Effects of thalidomide on angiogenesis and tumor growth and metastasis of human hepatocellular carcinoma in nude mice

Transcription

1 PO Box 2345, Beijing , Chin World J Gstroenterol 2005;11(2): Fx: World Journl of Gstroenterology ISSN E-mil: wjg@wjgnet.com ELSEVIER 2005 The WJG Press nd Elsevier Inc. All rights reserved. LIVER CANCER Effects of thlidomide on ngiogenesis nd tumor growth nd metstsis of humn heptocellulr crcinom in nude mice Zhong-Lin Zhng, Zhi-Su Liu, Qun Sun Zhong-Lin Zhng, Zhi-Su Liu, Qun Sun, Deprtment of Generl Surgery, Zhongnn Hospitl, Wuhn University, Wuhn , Hubei Province, Chin Correspondence to: Professor Zhi-Su Liu, Deprtment of Generl Surgery, Zhongnn Hospitl, Wuhn University, Wuhn , Hubei Province, Chin. zhngzhonglin221@sin.com Telephone: Fx: Received: Accepted: Abstrct AIM: To investigte the effects of thlidomide on ngiogenesis, tumor growth nd metstsis of heptocellulr crcinom in nude mice. METHODS: Twenty-four nude mice were rndomly divided into therpy group nd control group, 12 mice in ech group. Thlidomide dissolved in 0.5% sodium crboxyl methyl cellulose (CMC) suspension ws dministered intrperitonelly once dy t the dose of 200 mg/kg in therpy group, nd n equivlent volume of 0.5% CMC in control group. Mice were scrificed on the 30 th d, tumor size nd weight nd metstses in liver nd lungs were mesured. CD34 nd VEGF mrna in tumor tissue were detected by immunohistochemistry nd semi-quntittive RT-PCR respectively nd microvessel density (MVD) ws counted. Serum concentrtions of TNF-α nd ALT nd AFP were lso tested. RESULTS: MVD nd VEGF mrna in therpy group were less thn those in control group (31.08±16.23 vessels/hp vs 80.00±26.27 vessels/hp, ± vs ±0.1297, respectively, P<0.05). No sttisticl difference ws observed in tumor size nd weight nd metstses in liver nd lungs. TNF-α ws significntly lower in therpy group thn in control group (28.64±4.64 ng/l vs 42.69±6.99 ng/l, P<0.05). No sttisticl difference in ALT nd AFP ws observed between groups. CONCLUSION: Thlidomide cn significntly inhibit ngiogenesis nd metstsis of heptocellulr crcinom. It lso hs inhibitory effects on circulting TNF-α The WJG Press nd Elsevier Inc. All rights reserved. Key words: Heptocellulr crcinom; Thlidomide; Angiogenesis; Neoplsm metstsis Zhng ZL, Liu ZS, Sun Q. Effects of thlidomide on ngiogenesis nd tumor growth nd metstsis of humn heptocellulr crcinom in nude mice. World J Gstroenterol 2005; 11(2): INTRODUCTION Mlignnt tumor s growth, invsion nd metstsis depend on the process of ngiogenesis [1,2], oblitertion of the feeding vessels to tumor could cuse its shrinkge or deth [3]. As result, ntingiogenic therpy hs become hotspot in the field of tumor tretment. Heptocellulr crcinom (HCC) is the fourth most common cuse of cncer deth, nd ccounts for 53% of ll liver cncer deths in Chin [4]. Poor prognosis of heptocellulr crcinoms is minly due to its high recurrence nd metstsis. HCC lso kind of typicl hypervsculr mlignnt tumor, for which ntingiogenic therpy is prticulrly promising. It hs been found in recent reserch tht thlidomide, hving been removed from medicl mrkets for its severe side effects of tertogenesis, hs ntingiogenic effects [5]. Thlidomide first entered medicl cre mrkets s non-brbitl sedtive with remrkble nti-emetic effects on nuse of first-trimester morning sickness in pregnnt women. Unprecedented epidemic of bbies birth defects in lte 1950s