaematopoietic stem cells
Haematopoietic stem cells Neil P. Rodrigues, DPhil NIH Centre for Biomedical Research Excellence in Stem Cell Biology Boston University School of Medicine neil.rodrigues@imm.ox.ac.uk Haematopoiesis: An
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature11095 Supplementary Table 1. Summary of the binding between Angptls and various Igdomain containing receptors as determined by flow cytometry analysis. The results were summarized from
More informationSupplemental Experimental Procedures
Cell Stem Cell, Volume 2 Supplemental Data A Temporal Switch from Notch to Wnt Signaling in Muscle Stem Cells Is Necessary for Normal Adult Myogenesis Andrew S. Brack, Irina M. Conboy, Michael J. Conboy,
More informationMATERIALS AND METHODS. Neutralizing antibodies specific to mouse Dll1, Dll4, J1 and J2 were prepared as described. 1,2 All
MATERIALS AND METHODS Antibodies (Abs), flow cytometry analysis and cell lines Neutralizing antibodies specific to mouse Dll1, Dll4, J1 and J2 were prepared as described. 1,2 All other antibodies used
More informationsequences of a styx mutant reveals a T to A transversion in the donor splice site of intron 5
sfigure 1 Styx mutant mice recapitulate the phenotype of SHIP -/- mice. (A) Analysis of the genomic sequences of a styx mutant reveals a T to A transversion in the donor splice site of intron 5 (GTAAC
More informationSUPPLEMENTARY INFORMATION
a. Smo+/+ b. Smo+/+ 5.63 5.48 c. Lin- d. e. 6 5 4 3 Ter119 Mac B T Sca1 Smo+/+ 25 15 2 o BMT 2 1 5 * Supplementary Figure 1: Deletion of Smoothened does not alter the frequency of hematopoietic lineages
More informationCD34+ Cells: A Comparison of Stem and Progenitor Cells in Cord Blood, Peripheral Blood, and the Bone Marrow
White Paper September 2016 CD34+ Cells: A Comparison of Stem and Progenitor Cells in Cord Blood, Peripheral Blood, and the Bone Marrow Lily C. Trajman, PhD Introduction: Hematopoietic Stem Cells (HSCs)
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature12215 Supplementary Figure 1. The effects of full and dissociated GR agonists in supporting BFU-E self-renewal divisions. BFU-Es were cultured in self-renewal medium with indicated GR
More informationSupplemental figure 1. PDGFRα is expressed dominantly by stromal cells surrounding mammary ducts and alveoli. A) IHC staining of PDGFRα in
Supplemental figure 1. PDGFRα is expressed dominantly by stromal cells surrounding mammary ducts and alveoli. A) IHC staining of PDGFRα in nulliparous (left panel) and InvD6 mouse mammary glands (right
More informationVEGFR2-Mediated Vascular Dilation as a Mechanism of VEGF-Induced Anemia and Bone Marrow Cell Mobilization
Cell Reports, Volume 9 Supplemental Information VEGFR2-Mediated Vascular Dilation as a Mechanism of VEGF-Induced Anemia and Bone Marrow Cell Mobilization Sharon Lim, Yin Zhang, Danfang Zhang, Fang Chen,
More informationSupplementary Figure 1. Successful excision of genes from WBM lysates and
Supplementary Information: Supplementary Figure 1. Successful excision of genes from WBM lysates and survival of mice with different genotypes. (a) The proper excision of Pten, p110α, p110α and p110δ was
More informationCell signalling pathways in the HSC niche. Dr. Abdullah Aljedai
Cell signalling pathways in the HSC niche Dr. Abdullah Aljedai 31-10-2009 Learning objectives & resources 1- To introduce the concept of cell signaling process in the haemopoietic system. 2- To outline
More informationChronic variable stress activates hematopoietic stem cells
SUPPLEMENTARY INFORMATION Chronic variable stress activates hematopoietic stem cells Timo Heidt *, Hendrik B. Sager *, Gabriel Courties, Partha Dutta, Yoshiko Iwamoto, Alex Zaltsman, Constantin von zur
More informationThe Role of Rac Signaling in The Perivascular Niche
The Role of Rac Signaling in The Perivascular Niche Felicia Ciuculescu Diaspora and Higher Education and Research Perspectives in Personalized Medicine- from Concept to Clinical Application Center for
