SKI II reverses the chemoresistance of SGC7901/DDP gastric cancer cells

Transcription

1 ONCOLOGY LETTERS 8: , 2014 SKI II reverses the chemoresistnce of SGC7901/DDP gstric cncer cells YING LIU 1, ZUAN ZHU 2, HONGXING CAI 3, QINGHUA LIU 1, HONGLIAN ZHOU 2 nd ZHENGQIU ZHU 4 1 Deprtment of Pthology, Xuzhou Medicl College; 2 Deprtment of Gstroenterology, Affilited Hospitl of Xuzhou Medicl College; 3 Deprtment of Forensic Medicine, Xuzhou Medicl College; 4 Deprtment of Medicl Oncology, Affilited Hospitl of Xuzhou Medicl College, Xuzhou, Jingsu , P.R. Chin Received Jnury 31, 2013; Accepted July 26, 2013 DOI: /ol Abstrct. Cispltin is frequently used in treting gstric cncers; however, cquired resistnce to the drug often reduces the efficcy of therpy. The present study nlyzed the efficcy of the combintion of 4 [4 (4 chloro phenyl) thizol 2 ylmino]-phenol (SKI Ⅱ) nd cispltin [cis dimminedichloropltinum (II); DDP] on the gstric cncer SGC7901/DDP cell line. The results reveled tht SKI Ⅱ nd DDP hd cler synergistic effect. Glutthione (GSH) nd glutthione S trnsferse (GST) levels decresed significntly subsequent to the cells being treted with the combintion of DDP nd SKI Ⅱ compred with the cells tht were treted with DDP or SKI Ⅱ lone. Phosphorylted extrcellulr-signl-regulted kinse (p ERK) nd phosphorylted c-jun N-terminl kinse (p JNK) expression levels lso decresed following tretment with SKI Ⅱ. The results suggested tht SKI Ⅱ is ble to reverse the drug resistnce in humn gstric crcinom cells nd enhnce the ntitumor effect of DDP through the rs/mitogen ctivted protein kinse (MAPK) prolifertion pthwy. Introduction Cispltin [cis dimminedichloropltinum (II); DDP] is pltinum bsed drug tht is frequently used in the tretment of vrious cncers, including non Hodgkin's lymphom nd brest, testiculr, ovrin, hed nd neck, esophgel nd bldder cncer (1 3). Despite its therpeutic use, the intrinsic resistnce tht is cquired following continuous tretment limits the benefit of cispltin in cncer therpy. Therefore, the Correspondence to: Professor Zhengqiu Zhu, Deprtment of Medicl Oncology, Affilited Hospitl of Xuzhou Medicl College, 84 Hui-Hi Western Rod, Xuzhou, Jingsu , P.R. Chin E mil: liuyingliuqinghu@126.com Key words: 4 [4 (4 chloro phenyl) thizol 2 ylmino] phenol, sphingosine kinse 1, glutthione, glutthione S trnsferse, mitogen ctivted protein kinse pthwy, SGC7901/DDP cells identifiction of new nticncer drugs is required to optimize the performnce of DDP. Sphingosine 1 phosphte (S1P) is bioctive lipid tht hs been implicted in regulting vriety of cell biologicl responses, including cell prolifertion, survivl, differentition nd migrtion (4). There is gret del of interest in the roles tht S1P nd other sphingolipids ply in cell signling nd the response to stress (5 8). Furthermore, numerous studies hve linked S1P to vrious spects of cell motility, chemotxis nd metstsis in mmmlin nd SGC7901/DDP cells (9 11). The enzyme sphingosine kinse (SphK) is n oncogene tht is tightly regulted by number of growth fctors nd protein kinses. SphK is ble to increse the level of intrcellulr S1P. 4 [4 (4 chloro phenyl) thizol 2 ylmino] ph enol (SKI II) is minly used to inhibit SphK ctivity. SKI II is ble to inhibit S1P formtion in cells tht express drug trnsport proteins, including P glycoprotein (P gp), multidrug resistnce (MDR) ssocited protein 1 (MRP1) nd glutthione S trnsferse (GST). The mjority of ntitumor ctivities correlte with the concentrtions of the proteins tht re present in the blood nd tumors (12). The results provide further vlidtion for SphK s cncer therpeutic trget, s well s smll molecule inhibitors of SphK. The present study nlyzed the effects nd explored the mechnisms of the combintion of SKI Ⅱ nd DDP in SGC7901/DDP cells, which my id the further clinicl ppliction of this combintion in chemotherpy. Mterils nd methods Regents. The following regents nd detection kits were used: SKI Ⅱ (Sigm Aldrich Co., St Louis, MO, USA). SKI Ⅱ dissolved in dimethyl sulfoxide (DMSO); RMPI 1640 medium (Beyotime Institute of Biotechnology, Himen, Jingsu, Chin); fetl bovine serum (FBS; Tinjin Ho Yng Biologicl Mnufcture Co., Ltd., Tinjin, Chin); 3 (4, 5 dimethylthzol 2 yl) 2, 5 diphenyl tetrzolium bromide (MTT; Amresco, USA); glutthione (GSH); GST detection kit (Nnjing Jincheng Bioengineering Institute, Nnjing, Jingsu, Chin) nd totl RNA Extrction kit (Sngong Biotechnology, Shnghi, Chin). Monoclonl ntibodies (mab) ginst P gp, MRP1, phos- phorylted extrcellulr-signl-regulted kinse (p ERK) nd