nd erly 1960s ws due to its serious potentil side effects of tertogenicity, nd then the drug hs been prohibited nd removed from mrkets since But reserch on this gent hs never stopped nd in 1994 D A mto et l. [5] firstly reported it could remrkbly reduce neovsculriztion in rbbit cornes fter stimultion by bsic fibroblst growth fctor (bfgf), nd following studies [6-8] confirmed its ntingiogenic effects. As result, thlidomide hs been employed in the studies of solid tumor s n ntingiogenic gent in recent yers. Some preclinicl nd clinicl trils for the tretment of severl types of solid tumor using thlidomide hve been reported [9-11]. However, the effectiveness nd mechnism of this ntingiogenic gent for the tretment of heptocellulr crcinom hve not been fully investigted. In the current study we estblished nude mice models bering xenogrfts of humn heptocellulr crcinom with high metsttic potentil, by which we exmined the effect of thlidomide on ngiogenesis nd tumor growth nd metstsis of humn heptocellulr crcinom. Its influence on tumor necrosis fctor α (TNF-α) nd liver function ws lso investigted. MATERIALS AND METHODS Animls Mle thymic BALB/c nu/nu mice, 4-6 wk old, were obtined from Shnghi Institute of Mteri Medic, Chinese Acdemy of Sciences nd mintined under specific pthogen-free (SPF) conditions. The study protocol on mice ws pproved by Shnghi Medicl Experimentl Animl Cre Commission. Metsttic model of humn HCC in nude mice Humn heptocellulr crcinom cell line HCCLM3 ws estblished by Liver Cncer Institute of Fudn University [12], in which metsttic model of humn heptocellulr crcinom in nude mice ws constructed vi orthotopic implnttion of histologiclly intct metsttic tumor tissue. Briefly, HCCLM3 derived (0.2 ml) cells were injected subcutneously into the nude mice. When the subcutneous tumor reched bout 1.5 cm in dimeter, mice were scrificed nd smll pieces of tumor tissue (pproximtely 1 mm 3 ) were implnted into the

2 Zhng ZL et l. Thlidomide on humn heptocellulr crcinom in nude mice 217 liver of new recipient mice, which were kept in stndrd fcilities. This niml model represents 100% spreding in liver nd metstsis to lungs. Besides, lph-fetoprotein (AFP) ws excreted nd heptitis B virus ws integrted into host cellulr genome s previously reported [12]. Grouping nd drug dministrtion Twenty-four nude mice were rndomly divided into therpy group nd control group, 12 mice in ech group. Thlidomide ws dissolved in 0.5% sodium crboxyl methyl cellulose (CMC) s n even suspension due to its poor solubility in wter. Thlidomide (200 mg/kg d) ws intrperitonelly dministered once dy in the therpy group nd n equivlent volume of 0.5% CMC suspension simply in the control group. The injection strted from the second dy of inocultion nd continued in the following consecutive 30 d. Body weight of mice ws recorded once week. Prmeters observed On the 30 th d ll mice were scrificed nd 1 ml of blood smple ws collected. After seprted, tumors were weighed nd the longest () nd the smllest (b) dimeters were mesured by slide guge under operting microscope. Tumor volume ws clculted with the following formultion: V = b 2 /2. Liver tissues were crefully ntomized nd visible metstses were counted. Prffin blocks of 10% buffered formlin-fixed smples of lungs were prepred. Ech lung smple ws consecutively cut into 10 slices. Seril sections were cut t 5-µm nd stined with hemtoxylin nd eosin to