More informationBCR-ABL - LSK BCR-ABL + LKS - (%)
Marker Clone BCR-ABL + LSK (%) BCR-ABL + LKS - (%) BCR-ABL - LSK (%) P value vs. BCR-ABL + LKS - P value vs. BCR-ABL - LSK CD2 RM2-5 12.9 ± 3.6 36.7 ± 6.5 19.3 ± 2.4 0.01 0.10 CD5 53-7.3 13.9 ± 3.2 20.8
More informationNature Immunology: doi: /ni.3412
Supplementary Figure 1 Gata1 expression in heamatopoietic stem and progenitor populations. (a) Unsupervised clustering according to 100 top variable genes across single pre-gm cells. The two main cell
More informationSuppl Video: Tumor cells (green) and monocytes (white) are seeded on a confluent endothelial
Supplementary Information Häuselmann et al. Monocyte induction of E-selectin-mediated endothelial activation releases VE-cadherin junctions to promote tumor cell extravasation in the metastasis cascade
More informationX P. Supplementary Figure 1. Nature Medicine: doi: /nm Nilotinib LSK LT-HSC. Cytoplasm. Cytoplasm. Nucleus. Nucleus
a b c Supplementary Figure 1 c-kit-apc-eflu780 Lin-FITC Flt3-Linc-Kit-APC-eflu780 LSK Sca-1-PE-Cy7 d e f CD48-APC LT-HSC CD150-PerCP-cy5.5 g h i j Cytoplasm RCC1 X Exp 5 mir 126 SPRED1 SPRED1 RAN P SPRED1
More informationIslet viability assay and Glucose Stimulated Insulin Secretion assay RT-PCR and Western Blot
Islet viability assay and Glucose Stimulated Insulin Secretion assay Islet cell viability was determined by colorimetric (3-(4,5-dimethylthiazol-2-yl)-2,5- diphenyltetrazolium bromide assay using CellTiter
More informationSUPPLEMENTARY INFORMATION doi: /nature12026
doi:1.138/nature1226 a 4 35 3 MCSF level (pg/ml) 25 2 15 1 5 1h3 3h 5h 7h 15h 24h b MPP (CD135 KSL) HSC (CD34 CD15 KSLF) c % 4 ** LPS 3 GFP pos cells 2 PU.1 GFP LPS 1 FSCA Ctl NI 24h LPS Sup.Fig.1 Effect
More informationSupplementary Figure S1. Flow cytometric analysis of the expression of Thy1 in NH cells. Flow cytometric analysis of the expression of T1/ST2 and
Supplementary Figure S1. Flow cytometric analysis of the expression of Thy1 in NH cells. Flow cytometric analysis of the expression of T1/ST2 and Thy1 in NH cells derived from the lungs of naïve mice.
More informationSupplementary Figure 1. Generation of knockin mice expressing L-selectinN138G. (a) Schematics of the Sellg allele (top), the targeting vector, the
Supplementary Figure 1. Generation of knockin mice expressing L-selectinN138G. (a) Schematics of the Sellg allele (top), the targeting vector, the targeted allele in ES cells, and the mutant allele in
More informationPBMC from each patient were suspended in AIM V medium (Invitrogen) with 5% human
Anti-CD19-CAR transduced T-cell preparation PBMC from each patient were suspended in AIM V medium (Invitrogen) with 5% human AB serum (Gemini) and 300 international units/ml IL-2 (Novartis). T cell proliferation
More informationSupplementary data Supplementary Figure 1 Supplementary Figure 2
Supplementary data Supplementary Figure 1 SPHK1 sirna increases RANKL-induced osteoclastogenesis in RAW264.7 cell culture. (A) RAW264.7 cells were transfected with oligocassettes containing SPHK1 sirna
More informationstem cell products Basement Membrane Matrix Products Rat Mesenchymal Stem Cell Growth and Differentiation Products
stem cell products Basement Membrane Matrix Products Rat Mesenchymal Stem Cell Growth and Differentiation Products Stem Cell Qualified Extracellular Matrix Proteins Stem cell research requires the finest
More informationB6.SJL (Ly5.2) mice were obtained from Taconic Farms. Rag1-deficient mice were
Supplementary Methods Mice. B6.SJL (Ly5.2) mice were obtained from Taconic Farms. Rag1-deficient mice were purchased from The Jackson Laboratory. Real-time PCR Total cellular RNA was extracted from the
More informationFigure S1. Generation of inducible PTEN deficient mice and the BMMCs (A) B6.129 Pten loxp/loxp mice were mated with B6.