2 368 LIU et l: TUMOR THERAPY phosphorylted c-jun N-terminl kinse (p JNK; Snt Cruz Biotechnology Institute, Shnghi, Chin) were lso used. Cell line nd cell culture. The humn gstric crcinom SGC7901/DDP cell line ws purchsed from the Nnjing KeyGen Biologicl Co., Ltd. (Nnjing, Jingsu, Chin). The cells were cultured in RMPI 1640 medium (ph ) contining 100 ml/l fetl clf serum (FCS) nd 10 ml/l penicillin nd streptomycin t 37 C in humidified (95%) incubtor contining 95% ir nd 50 ml/l 5% CO 2. The SGC7901/DDP cells were cultured for 24 h nd then incubted with vrious concentrtions of SKI Ⅱ (µmol/l) + DDP (mg/l) for 48 h. Cytotoxicity nd MDR reversl ssy. The cells were seeded into 96 well pltes t 2x10 4 cells/well. Vrious concentrtions of the compound SKI Ⅱ (µmol/l) + DDP (mg/l; 0+0, , , 0+2.5, 0+5, , , , nd ) were subsequently dded nd incubted for 48 h. The IC 50 vlue of DDP in the bsence or presence of 1.25 µmol/l SKI Ⅱ for 48 h ws clculted from the plotted results using the untreted cells s 100% by probit nlysis using SPSS 16.0 (SPSS, Inc., Chicgo, IL, USA). The reversion fold (RF) vlues, s the potency of reversl, were clculted using the formul RF = IC 50 of DDP lone / IC 50 of DDP incubted with the test compounds (8,10). Triplicte experiments with triplicte smples were performed. Immunocytochemistry ssy. The exponentilly growing cells were cultured in 24 well plte t density of 1x10 4 cells/well. Vrious concentrtions of the SKI Ⅱ (µmol/l) + DDP compound (mg/l; 0+0, 0+2.5, , , 5+0, 5+2.5, 10+0 nd ) were subsequently dded nd incubted for 48 h. An IHC detection regent nd DAB kit (Snt Cruz Biotechnology Institute) were used to exmine the expression of P gp, MRP1, p JNK nd p ERK. The treted cells were rinsed three times with 0.01 M phosphte buffered solution (PBS) nd fixed for 30 min with 4% prformldehyde t 4 C. Following this, the cells were incubted with 0.3% TritonX 100 for 20 min nd 3% H 2 O 2 for 10 min. The cells were then blocked with 10% norml got serum for 1 h t room temperture. Primry ntibodies were dded nd incubted t 4 C overnight. Subsequent to the cells being rinsed three times with cold PBS, the secondry ntibody ws dded nd incubted t room temperture for 30 min. Finlly, the cells were rinsed with 0.01 M PBS three times nd incubted with the DAB complexes for 20 min. The cells were observed nd imges were cptured using phse contrst microscope (Olympus DP-11, Tokyo, Jpn). Triplicte experiments with triplicte smples were performed. Western blot nlysis. The cells were plted on culture flsks t density of 1x10 4 cells/ml with vrious concentrtions of SKI Ⅱ (µmol/l) + DDP (mg/l; 0+0, 0+2.5, , , 5+0, 5+2.5, 10+0 nd ) for 48 h. Following ech experiment, the cells were rinsed with 0.01 mol/l PBS three times nd 200 µl lyste contining 150 ml/l protese inhibitor ws dded, followed by use of n ice bth for 15 min. The cells were then scrped from the flsks, hrvested nd centrifuged t 15,000 x g for 20 min for superntnt collection of the totl proteins. The protein contents were determined by Lowry ssy. Sodium dodecyl sulfte polycrylmide gel electrophoresis (SDS PAGE) gel smple buffer ws dded to the lystes, which were heted to 100 C for 5 min. Following this, 100 µg protein ws loded into ech well of 12.5% SDS PAGE gel for electrophoresis nd the trgeted protein ws trnsferred onto nitrocellulose membrne. The membrne ws blocked using 5% skimmed milk for 2 h t room temperture, incubted overnight t 4 C with primry ntibodies directed ginst P gp, MRP1, p ERK, p JNK (ll diluted 1:500 in primry ntibody dilution buffer) nd β ctin (loding control, diluted 1:1000 in primry ntibody dilution buffer). The membrne ws wshed three times for 5 min ech in wshing buffer nd incubted with the pproprite AP conjugted secondry ntibody (rbbit nti P gp, MRP1, p JNK, p ERK nd rbbit nti β ctin diluted 1:1000 in secondry ntibody dilution buffer) for 2 h t room temperture. The blotted protein bnds were visulized using the BCIP/NBT Alkline Phosphtse Color Development kit (Beijing Biotech Co., Ltd., Beijing, Chin). The developed films were digitized using n Epson Perfection 2480 scnner (Seiko Corp, Ngno, Jpn). The opticl density (OD) vlues of the proteins were obtined using Glyko Bndscn softwre (Glyko, Novto, CA, USA). Intrcellulr GSH nd GST quntifiction. Subsequent to being incubted with vrious concentrtions of SKI Ⅱ (µmol/l) + DDP (mg/l; 0+0, 0+2.5, , , 5+0, 5+2.5, 10+0 nd ) for 48 h, 1x10 5 cells were collected nd homogenized with 10 mm HCl. The homogente ws plced in 96 well microplte nd mesured using spectrophotometer (Shimdzu UV 1208; Shimdzu, Kyoto, Jpn) t 412 nm. The rections between 5,5 dithiobis(2 nitrobenzoic cid) (DNTB) nd intrcellulr GSH nd GST were quntified by compring the bsorbnce t 412 nm for ech smple with tht of GSH stndrd solution (0 100 µm/l). The bsorbnce ws mesured 10 min fter the ddition of DNTB. RNA extrction nd semi quntittive polymerse chin rection (PCR). The cells were plted on culture flsks t density of 1x10 4 cells/ml with vrious concentrtions of SKI Ⅱ (µmol/l) + DDP (mg/l; 0+0, 0+2.5, , , 5+0, 5+2.5, 10+0 nd ) for 48 h. Totl RNA ws isolted using Totl RNA Extrction kit (Tingen Biotech Co., Ltd., Beijing, Chin), nd DNse tretment ws performed using the RNse Free DNse Set ccording to the mnufcturer's instructions. Reverse trnscription of 10 µg totl RNA ws performed in totl volume of 100 µl contining 250 pmol oligo (dt)18, 80 U rrnsin ribonuclese inhibitor nd 500 U Moloney murine leukemi virus reverse trnscriptse in 50 mm Tris HCl (ph 8.3), 75 mm KCl, 3 mm MgCl 2, 10 mm DTT nd 0.5 mm dntps. The totl RNA nd oligo (dt)18 solutions were initilly heted t 70 C for 10 min nd then immeditely chilled on ice. The other regents were dded nd incubted for 15 min t 30 C nd then 60 min t 42 C. The primers nd TqMn probes for MRP1 nd GST were designed using Primer Express softwre (Tingen Biotech Co., Ltd.). The primers nd TqMn probes for β ctin were purchsed from Tingen Biotech Co., Ltd.. The evlution of β ctin expression, used s control of the RNA mount, ws

3 ONCOLOGY LETTERS 8: , performed using the following primer sequences: forwrd, 5' GTGGGGCGCCCCAGGCACCA 3' nd reverse, 5' CTC CTTAATGTCACGCACGATTT 3', which yielded 500 bp product. The other primers sequences tht were used were: MRP1 forwrd, 5' CCCCATGAATCCAAGATACCTA 3' nd reverse, 5' CCTTACCATTTGGAGATGAAGC, which yielded 1808 bp product; GST sequence forwrd, 5' ACC TTCTTTGGTGGAACCTGTA 3' nd reverse, 5' AAAGGC ATTAGGGTTGTTCTGA 3', which yielded 1016 bp product. Quntifiction of the trget cdna (MRP1 nd GST) nd n internl reference gene (β ctin) ws conducted using fluorescence bsed quntittive PCR method. PCR ws performed in 25 µl rection volume contining cdna equivlent to 1 10 ng totl RNA nd 200 nm of ech primer, 100 nm of probe nd 12.5 U TqMn universl PCR Mster Mix (contining 1XTqMn buffer, 200 µm datp, dctp nd dgtp nd 400 µm dutp, 5 mm MgCl 2, 1.25 U AmpliTqGold nd 0.5 U AmpErse UNG). The therml cycling conditions were 50 C for 2 min nd 95 C for 10 min, followed by 45 cycles t 95 C for 15 sec nd 60 C for 1 min. The reltive quntifiction of gene expression ws performed using the reltive stndrd curve method. The stndrd curve ws creted utomticlly using the ABI PRISM 7700 Detection System softwre (Applied Biosystems, Foster City, CA, USA) by plotting the threshold cycle (CT) ginst ech input mount of the control totl RNA (16, 4, 1, 0.25, 0.063, nd ng totl strting RNA), prepred from the SGC7901/DDP humn gstric crcinom cells. The coefficient of liner regression for ech stndrd curve ws > For ech unknown smple, the reltive mount ws clculted using liner regression nlysis from the respective stndrd curve. A reltive trget gene expression vlue ws obtined by dividing the trget gene vlue by the β ctin vlue (internl reference gene). Experimentl nimls nd tumor bering nude mouse model. A totl of 24 femle BALB/C nude mice, ged 4 weeks nd weighing g, were obtined from the Experimentl Animl Center of Xuzhou Medicl College. All experiments were crried out in ccordnce with the Ntionl Institutes of Helth Guide for the Cre nd Use of Lbortory Animls. This study ws pproved by the ethics committee of XuZhou Medicl College. Humn gstric cncer SGC7901/DDP cells were implnted under the skin on the right side in 16 BALB/C nude mice. The inocultion volume ws 0.1 ml (1x10 7 living cells/ml). Following the inocultion, tumor nodes ppered t the inoculted site, which were observed