determine the presence of lung metstses. After blood smples were cogulted, centrifugtion t g for 10 min ws performed nd serum ws obtined for the test of AFP nd lnine minotrnsferse (ALT) nd TNF-α by rdioimmunossy nd immunosorbent ssy respectively. Prt of ech tumor tissue ws embedded in prffin block for dvnced immunohistochemistry nlysis of CD34 nd the rest ws stored t -70 for following RT-PCR study. Immunohistochemicl ssessment of vsculr density Prffin-embedded tumor tissues were sectioned (4 µm) nd the slides were deprffinized s usul nd wshed with tris buffered sline (TBS), nd then incubted with 10% norml got serum (Zhongshn Bio. CA). Sections were then incubted with ppropritely diluted (1:10) rt-nti-mouse CD34 monoclonl ntibody (Snt Cruz Biotechnology, Inc., Snt Cruz, CA) for 24 h t 4. Primry ntibody ws removed nd wshed with TBS, got-nti-rt IgG peroxidse (Zhongshn Bio. CA) ws then dded. Finlly the slices were stined s usul with hemtoxylin nd wshed with distilled wter. Quntifiction of blood vessels ws crried out s previously discribed [13]. Any brown-stined endothelil cell cluster distinct from djcent microvessels, tumor cells, or other stroml cells ws considered s single countble microvessel. The most vsculrized res of tumors were identified in low-power field ( 100), nd vessels were counted in five high-power fields ( 200). The dt were presented s men±sd of five high-power fields. Semi-quntittive reverse trnscription-pcr Totl RNA ws extrcted with Trizol regent (Promeg, USA) following the mnufcturer s instructions nd quntitted by bsorbnce nlysis t 260 nm. For the reverse trnscription polymerse chin rection, RNA PCR kit (AMV) (TkR Bio, JP) ws used. Totl volume of reverse trnscription rection ws 10 µl. Rection temperture ws 30 for 10 min, 42 for 20 min nd 45 for 30 min. For PCR rection the totl recting volume ws 50 µl. PCR rection ws performed in GeneAmp PCR system 2400 (Perkin Elmer, USA). Primers were designed ccording to previous publictions [14,15]. Primer sequences nd PCR rection conditions re shown in Tble 1. Glycerldehyde 3-phosphte dehydrogense (G3PDH) ws used s the internl stndrd. Of the PCR products 5 µl ws visulized by electrophoresis on 1.5% grose gel stined with ethidium bromide nd quntitted by densitometry using the Imge Mster VDS system nd ssocited softwre (Phrmci, Sweden). Enzyme-linked immunosorbent ssy for TNF-α Serum TNF-α ws tested by enzyme-linked immunosorbent ssy (ELISA) using TNF-α ELISA kit (Bsic Medicl Institute of Shnghi, Chinese Acdemy of Militry Medicl Sciences). Procedure ws designed ccording to mnufcturer s instructions, concentrtions of unknown smples were determined by compring the opticl density of smples to the stndrd curve. Sttisticl nlysis Dt were nlyzed for significnce with unpired t test nd chi-squre test. Sttisticl softwre SPSS 11.5 ws used in the nlysis. P vlue less thn 5% ws considered sttisticlly significnt. RESULTS Effects of thlidomide on growth of HCC Lumps in stomch nd skin invsion could be observed t the 5 th wk when mice were scrificed. The seprted tumors re shown in Figure 1. The chnges of body weight (g) nd tumor weight (g) nd tumor volume (cm 3 ) in tretment group were ll smller thn those in control group (4.3000± vs ±0.9827, ± vs ± nd ± vs ±0.3188, respectively) There ws no sttisticl significnce (P>0.05). Effects of thlidomide on metstsis of HCC Visible metstses rnging from 1 to 10 mm in dimeter