Figure S1. Generation of inducible PTEN deficient mice and the BMMCs (A) B6.129 Pten loxp/loxp mice were mated with B6.129-Gt(ROSA)26Sor tm1(cre/ert2)tyj /J mice. To induce deletion of the Pten locus,
More informationFig. S1. Upregulation of K18 and K14 mrna levels during ectoderm specification of hescs. Quantitative real-time PCR analysis of mrna levels of OCT4
Fig. S1. Upregulation of K18 and K14 mrna levels during ectoderm specification of hescs. Quantitative real-time PCR analysis of mrna levels of OCT4 (n=3 independent differentiation experiments for each
More informationactivation with anti-cd3/cd28 beads and 3d following transduction. Supplemental Figure 2 shows
Supplemental Data Supplemental Figure 1 compares CXCR4 expression in untreated CD8 + T cells, following activation with anti-cd3/cd28 beads and 3d following transduction. Supplemental Figure 2 shows the
More informationEosinophils are required. for the maintenance of plasma cells in the bone marrow
Eosinophils are required for the maintenance of plasma cells in the bone marrow Van Trung Chu, Anja Fröhlich, Gudrun Steinhauser, Tobias Scheel, Toralf Roch, Simon Fillatreau, James J. Lee, Max Löhning
More informationSupplementary Figure 1: Hsp60 / IEC mice are embryonically lethal (A) Light microscopic pictures show mouse embryos at developmental stage E12.
Supplementary Figure 1: Hsp60 / IEC mice are embryonically lethal (A) Light microscopic pictures show mouse embryos at developmental stage E12.5 and E13.5 prepared from uteri of dams and subsequently genotyped.
More informationEffective activity of cytokine-induced killer cells against autologous metastatic melanoma including cells with stemness features
Effective activity of cytokine-induced killer cells against autologous metastatic melanoma including cells with stemness features Loretta Gammaitoni, Lidia Giraudo, Valeria Leuci, et al. Clin Cancer Res
More informationSUPPLEMENTARY INFORMATION
Complete but curtailed T-cell response to very-low-affinity antigen Dietmar Zehn, Sarah Y. Lee & Michael J. Bevan Supp. Fig. 1: TCR chain usage among endogenous K b /Ova reactive T cells. C57BL/6 mice
More informationPrimary Cilia are Expressed on a Small Fraction of Cells in Trabecular Bone and Marrow
Primary Cilia are Expressed on a Small Fraction of Cells in Trabecular Bone and Marrow Thomas R. Coughlin 1, Muriel Voisin, Ph.D. 2, Glen L. Niebur, PhD 1, Laoise M. McNamara 2. 1 University of Notre Dame,
More informationSupplementary Figure 1 Role of Raf-1 in TLR2-Dectin-1-mediated cytokine expression
Supplementary Figure 1 Supplementary Figure 1 Role of Raf-1 in TLR2-Dectin-1-mediated cytokine expression. Quantitative real-time PCR of indicated mrnas in DCs stimulated with TLR2-Dectin-1 agonist zymosan
More informationSupplemental Data. Wnt/β-Catenin Signaling in Mesenchymal Progenitors. Controls Osteoblast and Chondrocyte
Supplemental Data Wnt/β-Catenin Signaling in Mesenchymal Progenitors Controls Osteoblast and Chondrocyte Differentiation during Vertebrate Skeletogenesis Timothy F. Day, Xizhi Guo, Lisa Garrett-Beal, and
More informationSupplementary Figures
Supplementary Figures Supplementary Figure 1 Characterization of stable expression of GlucB and sshbira in the CT26 cell line (a) Live cell imaging of stable CT26 cells expressing green fluorescent protein
More informationGetting to the root of Cancer
Cancer Stem Cells: Getting to the root of Cancer Dominique Bonnet, Ph.D Senior Group Leader, Haematopoietic Stem Cell Laboratory Cancer Research UK, London Research Institute Venice, Sept 2009 Overview
More informationSUPPLEMENTARY METHODS