continuously for 1 week. The tumors were formed from hrd tumor nodes t the inoculted site nd incresing nodl enlrgement. The mice were rised in n pproprite niml house nd fed with cool boiled wter nd fodder sterilized with stem. The wood chips tht were used for the bedding were sterilized with stem nd the mouse cges were sterilized with disinfectnt solution. The wter, fodder, wood chips nd cges were chnged nd clened once dy, nd the mbient temperture nd humidity were kept t 22±1 C nd 60±10%, respectively, on 12 h dy/night cycle. The mximum tumor dimeter ws mesured using vernier cliper. All the niml experiments were performed in complince with the ntionl lws relting to niml reserch. The 16 BALB/C tumor bering nude mice were rndomized into four groups, with four mice in ech group. The norml group consisted of mice tht were treted with nothing. The DDP mouse group were treted with 2.5 mg/kg intrperitonel perfusion (i.p.) of DDP for 48 h. The SKI Ⅱ mouse group ws treted with 0.3 mg/kg i.p. SKI Ⅱ for 48 h nd the DDP + SKI Ⅱ mouse group were treted with 0.3 mg/kg i.p. SKI Ⅱ nd 2.5 mg/kg i.p. DDP for 48 h. The mice were then scrificed by cervicl disloction t 48 h subsequent to i.p. dministrtion. The tumors were removed to mesure their weight. Next, certin tumors were mounted on glss slides for immunohistochemicl (IHC) stining. Other tumors were collected nd stored t 80 C for western blotting nd GSH nd GST quntifiction. Immunohistochemicl stining. The IHC detection regent nd DAB kit were used to exmine the expression of P gp, MRP1, p JNK nd p ERK. Briefly, the deprffinized sections were heted in 700 W microwve oven for 12 min to retrieve the ntigens nd then cooled to room temperture. Endogenous peroxide ctivity ws blocked using 3% H 2 O 2 for 10 min. The sections were wshed with 0.01 M PBS, blocked with 10% rbbit serum for 15 min to reduce non specific ntibody binding nd incubted with the respective primry ntibody (ginst P gp, MRP1, p ERK or p JNK) t 4 C overnight. The other steps were similr to those described in the IHC ssy. Western blotting. The tumors were collected over ice nd mechniclly lysed in RIPA Lysis Buffer (P0013B; Beyotime Institute of Biotechnology), which contined 50 mm Tris (ph 7.4), 150 mm NCl, 1% Triton X 100, 1% sodium deoxycholte, 0.1% SDS, sodium orthovndte nd 1 mm phenylmethylsulphonyl fluoride (PMSF). The mucos ws homogenized for 30 sec nd kept on ice for 20 min. The homogentes were centrifuged t 12,000 x g for 30 min t 4 C, nd the superntnts tht contined the cytoplsmic components were retined nd stored t 80 C nd thwed once. The nucler pellets were dissolved in RIPA Lysis Buffer nd PMSF, centrifuged t 12,000 x g for 20 min t 4 C nd the superntnt extrcts collected. The nucler extrcts were liquoted nd stored t 80 C for western blotting nlysis of p65 protein ctivity. The protein concentrtions were determined using the bicinchoninic cid (BCA) protein ssy. Equl mounts of protein were resolved in SDS polycrylmide gels nd trnsferred electrophoreticlly onto nitrocellulose membrne (Amershm Biosciences, Amershm, UK). The other steps were similr to those described in the western blot nlysis. Tumor GSH nd GST quntifiction. To detect the ctivity of GST nd the contents of GSH, the tumors were excised nd subsequently homogenized in norml sline t 4 C. The homogente ws centrifuged t 4,000 x g for 10 min nd the superntnt ws retined. The homogente ws plced in 96 well microplte nd the bsorbnce ws mesured t 412 nm ws using spectrophotometer (Schimdzu UV 1208). The other steps were similr to those described in the intrcellulr GSH nd GST quntifiction. Sttisticl nlysis. The results re presented s the men ± SD of three replicted experiments. A one wy ANOVA ws