were observed when seven lobes of liver were crefully ntomized nd the number of visible metstses ws recorded. Gross pthologicl exmintion of the lungs found scttered hemorrhgic spots, which were confirmed by histopthology to be metstses (Figure 2). The metsttic rte in liver nd lungs in tretment group nd control group ws both 100%, but the number of metstses in both liver nd lungs in therpy group ws significntly less thn tht in control group (P<0.05, Figure 3). Tble 1 Primer sequences nd PCR rection conditions Gene Primers Products size Anneling Cycles Temp/Time VEGF (ll isoforms) Upper: CCTGGTGGACATCTTCCAGGAGTACC 196 bp 58 /30 s 30 Lower: GAAGCTCATCTCTCCTATGTGCTGGC G3PDH Upper: ACCACAGTCCATGCCATCAC 450 bp 58 /30 s 30 Lower: TCCACCACCCTGTTGCTGTA

3 218 ISSN CN / R World J Gstroenterol Jnury 14, 2005 Volume 11 Number 2 cells were stined brown or yellow nd sinusoidly distributed in cpillry wlls of portl re nd fiber intervl of liver tissue (Figure 4). Microvessel counting reveled tht MVD in control group ws 80.00±26.27 per high-power field ( 200), wheres it ws 31.08±16.23 in therpy group ( P<0.05). Figure 1 Tumors in nude mice on the 30 th d. Upper line of tumors ws HCC in the control group, the lower in therpy group. Semi-quntittive RT-PCR As shown in Figure 5, the PCR products of VEGF nd G3PDH were visulized t the expected loctions on grose gels nd in direct cdna sequencing. All the obtined PCR products hd the sme cdna sequences s the gene bnk sequences (dt not shown). The degree of VEGF mrna by semiquntittive RT-PCR ws ± in the therpy group, nd ± in the control group (P<0.05). M C T C T C T C T C T C T bp G3PDH VEGF Figure 2 Metstses of heptocellulr crcinom in lungs. Mgnifiction: 200. Number of metstses per mouse Lung Control group Therpy group Liver Figure 3 Metstses of heptocellulr crcinom in lungs nd liver. P<0.05. Liver metstses were recorded in gross mnner by exmining ech lobe of liver nd counting mcroscopic tumors on the surfce. Lung metstses were counted under microscope by observing consecutive prffin slices of lung. CD34 expression nd microvessel counting Expression of CD34 in therpy group ws wek or even negtive, wheres it ws strong in control group. The newborn endothelil Figure 5 RT-PCR of VEGF mrna in HCC tissue. M: Mrker, 100 bp DNA ldder, rnging from 100 bp to 600 bp; C: Control group; T: Therpy group. The bnd of VEGF (ll isoforms, 196 bp) nd G3PDH (450 bp) re shown t expected loction in the gel. G3PDH used s n internl stndrd. VEGF mrna ws expressed strongly in control group, wheres wekly in therpy group. Effects on serum TNF-α nd liver function indexes Concentrtions of serum ALT, AFP nd TNF-α re shown in Tble 2. The level of TNF-α in therpy group ws lower thn tht in control group (P<0.05). No significnt difference ws observed in the in serum concentrtions of ALT nd AFP. Tble 2 Comprison of serum concentrtions of ALT nd AFP nd TNF-α between groups (men±sd) Groups ALT (IU/L) AFP (µg/l) TNF-α (ng/l) Control (n = 12) ± ± ±6.99 Therpy (n = 12) 87.88± ± ±4.64 P<0.05 vs control group. DISCUSSION Angiogenesis is neovsculriztion process during which endothelil cells of the pre-existing cpillries proliferte nd migrte to form new vsculr tips or so clled vsculr sprouts or endothelil buds. It is criticl for the growth, invsion nd A B Figure 4 Immunohistochemicl expression of CD34. A: control group; B: thlidomide treted group. Mgnifiction: 200.