SUPPLEMENTARY METHODS Histological analysis. Colonic tissues were collected from 5 parts of the middle colon on day 7 after the start of DSS treatment, and then were cut into segments, fixed with 4% paraformaldehyde,
More informationSupplementary Figure 1. Characterization of ALDH-positive cell population in MCF-7 cells. (a) Expression level of stem cell markers in MCF-7 cells or
Supplementary Figure 1. Characterization of ALDH-positive cell population in MCF-7 cells. (a) Expression level of stem cell markers in MCF-7 cells or ALDH-positive cell population by qpcr. Data represent
More informationTISSUE-SPECIFIC STEM CELLS
TISSUE-SPECIFIC STEM CELLS Inhibition of Aldehyde Dehydrogenase Expands Hematopoietic Stem Cells with Radioprotective Capacity GARRETT G. MURAMOTO, a J. LAUREN RUSSELL, a RACHID SAFI, b ALICE B. SALTER,
More information(a) Significant biological processes (upper panel) and disease biomarkers (lower panel)
Supplementary Figure 1. Functional enrichment analyses of secretomic proteins. (a) Significant biological processes (upper panel) and disease biomarkers (lower panel) 2 involved by hrab37-mediated secretory
More informationEML Erythroid and Neutrophil Differentiation Protocols Cristina Pina 1*, Cristina Fugazza 2 and Tariq Enver 3
EML Erythroid and Neutrophil Differentiation Protocols Cristina Pina 1*, Cristina Fugazza 2 and Tariq Enver 3 1 Department of Haematology, University of Cambridge, Cambridge, UK; 2 Dipartimento de Biotecnologie
More informationTISSUE-SPECIFIC STEM CELLS
TISSUE-SPECIFIC STEM CELLS Concise Review: Multiple Niches for Hematopoietic Stem Cell Regulations IL-HOAN OH, a,b KYUNG-RIM KWON a,b a The Catholic High-Performance Cell Therapy Center, Division of Regenerative
More informationSUPPLEMENTARY INFORMATION
DOI:.38/ncb3399 a b c d FSP DAPI 5mm mm 5mm 5mm e Correspond to melanoma in-situ Figure a DCT FSP- f MITF mm mm MlanaA melanoma in-situ DCT 5mm FSP- mm mm mm mm mm g melanoma in-situ MITF MlanaA mm mm
More informationSupplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells
Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells (b). TRIM33 was immunoprecipitated, and the amount of
More informationImpaired DNA replication within progenitor cell pools promotes leukemogenesis
Impaired DNA replication within progenitor cell pools promotes leukemogenesis Ganna Bilousova, University of Colorado Andriy Marusyk, University of Colorado Christopher Porter, Emory University Robert
More informationSupplementary Figure 1: Neuregulin 1 increases the growth of mammary organoids compared to EGF. (a) Mammary epithelial cells were freshly isolated,
1 2 3 4 5 6 7 8 9 10 Supplementary Figure 1: Neuregulin 1 increases the growth of mammary organoids compared to EGF. (a) Mammary epithelial cells were freshly isolated, embedded in matrigel and exposed
More informationEffective Targeting of Quiescent Chronic Myelogenous
Cancer Cell, Volume 7 Supplemental Information Effective Targeting of Quiescent Chronic Myelogenous Leukemia Stem Cells by Histone Deacetylase Inhibitors in Combination with Imatinib Mesylate Bin Zhang,
More informationGeneral Laboratory methods Plasma analysis: Gene Expression Analysis: Immunoblot analysis: Immunohistochemistry:
General Laboratory methods Plasma analysis: Plasma insulin (Mercodia, Sweden), leptin (duoset, R&D Systems Europe, Abingdon, United Kingdom), IL-6, TNFα and adiponectin levels (Quantikine kits, R&D Systems
More informationCellular Physiology and Biochemistry
Original Paper 2015 The Author(s). 2015 Published The Author(s) by S. Karger AG, Basel Published online: November 27, 2015 www.karger.com/cpb Published by S. Karger AG, Basel 2194 1421-9778/15/0376-2194$39.50/0