4 370 LIU et l: TUMOR THERAPY Tble I. Reversing effect of SKI Ⅱ on SGC7901/DDP cells. A Group, SKI II (µmol/l) Inhibition + DDP (mg/l) rte (%) IC 50 RF Pre reversion ± ± ± ± ±0.024 Post reversion ± ± ± ± ±0.175 B C Dt re presented s the men ± SD; n=6. SKI II, 4 [4 (4 chloro phenyl) thizol 2 ylmino] phenol; DDP, cis dimminedichloropltinum (II); RF, reversion fold. D performed to determine the differences mong the groups. All the sttisticl nlyses were performed using GrphPd Prism 5 (GrphPd Softwre Inc., L Joll, CA, USA). P<0.05 ws considered to indicte sttisticlly significnt difference. Results SKI Ⅱ reverses the resistnce of cells to DDP. SKI Ⅱ in combintion with DDP hd greter effect on the SGC 7901/DDP cells compred with DDP or SKI Ⅱ lone (P<0.05). The resistnce index of the SGC7901/DDP cells to DDP ws 6.3. Following the tretment with SKI Ⅱ, the IC 50 of DDP to the SGC7901/DDP cells ws reduced from 3.33 µmol/l to µmol/l by fold (Tble Ⅰ). Expression of P gp, MRP 1, p ERK nd p JNK in immunocytochemistry ssy. The immunocytochemistry ssy in vitro confirmed the expression of P gp, MRP 1, p ERK nd p JNK in the humn gstric crcinom cells. The number of P gp, MRP 1, p ERK nd p JNK positive cells in the SKI Ⅱ (µmol/l) + DDP (mg/lu; 5+0, 10+0, nd ) groups were significntly decresed (P<0.05). The immunocytochemistry ssy in vivo confirmed the expression of P gp, MRP 1, p ERK nd p JNK in the tumors. The number of P gp, MRP 1, p ERK nd p JNK positive cells in vitro nd in vivo ll decresed (P<0.05) following the tretment with SKI Ⅱ lone nd significntly decresed following the tretment with the DDP + SKI Ⅱ group (P<0.05; Tbles Ⅱ nd Ⅲ). Expression of P gp, MRP 1, p ERK nd p JNK in the western blot ssy. The result of the western blot ssy in vitro demonstrted tht P gp, MRP 1, p ERK nd p JNK were expressed in the humn gstric crcinom cells. Compred with the DDP (2.5 mg/l) group, the expression of P gp, MRP 1, p ERK nd Figure 1. P gp, MRP1, p ERK nd p JNK expression ws downregulted by SKI Ⅱ nd DDP, s determined by western blotting. (A), β ctin; b, P gp; c, MRP1; d, p ERK; nd e, p JNK. Ⅰ, control; Ⅱ, DDP 2.5; Ⅲ, SKI-II 1.25; Ⅳ, SKI-II 5; Ⅴ, SKI-II 10; Ⅵ, DDP SKI-II 1.25; Ⅶ, DDP SKI-II 5; nd Ⅷ, DDP SKI-II 10. 1, Control; 2, DDP; 3, SKI-II nd 4, DDP+SKI-II. (B) MRP1, GSH nd GST expression ws downregulted following tretment with SKI Ⅱ nd DDP, s observed by RT PCR., β ctin; b, GST; nd c, MRP1. Ⅰ, control; Ⅱ, DDP 2.5; Ⅲ, SKI-II 1.25; Ⅳ, SKI-II 5; Ⅴ, SKI-II 10; Ⅵ, DDP SKI-II 1.25; Ⅶ, DDP SKI-II 5; nd Ⅷ, DDP SKI-II 10. The effects of SKI Ⅱ+DDP on (C) GSH contents nd (D) GST ctivity re shown following the tretment. * P<0.05 vs. norml group; P<0.05 vs. DDP 2.5 group; P<0.05 vs. SKI-II1.25 group. P gp, P glycoprotein; MRP1, multidrug resistnce ssocited protein 1; p ERK, phosphorylted extrcellulr-signl regulted kinse; p JNK, phosphorylted c-jun N-terminl kinse; SKI II, 4 [4 (4 chloro phenyl) thizol 2 ylmino] phenol; DDP, cis dimminedichloropltinum (II); GSH, glutthione; GST, glutthione S trnsferse. p JNK decresed in the SKI Ⅱ (µmol/l) + DDP (mg/l; 5+0, 10+0, nd 0+2.5; P<0.05; Tble Ⅳ). The result of the western blot ssy in vivo demonstrted tht P gp, MRP 1, p ERK nd p JNK were expressed in the tumors. Compred with the DDP group, the expression of P gp, MRP 1, p ERK nd p JNK decresed (P<0.05) in the tumors following the tretment with SKI Ⅱ lone nd significntly decresed following the tretment with the DDP + SKI Ⅱ group (P<0.05; Fig. 1A, Tble Ⅴ).

5 ONCOLOGY LETTERS 8: , Tble II. Expression of P gp, MRP 1, p ERK nd p JNK in the immunocytochemistry ssy in vitro. Groups, SKI II (µmol/l) + DDP (mg/l) P gp MRP1 p JNK p ERK ± ± ± ± ± ± ± ± ± ± ± ± ±1.02 bc 53.37±0.61 bc 54.60±1.00 bc 52.86±1.00 bc ±0.99 bc 39.55±0.50 bc 40.44±0.45 bc 39.73±0.36 bc ± ± ± ± ±1.36 bc 44.31±0.90 bc 45.73±+0.26 bc 44.61±0.53 bc ±0.85 bc 29.39±1.05 bc 30.57±0.70 bc 30.63±0.71 bc P<0.05 vs. control group, b P<0.05 vs. DDP 2.5 group nd c P<0.05 vs. SKI II 1.25 group. Dt re presented s the men ± SD; n=3. P gp, P glycoprotein; MRP1, multidrug resistnce (MDR) ssocited protein 1; SKI II, 4 [4 (4 chloro phenyl) thizol 2 ylmino] phenol; DDP, cis dimminedichloropltinum (II); p ERK, phosphorylted extrcellulr-signl regulted kinse; p JNK, phosphorylted c-jun N-terminl kinse. Tble III. Expression of P gp, MRP 1, p ERK nd p JNK in immunocytochemistry ssy in vivo. Protein expression rte (%) Group P gp MRP1 p ERK p JNK Control ± ± ± ±0.699 DDP ± ± ± ±0.284 SKI II ±0.662 b ±0.673 b ±0.545 b ±0.982 b DDP+SKI II ±0.372 bc ±0.403 bc ±0.561 bc ±0.830 bc P<0.05 vs. control, b P<0.05 vs. DDP group nd c P<0.05 vs. SKI II group. Dt re presented s the men ± SD; n=4. P gp, P glycoprotein; MRP1, multidrug resistnce (MDR) ssocited protein 1; SKI II, 4 [4 (4 chloro phenyl) thizol 2 ylmino] phenol; DDP, cis dimminedichloropltinum (II); p ERK, phosphorylted extrcellulr-signl regulted kinse; p JNK, phosphorylted c-jun