4 Zhng ZL et l. Thlidomide on humn heptocellulr crcinom in nude mice 219 metstsis of cncer [1,2,16]. Solid tumors would not grow beyond the volume of 2-3 mm 3 when sprouting new cpillry blood vessels re tck, nd the smll cncer blocks, so-clled micrometstses, would be kept in hibernting stte for long term. Antingiogenic therpy for mlignnt tumors hs opened brnd new wy to the tretment of crcinoms, nd is regrded s one of the most promising nd hopeful strtegies. Different inhibitory effects of thlidomide on ngiogenesis nd tumor growth hve been reported [17-19]. The current study ws to exmine the effect of thlidomide on ngiogenesis nd tumor growth nd metstsis of humn heptocellulr crcinom. In our study intrperitonel dministrtion ws employed s previously described [14,15] t the dose of 200 mg/kg body weight every dy. Kotoh et l. [15] reported the ntitumor nd ntingiogenic effect of thlidomide on humn esophgel cncer ES63 in nude mice by intrperitonel dministrtion. Wheres sme effects were not observed when mice were treted by gvge dministrtion. However, experiments in vitro hve filed to demonstrte tht thlidomide or ny of its metbolites hs ny direct effect on cell prolifertion or cytotoxic effect [20]. The mechnisms underlying the strong effect of ntingiogenesis by intrperitonel route but poor efficiency by orl route remin uncler, the reson might be the biovilbility of the ctive form of thlidomide t tumor site. Results in this study revel tht chnges of body weight nd tumor weight nd tumor volume in tretment group were smller thn those in control group, but sttisticl nlysis showed no significnt difference (P>0.05). Metstses in both liver nd lung were observed. The metsttic rte in liver nd lungs in tretment group nd control group ws 100%, but metstsis counting showed tht the number of metstses in liver nd lungs in tretment group ws both sttisticlly lower thn those in control group (P<0.05). Minchinton et l. [6] reported tht thlidomide did not lter primry tumor growth of Lewis lung tumor xenoplnted in mice, nd dditionlly reduced the rdiosensitivity of the tumor, but did increse its sensitivity of combined tretment with rdition nd cytotoxin tirpzmine. In nother report [17], thlidomide lone inhibited tumor growth by 55% in the rbbit orl crcinom model. However, Gutmn et l. [19] filed to find ny ntingiogenic effect nd tumor inhibition effect of thlidomide in syngeneic mice. Results reported re very different, it might be prtly due to thlidomide s species specificity nd tissue specificity [21]. Stephens et l. [22] believe tht vrious species nd tissues depend on different ngiogenesis or vsculr pthwys, the extent of dependence on integrin α V β 3 determines their sensitivity to thlidomide. Angiogenesis is highly complex nd closely regulted process, which is influenced by the blnce between stimultory nd inhibitory fctors relesed by tumor nd surrounding host cells. VEGF, bfgf nd ptelet-derived endothelil cell growth fctor (PD-ECGF) re the min stimultory fctors, of which VEGF is the most importnt; it could promote the growth of mlignnt cells by incresing vsculr permebility [23]. Reserches hve reveled tht expression of VEGF in heptocellulr crcinom is much higher thn tht in non-tumor tissues [24]. Concentrtion of VEGF in serum is lso closely relted to tumor s pthologic progress nd ptients prognosis fter opertion [25]. In the current study we exmined VEGF mrna in cncer by semi-quntittive RT-PCR. It showed tht the level of VEGF mrna in thlidomide-treted group ws significntly lower thn tht in control group. Also we immunohistochemiclly exmined the expression of CD34 which ws considered s n endothelilspecific mrker, using monoclonl ntimouse CD34 ntibody. Results suggested tht the expression of CD34 in therpy group ws very wek, wheres in control group it ws strongly expressed. Accordingly, MVD