More informationStem cells are undifferentiated cells which are maintained within a specific niche. A stem cell
Abstract Stem cells are undifferentiated cells which are maintained within a specific niche. A stem cell niche is a microenvironment of cells that maintain stem cell functionality, and one example is the
More informationDISCOVERING ATCC IMMUNOLOGICAL CELLS - MODEL SYSTEMS TO STUDY THE IMMUNE AND CARDIOVASCULAR SYSTEMS
DISCOVERING ATCC IMMUNOLOGICAL CELLS - MODEL SYSTEMS TO STUDY THE IMMUNE AND CARDIOVASCULAR SYSTEMS James Clinton, Ph.D. Scientist, ATCC February 19, 2015 About ATCC Founded in 1925, ATCC is a non-profit
More informationCell isolation. Spleen and lymph nodes (axillary, inguinal) were removed from mice
Supplementary Methods: Cell isolation. Spleen and lymph nodes (axillary, inguinal) were removed from mice and gently meshed in DMEM containing 10% FBS to prepare for single cell suspensions. CD4 + CD25
More informationHighly Efficient CRISPR/Cas9 Gene Editing and Long-Term Engraftment of Human Hematopoietic Stem and Progenitor Cells
Highly Efficient CRISPR/Cas9 Gene Editing and Long-Term Engraftment of Human Hematopoietic Stem and Progenitor Cells J. M. Heath, A. Chalishazar, C.S. Lee, W. Selleck, C. Cotta-Ramusino, D. Bumcrot, J.L.
More informationNature Immunology: doi: /ni Supplementary Figure 1. Cellularity of leukocytes and their progenitors in naive wild-type and Spp1 / mice.
Supplementary Figure 1 Cellularity of leukocytes and their progenitors in naive wild-type and Spp1 / mice. (a, b) Gating strategies for differentiated cells including PMN (CD11b + Ly6G hi and CD11b + Ly6G
More informationGeneration of ST2-GFP reporter mice and characterization of ILC1 cells following infection
Supplementary Figure 1 Generation of ST2-GFP reporter mice and characterization of ILC1 cells following infection with influenza virus. (a) ST2-GFP reporter mice were generated as described in Methods.
More informationSupplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation.
Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation. (a) Embryonic fibroblasts isolated from wildtype (WT), BRAF -/-, or CRAF -/- mice were irradiated (6 Gy) and DNA damage
More informationScientific report: Delineating cellular stages and regulation of human NK cell development to improve NK cell-based therapy for cancer (Dnr )
Scientific report: Delineating cellular stages and regulation of human NK cell development to improve NK cell-based therapy for cancer (Dnr 130259) The main goal of this project focuses on establishing
More informationSupplementary Table; Supplementary Figures and legends S1-S21; Supplementary Materials and Methods
Silva et al. PTEN posttranslational inactivation and hyperactivation of the PI3K/Akt pathway sustain primary T cell leukemia viability Supplementary Table; Supplementary Figures and legends S1-S21; Supplementary
More informationIKK-dependent activation of NF-κB contributes to myeloid and lymphoid leukemogenesis by BCR-ABL1
Supplemental Figures BLOOD/2014/547943 IKK-dependent activation of NF-κB contributes to myeloid and lymphoid leukemogenesis by BCR-ABL1 Hsieh M-Y and Van Etten RA Supplemental Figure S1. Titers of retroviral
More informationMBios 401/501: Lecture 12.1 Signaling IV. Slide 1
MBios 401/501: Lecture 12.1 Signaling IV Slide 1 Pathways that require regulated proteolysis 1. Notch and Delta 2. Wnt/ b-catenin 3. Hedgehog 4. NFk-B Our last topic on cell signaling are pathways that
More informationLIST OF ORGANS FOR HISTOPATHOLOGICAL ANALYSIS:!! Neural!!!!!!Respiratory:! Brain : Cerebrum,!!! Lungs and trachea! Olfactory, Cerebellum!!!!Other:!