N-terminl kinse. Tble IV. OD vlue of P gp, MRP1, p JNK nd p ERK in ll the groups in vivo in the western blot ssy. OD Group P gp MRP1 p JNK p ERK Control 1.250± ± ± ±0.004 DDP ± ± ± ±0.005 SKI II ± ± ± ±0.004 SKI II ±0.007 bc 0.844±0.004 bc 0.867±0.003 bc 0.864±0.00 bc SKI II ±0.005 bc 0.722±0.005 bc 0.728±0.002 bc 0.735±0.03 bc DDP 2.5+SKI II ± ± ± ±0.007 DDP 2.5+SKI II ±0.005 bc 0.706±0.004 bc 0.745±0.006 bc 0.747±0.01 bc DDP 2.5+SKI II ±0.004 bc 0.669±0.003 bc 0.651±0.004 bc 0.668±0.00 bc P<0.05 vs. control, b P<0.05 vs. DDP 2.5 group nd c P<0.05 vs. SKI II 1.25 group. Dt re presented s the men ± SD; n=3. OD, opticl density; P gp, P glycoprotein; MRP1, multidrug resistnce (MDR) ssocited protein 1; SKI II, 4 [4 (4 chloro phenyl) thizol 2 ylmino] phenol; DDP, cis dimminedichloropltinum (II); p ERK, phosphorylted extrcellulr-signl regulted kinse; p JNK, phosphorylted c-jun N-terminl kinse. Expression levels of MRP 1, GST messenger RNA (mrna) in SGC7901/DDP cells. The expression levels of MRP 1 mrna in the SGC7901/DDP cells were clculted s: (Rtio of the mount of MRP 1 mrna / mount of β ctin mrna in the DDP treted cells) / (rtio of the mount of MRP1 mrna / mount of β ctin mrna in cells t 48 h following SKI Ⅱ nd/or DDP tretment). The MRP 1 levels peked in the SKI Ⅱ (µmol/l) + DDP (mg/l; 0+0;0+2.5) groups, but hd

6 372 LIU et l: TUMOR THERAPY Tble V. OD vlue of P gp, MRP1, p JNK nd p ERK in ll the groups in vitro in the western blot ssy. OD Group P gp MRP1 p ERK p JNK Control 1.313± ± ± ±0.040 DDP 1.300± ± ± ±0.054 SKI II 1.047±0.041 b 0.997±0.068 b 0.813±0.015 b 0.817±0.026 b DDP+SKI II 0.870±0.056 bc 0.810±0.026 bc 0.713±0.020 bc 0.680±0.023 bc P<0.05 vs. control, b P<0.05 vs. DDP group nd c P<0.05 vs. SKI II group. Dt re presented s the men ± SD; n=4. OD, opticl density; P gp, P glycoprotein; MRP1, multidrug resistnce (MDR) ssocited protein 1; SKI II, 4 [4 (4 chloro phenyl) thizol 2 ylmino] phenol; DDP, cis dimminedichloropltinum (II); p ERK, phosphorylted extrcellulr-signl regulted kinse; p JNK, phosphorylted c-jun N-terminl kinse. decresed in the SKI Ⅱ (µmol/l) + DDP (mg/l; 5+0; 10+0, nd ) tretment groups fter 48 h. In the SKI Ⅱ (µmol/l) + DDP (mg/l; 5+0, 10+0, nd ) treted cells, the combintion of the two drugs resulted in significntly lower level of MRP1 expression compred with the cells tht were treted with SKI Ⅱ lone t the 48 h time point (P<0.05). The expression of GST mrna in the SGC7901/DDP cells ws decresed by SKI Ⅱ + DDP (mg/l; nd ) tretment fter 48 h, exhibiting significnt suppression of GST expression compred with SKI Ⅱ or DDP tretment lone (P<0.05; Fig. 1B). This suggested tht SKI Ⅱ tretment enhnced DDP toxicity ginst the SGC7901/DDP cells through the suppression of GST expression, which is normlly enhnced by DDP exposure in the SGC7901/DDP cells. Contents of GSH nd GST. In vitro, the expression of GSH decresed significntly (P<0.05) in the cells subsequent to being treted with SKI Ⅱ lone (5 µmol/l nd 10 µmol/l), nd significntly decresed subsequent to being treted with SKI Ⅱ (µmol/l) + DDP (mg/l; nd ; P<0.05). The GST ctivity significntly decresed in the SKI Ⅱ (µmol/l) + DDP (mg/l; nd ) groups when compred with SKI Ⅱ lone (5 umol/l nd 10 umol/l; P<0.05). In vivo, GSH decresed (P=0.027; P<0.05) in the tumors subsequent to being treted with SKI Ⅱ lone nd significntly decresed following tretment with DDP + SKI Ⅱ (P<0.05; Fig. 1C nd D). The GST ctivity significntly decresed in the DDP + SKI Ⅱ group when compred with the SKI Ⅱ lone group (P<0.05). Discussion Gstric cncer is common mlignnt tumor of the limentry trct nd its incidence rte is mong the three leding kinds of neoplsm in vrious regions of Chin (13,14). Conventionl tretments for dvnced gstric cncer include extended resection, rdiotherpy nd chemotherpy, which hve little effect on the survivl rte of ffected ptients. Cispltin is pltinum chemotherpeutic gent tht is used in vriety of mlignncies. The mjor limittion in the clinicl ppliction of cispltin hs been the development of cispltin resistnce by tumors. A number of experimentl strtegies to overcome cispltin resistnce re t the preclinicl or clinicl levels, including the introduction of the bx gene, the inhibition of the JNK pthwy, the introduction of functionl p53 gene nd the tretment of tumors with ldose reductse