in the former ws much less thn tht in the lter (P<0.05). VEGF nd MVD re the most common prmeters reflecting neovsculristion. The effects of down-regultion in this study suggest thlidomide hs inhibitory effects on ngiogenesis. Its inhibitory effects on metstses in liver nd lung might minly ttribute to its inhibition on VEGF [14], nd its inhibition on integrin α V β 3 my lso involve the process. Whether its obvious inhibition on metstsis but poor effects on tumor growth re due to its modultion on integrin α V β 3 is yet to be investigted. The phrmceuticl role of thlidomide is very extensive, the most significnt is to decrese the level of TNF-α in circultion so s to modulte immune system [26]. TNF-α, n importnt inflmmtory fctor, is lso criticl fctor to induce inflmmtory rection in heptitis [27]. Rufmn et l. [28] reported cse of heptitis C who s ALT in circultion ws induced to norml by thlidomide. Serum TNF-α nd liver function indexes such s ALT nd AFP were tested in the study so s to try to find thlidomide s influence on liver function. Results suggest thlidomide could drmticlly down-regulte serum TNF-α s previously reported [26], but no sttisticl vrince ws observed in serum concentrtion of ALT nd AFP. Whether inhibition of TNF-α synthesis plys different role in the inhibition of ngiogenesis compred with immunomodultion hs yet to be investigted. The remrkbly inhibitory effect of thlidomide on TNF-α might be vluble for clinicl tretment of liver cncer, becuse in Chin bout 90% of heptocellulr crcinoms re ccompnied with heptitis B nd bnorml liver function, the continuous inflmmtory sttes of liver nd liver filure fter opertion t lest could prtly contribute to the prognosis nd poor life qulity of ptients. Although in this niml model heptitis B virus genome ws crried nd AFP ws expressed, its biologicl stte of heptitis might be very different from tht of humn beings. Further studies bout the drug s effect on liver function re needed. The moleculr mechnisms nd specific ntitumor effects of thlidomide re yet to be elucidted, lthough some clinicl trils hve been performed [29]. Current clinicl trils on thlidomide re minly performed on unoperble mlignnt cses of middle or finl phse, nd in most cses tumor s volume chnge nd disppernce re tken s stndrds to evlute the drug s efficiency. Studies should be focused on elucidting the ntitumor nd ntingiogenic effects of thlidomide on specific cncers. Then in clinicl trils this drug should be used s n djunct tretment modlity, its ccumulting effects in long term nd influence on the life qulity of ptients my be the most vluble, becuse thlidomide, s n ntingiogenic gent, does not hve remrkble dose-effect reltionship s cytotoxic drugs. The results of this study suggest tht thlidomide cn be used s n djunct tretment modlity in the tretment of heptocellulr crcinom. REFERENCES 1 Folkmn J. The role of ngiogenesis in tumor growth. Semin Cncer Biol 1992; 3: Folkmn J. Role of ngiogenesis in tumor growth nd metstsis. Semin Oncol 2002; 29(6 Suppl 16): Kuiper RA, Schellens JH, Blijhm GH, Beijnen JH, Voest EE. Clinicl reserch on ntingiogenic therpy. Phrmcol Res 1998; 37: Pisni P, Prkin DM, Bry F, Ferly J. Estimtes of the worldwide mortlity from 25 cncers in Int J Cncer 1999; 83: D Amto RJ, Loughnn MS, Flynn E, Folkmn J. Thlidomide is n inhibitor of ngiogenesis. Proc Ntl Acd Sci USA 1994; 91: Minchinton AI, Fryer KH, Wendt KR, Clow KA, Hyes MM. The effect of thlidomide on experimentl tumors nd metstses. Anticncer Drugs 1996; 7:

5 220 ISSN CN / R World J Gstroenterol Jnury 14, 2005 Volume 11 Number 2 7 Kenyon BM, Browne F, D Amto RJ. Effects of thlidomide nd relted metbolites in mouse cornel model of neovsculriztion. Exp Eye Res 1997; 64: Kruse FE, Joussen AM, Rohrschneider K, Becker MD, Volcker HE. Thlidomide inhibits cornel ngiogenesis induced by vsculr endothelil growth fctor. Grefes Arch Clin Exp Ophthlmol 1998; 236: Tseng JE, Glisson BS, Khuri FR, Shin DM, Myers JN, El-Nggr AK, Roch JS, Ginsberg LE, Thll PF, Wng X, Teddy S, Lwhorn KN, Zentgrf RE, Steinhus GD, Plud JM, Abbruzzese JL, Hong WK, Herbst RS. Phse II study of the ntingiogenesis gent thlidomide in recurrent or metsttic squmous cell crcinom of the hed nd neck. Cncer 2001; 92: Govindrjn R. Irinotecn nd thlidomide in metsttic colorectl cncer. Oncology 2000; 14(12 Suppl 13): Bids SM, Winer EP, Fleming GF, Hrris L, Plud JM, Crwford JG, Ymuchi H, Iscs C, Hnfelt J, Tefft M, Flockhrt D, Johnson MD, Hwkins MJ, Lippmn ME, Hyes DF. Phse II evlution of thlidomide in ptients with metsttic brest cncer. J Clin Oncol 2000; 18: Li Y, Tng Y, Ye L, Liu B, Liu K, Chen J, Xue Q. Estblishment of heptocellulr crcinom cell line with unique metsttic chrcteristics through in vivo selection nd screening for metstsis-relted genes through cdna microrry. J Cncer Res Clin Oncol 2003; 129: Weidner N, Semple JP, Welch WR, Folkmn J. Tumor ngiogenesis nd metstsis-correltion in invsive brest crcinom. N Engl J Med 1991; 324: Myoung H, Hong SD, Kim YY, Hong SP, Kim MJ. Evlution of the nti-tumor nd nti-ngiogenic effect of pclitxel nd thlidomide on the xenotrnsplnted orl squmous cell crcinom. Cncer Lett 2001; 163: Kotoh T, Dhr DK, Msung R, Tbr H, Tchibn M, Kubot H, Kohno H, Ngsue N. Antingiogenic therpy of humn esophgel cncers with thlidomide in nude mice. Surgery 1999; 125: Folkmn J. Fundmentl concepts of the ngiogenic process. Curr Mol Med 2003; 3: Verheul HM, Pnigrhy D, Yun J, D Amto RJ. Combintion orl ntingiogenic therpy with thlidomide nd sulindc inhibits tumour growth in rbbits. Br J Cncer 1999; 79: Eisen T, Boshoff C, Mk I, Spunr F, Vughn MM, Pyle L, Johnston SR, Ahern R, Smith IE, Gore ME. Continuous low dose thlidomide: phse II study in dvnced melnom, renl cell, ovrin nd brest cncer. Br J Cncer 2000; 82: Gutmn M, Szold A, Rvid A, Lzusks T, Merimsky O, Klusner JM. Filure of thlidomide to inhibit tumor growth nd ngiogenesis in vivo. Anticncer Res 1996; 16: Sntos-Mendoz T, Fvil-Cstillo L, Oltr A, Tmriz J, Lbrrios F, Estrd-Prr S, Estrd-Grci L. Thlidomide nd its metbolites hve no effect on humn lymphocyte prolifertion. Int Arch Allergy Immunol 1996; 111: Belo AV, Ferreir MA, Bosco AA, Mchdo RD, Andrde SP. Differentil effects of thlidomide on ngiogenesis nd tumor growth in mice. Inflmmtion 2001; 25: Stephens TD, Bunde CJ, Fillmore BJ. Mechnism of ction in thlidomide tertogenesis. Biochem Phrmcol 2000; 59: Ymguchi R, Yno H, Nkshim Y, Ogswr S, Higki K, Akib J, Hicklin DJ, Kojiro M. Expression nd locliztion of vsculr endothelil growth fctor receptors in humn heptocellulr crcinom nd non-hcc tissues. Oncol Rep 2000; 7: Shimmur T, Sito S, Morit K, Kitmur T, Morimoto M, Kib T, Numt K, Tnk K, Sekihr H. Detection of vsculr endothelil growth fctor nd its receptor expression in humn heptocellulr crcinom biopsy specimens. J Gstroenterol Heptol 2000; 15: Poon RT, Ng IO, Lu C, Yu WC, Fn ST, Wong J. Correltion of serum bsic fibroblst growth fctor levels with clinicopthologic fetures nd postopertive recurrence in heptocellulr crcinom. Am J Surg 2001; 182: Meierhofer C, Dunzendorfer S, Wiedermnn CJ. Theoreticl bsis for the ctivty of thlidomide. BioDrugs 2001; 15: Powell EE, Edwrds-Smith CJ, Hy JL, Clouston AD, Crwford DH, Shorthouse C, Purdie DM, Jonsson JR. Host genetic fctors influence disese progression in chronic heptitis C. Heptology 2000; 31: Rufmn JP, Lmps LW. Thlidomide-induced normliztion of serum ALT levels in ptient with heptitis C. Am J Gstroenterol 2001; 96: Ptt YZ, Hssn MM, Lozno RD, Ellis LM, Peterson JA, Wugh KA. Durble clinicl response of refrctory heptocellulr crcinom to orlly dministered thlidomide. Am J Clin Oncol 2000; 23: Edited by Wng XL nd Zhu LH