LIST OF ORGANS FOR HISTOPATHOLOGICAL ANALYSIS:!! Neural!!!!!!Respiratory:! Brain : Cerebrum,!!! Lungs and trachea! Olfactory, Cerebellum!!!!Other:! Spinal cord and peripheral nerves! Eyes, Inner ear, nasal
More informationProtection against doxorubicin-induced myocardial dysfunction in mice by cardiac-specific expression of carboxyl terminus of hsp70-interacting protein
Protection against doxorubicin-induced myocardial dysfunction in mice by cardiac-specific expression of carboxyl terminus of hsp70-interacting protein Lei Wang 1, Tian-Peng Zhang 1, Yuan Zhang 2, Hai-Lian
More informationSupplement Material. Spleen weight (mg) LN cells (X106) Acat1-/- Acat1-/- Mouse weight (g)
Supplement Material A Spleen weight (mg) C Mouse weight (g) 1 5 1 2 9 6 3 2 5 2 1 5 Male LN cells (X16) 4 ** ** Female B 3 2 1 Supplemental Figure I. Spleen weight (A), Inguinal lymph node (LN) cell number
More informationQuantitative PPARγ expression affects the balance between tolerance and immunity
Quantitative PPARγ expression affects the balance between tolerance and immunity Ya-Hui Liu 1, Yau-Sheng Tsai 1,2,3, Shih-Chieh Lin 4, Nan-Shih Liao 5, Ming-Shiou Jan 6, Chung-Tiang Liang 7, Shih-Wen Hsu
More informationHuman chronic myeloid leukemia stem cells are insensitive to imatinib despite inhibition of BCR-ABL activity
Research article Related Commentary, page 22 Human chronic myeloid leukemia stem cells are insensitive to imatinib despite inhibition of BCR-ABL activity Amie S. Corbin, 1,2 Anupriya Agarwal, 1 Marc Loriaux,
More informationHEK293FT cells were transiently transfected with reporters, N3-ICD construct and
Supplementary Information Luciferase reporter assay HEK293FT cells were transiently transfected with reporters, N3-ICD construct and increased amounts of wild type or kinase inactive EGFR. Transfections
More informationNeutrophils contribute to fracture healing by synthesizing fibronectin+ extracellular matrix rapidly after injury
Neutrophils contribute to fracture healing by synthesizing fibronectin+ extracellular matrix rapidly after injury Bastian OW, Koenderman L, Alblas J, Leenen LPH, Blokhuis TJ. Neutrophils contribute to
More informationIn vitro bactericidal assay Fig. S8 Gentamicin protection assay Phagocytosis assay
In vitro bactericidal assay Mouse bone marrow was isolated from the femur and the tibia. Cells were suspended in phosphate buffered saline containing.5% BSA and 2 mm EDTA and filtered through a cell strainer.
More informationwell for 2 h at rt. Each dot represents an individual mouse and bar is the mean ±
Supplementary data: Control DC Blimp-1 ko DC 8 6 4 2-2 IL-1β p=.5 medium 8 6 4 2 IL-2 Medium p=.16 8 6 4 2 IL-6 medium p=.3 5 4 3 2 1-1 medium IL-1 n.s. 25 2 15 1 5 IL-12(p7) p=.15 5 IFNγ p=.65 4 3 2 1
More informationPathologic Stage. Lymph node Stage
ASC ASC a c Patient ID BMI Age Gleason score Non-obese PBMC 1 22.1 81 6 (3+3) PBMC 2 21.9 6 6 (3+3) PBMC 3 22 84 8 (4+4) PBMC 4 24.6 68 7 (3+4) PBMC 24. 6 (3+3) PBMC 6 24.7 73 7 (3+4) PBMC 7 23. 67 7 (3+4)
More informationStem cells: units of development and regeneration. Fernando D. Camargo Ph.D. Whitehead Fellow Whitehead Institute for Biomedical Research.