inhibitors (15,16). Of prticulr significnce re the combintions of pltinum drug tretments with other drugs, rdition nd the emerging gene therpy regimens. The present study nlyzed the effect of the combintion of SKI Ⅱ nd DDP on the SGC7901/DDP cells nd identified tht SKI Ⅱ in combintion with DDP hd n improved effect compred with DDP or SKI Ⅱ lone. Following the tretment with SKI Ⅱ, the IC 50 of DDP to the SGC7901/DDP cells ws reduced. Furthermore, the present study explored the mechnisms of SKI Ⅱ in vitro nd in vivo. MDR is n unfvorble fctor tht cuses the filure of tretments ginst cncer cells (17). MDR occurs when cncer cells cquire simultneous resistnce to vrious chemotherpeutic gents tht hve no structurl or functionl similrities (18). The mechnisms tht re involved in MDR include the overexpression of mutispecific ATP dependent drug efflux pumps, including P gp, MRP1 nd BCRP (ABCG2), which reduce the vilble concentrtion of the drug for the cncer cells (19). The present study identified tht the combintion of SKI Ⅱ nd DDP ws ble to reverse the MDR of the SGC7901/DDP cells vi the downregultion of P gp nd MRP1, which incresed the concentrtions of DDP in the SGC7901/DDP cells. Endogenous ntioxidnts, including reduced GSH, GSH peroxidse (GSH PX), superoxide dismutse (SOD) nd ctlse (CAT), re compounds tht ct s free rdicl scvengers. These ntioxidnts re electron donors nd rect with the free rdicls to form hrmless products such s wter. Therefore, ntioxidnts protect ginst oxidtive stress nd prevent dmge to cells (20). Similrly, GST is soluble protein tht is locted in the cytosol nd plys significnt role in cell protection. The present study identified tht the combintion of SKI Ⅱ nd DDP decresed the levels of GSH nd GST in the SGC7901/DDP cells, which decresed the protection possibility of GSH nd GST to the cells. Therefore, the inhibition rte of the SGC7901/DDP cells tht were treted with SKI Ⅱ nd DDP incresed significntly in vitro nd in vivo. MAPKs belong to lrge fmily of proline directed serine threonine protein kinses tht re significnt signling components in the conversion of extrcellulr signls into n intrcellulr response through series of phosphoryltion

7 ONCOLOGY LETTERS 8: , cscdes (21). The ultimte effects of MAPK ctivtion nd phosphoryltion depend on the bility of the kinses to induce the pproprite gene expression events. Three MAP kinse pthwys, ERK, JNK nd p38, hve been identified nd well studied (22,23). The expression nd ctivtion of the JNK nd ERK MAPK pthwy correlte with prognosis nd ffects the therpeutic outcome in severl types of cncer (24,25). The present study reveled tht the combintion of SKI Ⅱ nd DDP my decrese the MAPK pthwy by decresing the expression of ERK nd JNK in the SGC7901/DDP cells. Wssermn et l identified tht the ctivtion of MAPK lso induced the mrna expression of immedite erly genes, including c jun nd c fos, nd trnscriptionlly ctivted the ntioxidnt/electrophile response element (ARE/EpRE) nd the chlormphenicol cetyltrnsferse reporter gene, which re present in number of stress response genes, including GST, quinone reductse nd heme oxygense 1 (26 29). Furthermore, the present study reveled tht the combintion of SKI Ⅱ nd DDP my lso decrese the levels of GSH nd GST in the SGC7901/DDP cells. This emphsizes the complexity of MAPK signling. In summry, the results of the present study hve shown tht SKI Ⅱ is ble to reverse the chemoresistnce of SGC7901/DDP gstric cncer cells by decresing the levels of P gp nd MRP 1, which increses the concentrtions of DDP in the SGC7901/DDP cells. Furthermore, SKI Ⅱ decresed the levels of GSH nd GST in the cells, which decresed the protection possibility of GSH nd GST to the SGC7901/DDP cells. The present study demonstrted tht the combintion of SKI Ⅱ nd DDP ws ble to regulte the MAPK pthwys by decresing the expression of ERK nd JNK in the SGC7901/DDP cells. The study hs provided significnt insights into the signl trnsduction pthwys tht re induced by the combintion of SKI Ⅱ nd DDP, which ctivte MAPK pthwys, leding to decrese in GST for cellulr protection signling. Therefore, further understnding of the regultory system of MDR, GSH nd MAPK signling is required for the ppliction of SKI II nd DDP in clinicl settings. Acknowledgements This study ws supported by the Jingsu Provincil Deprtment of Helth 2011 Annul Medicl Reserch Project (no. Z201016) nd the Jingsu Province Six Tlents Pek Seventh Btches of Funded projects (no. 032). References 1. Lekkis L, Tryfonopoulos D, Pistmtzin N, et l: Slvge chemotherpy with cispltin nd 5 fluorourcil in metsttic brest cncer. Prticulr ctivity ginst liver metstses. Anticncer Res 32: , Grcí Velsco A, Durán I, Grcí E, et l: Biologicl mrkers of cispltin resistnce in dvnced testiculr germ cell tumours. Clin Trnsl Oncol 14: , Yngw M, Ttsumi M, Miyt H, et l: Evlution of response to neodjuvnt chemotherpy for esophgel cncer: PET response criteri in solid tumors versus response evlution criteri in solid tumors. J Nucl Med 53: , Kumr A nd Sb JD: Lyse to live by: sphingosine phosphte lyse s therpeutic trget. Expert Opin Ther Trgets 13: , Hl T: Physiologicl nd pthologicl ctions of sphingosine 1 phosphte. Semin Cell Dev Biol 15: , Ogretmen B nd Hnnun YA: Biologiclly ctive sphingolipids in cncer pthogenesis nd tretment. Nt Rev Cncer 4: , Spiegel S nd Milstien S: Sphingosine 1 phosphte, key cell signling molecule. J Biol Chem 277: , Th, TA, Argrves KM nd Obeid LM: Sphingosine 1 phosphte receptors: receptor specificity versus functionl redundncy. Biochim Biophys Act 1682: 48 55, Kumr A, Wessels D, Dniels KJ, et l: Sphingosine 1 phosphte plys role in the suppression of lterl pseudopod formtion during Dictyostelium discoideum cell migrtion nd chemotxis. Cell Motil Cytoskeleton 59: , Oskouin B nd Sb JD: Deth nd txis: wht non mmmlin models tell us bout sphingosine 1 phosphte. Semin Cell Dev Biol 15: , Spiegel S, English D nd Milstien S: Sphingosine 1 phosphte signling: providing cells with sense of direction. Trends Cell Biol 12: , French KJ, Upson JJ, Keller SN, et l: Antitumor ctivity of sphingosine kinse inhibitors. J Phrmcol Exp Ther 318: , Roukos DH nd Kpps AM: Perspectives in the tretment of gstric cncer. Nt Clin Prct Oncol 2: , Menges M, Schmidt C, Lindemnn W, et l: Low toxic neodjuvnt cispltin, 5 fluorourcil nd folinic cid in loclly dvnced gstric cncer yields high R 0 resection rte. J Cncer Res Clin Oncol 129: , Zho Z, Wng J, Tng J, et l: JNK nd Akt medited Pum expression in the poptosis of cispltin resistnt ovrin cncer cells. Biochem J 444: , Hsegw M, Ishiguro K, Ando T nd Goto H: Gernylgernylcetone ttenutes cispltin induced reductions in cell vibility by suppressing the elevtion of intrcellulr p53 content without het shock protein induction. Ngoy J Med Sci 74: , Vsconcelos FC, Cvlcnti GB Jr, Silv KL, et l: Constrsting fetures of MDR phenotype in leukemis by using two fluorochromes: implictions for clinicl prctice. Leuk Res 31: , Ptel NH nd Rothenberg ML: Multidrug resistnce in cncer chemotherpy. Invest New Drugs 12: 1 13, Legrnd O, Simonin G, Beuchmp Nicoud A, et l: Simultneous ctivity of MRP1 nd Pgp is correlted with in vitro resistnce to dunorubicin nd with in vivo resistnce in dult cute myeloid leukemi. Blood 94: , Vlko M, Rhodes CJ, Moncol J, et l: Free rdicls, metls nd ntioxidnts in oxidtive stress induced cncer. Chem Biol Interct 160: 1 40, Cobb MH nd Goldsmith EJ: How MAP kinses re regulted. J Biol Chem 270: , Wgner EF nd Nebred AR: Signl integrtion by JNK nd p38 MAPK pthwys in cncer development. Nt Rev Cncer 9: , Lee HG, Minemtsu H, Kim KO, et l: Actin nd ERK1/2 CEBPβ signling medites phgocytosis induced innte immune response of osteoprogenitor cells. Biomterils 32: , McGlynn LM, Kirkegrd T, Edwrds J, et l: Rs/Rf 1/MAPK pthwy medites response to tmoxifen but not chemotherpy in brest cncer ptients. Clin Cncer Res 15: , Atmc A, Puligk C, Steinmetz K, et l: Prognostic impct of phosphorylted mitogen ctivted protein kinse expression in ptients with metsttic gstric cncer. Oncology 80: , Wssermn WW nd Fhl WE: Functionl ntioxidnt responsive elements. Proc Ntl Acd Sci USA 94: , Li Y nd Jiswl AK: Regultion of humn NAD(P)H: quinone oxidoreductse gene. Role of AP1 binding site contined within humn ntioxidnt response element. J Biol Chem 267: , Rushmore TH nd Pickett CB: Trnscriptionl regultion of the rt glutthione S trnsferse Y subunit gene. Chrcteriztion of xenobiotic responsive element controlling inducible expression by phenolic ntioxidnts. J Biol Chem 265: , Prester T, Holtzclw WD, Zhng Y nd Tlly P: Chemicl nd moleculr regultion of enzymes tht detoxify crcinogens. Proc Ntl Acd Sci USA 90: , 1993.