Stem cells: units of development and regeneration Fernando D. Camargo Ph.D. Whitehead Fellow Whitehead Institute for Biomedical Research Concepts 1. Embryonic vs. adult stem cells 2. Hematopoietic stem
More information(A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and a
Supplementary figure legends Supplementary Figure 1. Expression of Shh signaling components in a panel of gastric cancer. (A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and
More information(A) PCR primers (arrows) designed to distinguish wild type (P1+P2), targeted (P1+P2) and excised (P1+P3)14-
1 Supplemental Figure Legends Figure S1. Mammary tumors of ErbB2 KI mice with 14-3-3σ ablation have elevated ErbB2 transcript levels and cell proliferation (A) PCR primers (arrows) designed to distinguish
More informationMolecular Cell Biology - Problem Drill 19: Cell Signaling Pathways and Gene Expression
Molecular Cell Biology - Problem Drill 19: Cell Signaling Pathways and Gene Expression Question No. 1 of 10 1. Which statement about cell signaling is correct? Question #1 (A) Cell signaling involves receiving
More informationEarly cell death (FGF) B No RunX transcription factor produced Yes No differentiation
Solution Key - Practice Questions Question 1 a) A recent publication has shown that the fat stem cells (FSC) can act as bone stem cells to repair cavities in the skull, when transplanted into immuno-compromised
More informationThe Regulation of Bone Formation by the Met-5-enkephalin-Opioid Growth Factor Receptor Signaling Axis
The Regulation of Bone Formation by the Met-5-enkephalin-Opioid Growth Factor Receptor Signaling Axis Nikhil Thakur, MD, Sean D. DeBoyace, BS, Bryan S. Margulies, PhD. SUNY Upstate Medical University,
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/2/1/ra81/dc1 Supplementary Materials for Delivery of MicroRNA-126 by Apoptotic Bodies Induces CXCL12- Dependent Vascular Protection Alma Zernecke,* Kiril Bidzhekov,
More informationSupplemental Figure 1. Intracranial transduction of a modified ptomo lentiviral vector in the mouse
Supplemental figure legends Supplemental Figure 1. Intracranial transduction of a modified ptomo lentiviral vector in the mouse hippocampus targets GFAP-positive but not NeuN-positive cells. (A) Stereotaxic
More informationAnti-ceramide Antibody Prevents the Radiation GI Syndrome in Mice
Anti-ceramide Antibody Prevents the Radiation GI Syndrome in Mice Jimmy A. Rotolo 1, Branka Stancevic 1, Jianjun Zhang 1, Guoqiang Hua 1, John Fuller 1, Xianglei Yin 1, Adriana Haimovitz-Friedman 2, Kisu
More informationSupplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the
Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the genome-wide methylation microarray data. Mean ± s.d.; Student
More informationCanberra, Australia). CD11c-DTR-OVA-GFP (B6.CD11c-OVA), B6.luc + and. Cancer Research Center, Germany). B6 or BALB/c.FoxP3-DTR-GFP mice were
Supplemental Materials and Methods Mice Female C57BL/6 (B6, I-E null, H-2 b ), BALB/c (H-2 d ) + ), FVB/N (H-2 q, I-E null, CD45.1 + ), and B6D2F1 (H-2 b/d ) mice were purchased from the Animal Resources
More informationSupplemental Figure 1. Signature gene expression in in vitro differentiated Th0, Th1, Th2, Th17 and Treg cells. (A) Naïve CD4 + T cells were cultured
Supplemental Figure 1. Signature gene expression in in vitro differentiated Th0, Th1, Th2, Th17 and Treg cells. (A) Naïve CD4 + T cells were cultured under Th0, Th1, Th2, Th17, and Treg conditions. mrna
More informationSupplementary Material
Supplementary Material Taghon, Yui, and Rothenberg: Mast cell diversion of T-lineage precursor cells by the essential T-lineage transcription factor GATA Supplemental Table Supplemental Figures 1-6 Supplemental
More informationThe nucleotide sugar UDP-glucose mobilizes long-term repopulating primitive hematopoietic cells
Research article The nucleotide sugar UDP-glucose mobilizes long-term repopulating primitive hematopoietic cells Sungho Kook, 1 Joonseok Cho, 1 Sean Bong Lee, 2 and Byeong-Chel Lee 1 1 University of Pittsburgh
More informationSUPPLEMENTARY INFORMATION
Supplemental Figure 1. Furin is efficiently deleted in CD4 + and CD8 + T cells. a, Western blot for furin and actin proteins in CD4cre-fur f/f and fur f/f Th1 cells. Wild-type and furin-deficient CD4 +
More informationInteractions between cancer stem cells and their niche govern metastatic colonization
Correction Interactions between cancer stem cells and their niche govern metastatic colonization Ilaria Malanchi, Albert Santamaria-Martínez, Evelyn Susanto, Hong Peng, Hans-Anton Lehr, Jean-Francois Delaloye
More informationSUPPLEMENTARY INFORMATION
b 350 300 250 200 150 100 50 0 E0 E10 E50 E0 E10 E50 E0 E10 E50 E0 E10 E50 Number of organoids per well 350 300 250 200 150 100 50 0 R0 R50 R100 R500 1st 2nd 3rd Noggin 100 ng/ml Noggin 10 ng/ml Noggin
More informationSupplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 )
770 771 Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 ) Human CXCL1 GCGCCCAAACCGAAGTCATA ATGGGGGATGCAGGATTGAG PF4 CCCCACTGCCCAACTGATAG TTCTTGTACAGCGGGGCTTG
More informationCYTOKINE RECEPTORS AND SIGNAL TRANSDUCTION
CYTOKINE RECEPTORS AND SIGNAL TRANSDUCTION What is Cytokine? Secreted popypeptide (protein) involved in cell-to-cell signaling. Acts in paracrine or autocrine fashion through specific cellular receptors.
More informationEnzyme-coupled Receptors. Cell-surface receptors 1. Ion-channel-coupled receptors 2. G-protein-coupled receptors 3. Enzyme-coupled receptors
Enzyme-coupled Receptors Cell-surface receptors 1. Ion-channel-coupled receptors 2. G-protein-coupled receptors 3. Enzyme-coupled receptors Cell-surface receptors allow a flow of ions across the plasma
More informationSupplemental Information. Tissue Myeloid Progenitors Differentiate. into Pericytes through TGF-b Signaling. in Developing Skin Vasculature
Cell Reports, Volume 18 Supplemental Information Tissue Myeloid Progenitors Differentiate into Pericytes through TGF-b Signaling in Developing Skin Vasculature Tomoko Yamazaki, Ani Nalbandian, Yutaka Uchida,
More informationDISCLOSURE. I have the following financial relationships:
DISCLOSURE I have the following financial relationships: Consultant for: Fate Therapeutics, GlaxoSmithKline, Bone Therapeutics, G1 Therapeutics Contracted Research for: GlaxoSmithKline Royalties from:
More informationType of file: PDF Size of file: 0 KB Title of file for HTML: Supplementary Information Description: Supplementary Figures
Type of file: PDF Size of file: 0 KB Title of file for HTML: Supplementary Information Description: Supplementary Figures Supplementary Figure 1 mir-128-3p is highly expressed in chemoresistant, metastatic
More informationConstruction of a hepatocellular carcinoma cell line that stably expresses stathmin with a Ser25 phosphorylation site mutation
Construction of a hepatocellular carcinoma cell line that stably expresses stathmin with a Ser25 phosphorylation site mutation J. Du 1, Z.H. Tao 2, J. Li 2, Y.K. Liu 3 and L. Gan 2 1 Department of Chemistry,
More information