Investigation into the molecular mechanism of action of Triticum aestivum for its activity in Thalassemia
|
|
- Leonard Booth
- 5 years ago
- Views:
Transcription
1 Investigation into the molecular mechanism of action of Triticum aestivum for its activity in Thalassemia Clinical study: The clinical study Investigation into the molecular mechanism of action of Triticum aestivum for its activity in Thalassemia was conducted at Sir. Takhtasinhji Hospital, Bhavnagar. The necessary permission of institutional review board Government medical college Bhavnagar was obtained by letter no. IRB (HEC) no.19/2008 dated 07/09/2009 prior to the commencement of clinical study. The permission letter is attached on the last page of the thesis. The Clinical study was prospective, open labelled, non-randomised, parallel design and no controlled neutraceuticals clinical trial on thalassemia major patients. The clinical trial was carried out from April to March The informed consent form in Gujarati language was taken from all the patients/parents or their relatives. Inclusion criteria: The study included a total of 28 thalassemia major patient s age range from 2 to 25 years registered indoor patients for the blood transfusion at Sir.T hospital, Bhavnagar and they were divided into 2 groups. Out of 22 patients 16 patients were with spleen and 6 patients were without spleen. Thalesemia major patients were selected and they were administered Green Era Wheat Grass capsules each containing 320 mg. of wheatgrass (Triticum aestivum) dry powder received from Green Era foods and Nutraceutics, Bhavnagar.
2 Summary and Conclusions : 1. Administration of wheatgrass capsules or juice for 9 months in patients with thalassemia major produced increase in mean cell volume (MCV) and elevated in value of mean cell haemoglobin concentration (MCHC). However, no significant changes were observed in red blood cells (RBCs), packed cell volume (PCV), mean cell haemoglobin (MCH) and red cell distribution width (RDW) in thalassemia major patients. 2. Treatment with wheatgrass capsules for 9 months produced increase in level of haemoglobin (Hb) however, increase in haemoglobin (Hb) was not found with wheatgrass juice. 3. Both wheatgrass capsules as well as juice produced significant increase in mean blood transfusion interval in thalassemia major patients. 4. Wheatgrass juice and not the capsules induce foetal haemoglobin (HbF) level in thalassemia major patients and hence the effect of wheatgrass on HbF requires further investigations however, both wheatgrass capsules and juice after 9 months treatment produced decrease in HbA 2 level in thalassemia major patients. 5. Administration of wheatgrass capsules produced anti allergic properties by virtue of decrease in eosinophil count in thalassemia major patients however, decrease in eosinophil counts was not found with wheatgrass juice. 6. Treatment with wheatgrass capsules and juice for 9 months, we did not observed major changes in total WBC count, neutrophil count, lymphocyte count, monocyte count and hence, wheatgrass does not produce any adverse effect on defense mechanisms of body in patients with thalassemia.
3 7. Wheatgrass capsules produced decrease in SGPT and SGOT level by virtue of various antioxidants and hence, it appears to possess hepato-protective property. produced contradictory results after 6 and 9 months treatment period so it requires further investigations. 8. Serum creatinine and blood urea nitrogen (BUN) level remains unaffected either before treatment or after treatment with wheatgrass capsules or juice. 9. Administration of wheatgrass capsules or juice for 9 months period produced reduction in serum ferritin, serum iron, and total iron binding capacity (TIBC) indicates that wheatgrass reduces iron over load in thalassemia major patients. 10. The urine analysis produced excretion of urobilinogen in normal level and absence of bilirubin, bile salts, leukocytes, nitrites, protein, and glucose in pre and post treated thalassemia major patients. These results indicated that iron is not excreted in abnormal proportion through kidney in thalassemia major patients. 11.Both wheatgrass capsules and juice produced positive chromo azurol S (CAS) assay for the presence of phytosiderophore (mugienic acid). 12. In vitro assay of Iodometric titration supported the presence of phytosiderophore by showing iron complexation in ferric ammonium sulphate treated with wheatgrass capsules or juice as compared to that of un-treated ferric ammonium sulphate. 13. The colorimeter assay of ferric ammonium sulphate plus potassium thiocynate treated with wheatgrass capsules or juice produced decrease in absorbance as compared to untreated ferric ammonium sulphate.
4 14. Treatment with wheatgrass capsules or juice, thalassemia major patients were not getting frequent infections, cold and cough. Treatment with wheatgrass in patients was not found to produce any adverse effects or enlargement of abdomen during entire period of study. Conclusions: We conclude that wheatgrass capsules produced increase in mean cell volume (MCV) and mean cell haemoglobin concentration (MCHC) level, significant elevation in mean blood transfusion interval, reduction in HbA 2 level in thalassemia major patients. Treatment with Green Era Wheat Grass capsules produced increase in haemoglobin level and anti-allergic properties in thalassemia major patients, however, increase in haemoglobin level and an anti-allergic property was not found with wheatgrass juice. Both wheatgrass capsules and juice does not produce any adverse effect on defense mechanisms of body in thalassemia major patients. We also conclude that treatment with wheatgrass capsules possess hepato-protective action by virtue of exogenous antioxidants however; hepato-protective action was not found with wheatgrass juice in thalassemia major patients. Both wheatgrass capsules and juice produced decrease in iron over load in patients with thalassemia and hence, improves the quality of life in thalassemics. In conclusion, our studies suggest the potential benefit of Green Era Wheat Grass capsules as well as juice by virtue of its multiple beneficial therapeutic actions in thalassemia and its associated complications we recommend wheatgrass as a good option in the treatment of thalassemia major.
5 Note : Do not use this data without our permission.
Evidence for the Presence of Iron Chelator Constituent In The Wheatgrass for the Treatment of Patients With Thalassemia Major
Research Article ISSN: 974-6943 Available online through http://jprsolutions.info Evidence for the Presence of Iron Chelator Constituent In The Wheatgrass for the Treatment of Patients With Thalassemia
More informationClinician Blood Panel Results
Page 1 of 7 Blood Panel - Markers Out of Range and Patterns (Pattern: proprietary formula using one or more Blood Markers) Blood Panel: Check for Markers that are out of Lab Range ***NOTE*** Only one supplement
More information10 Essential Blood Tests PART 1
Presents 10 Essential Blood Tests PART 1 The Blood Chemistry Webinars With DR. DICKEN WEATHERBY Creator of the Blood Chemistry Software Essential Blood Test #1: Basic Chem Screen and CBC http://bloodchemsoftware.com
More informationComplete Medical History
Lab Results for Ben Greenfield Last Test Date: Your medical history is not complete. Complete Medical History Complete Medical History What's Next Blood Draw Blood draw scheduled Complete your medical
More information6/3/2018 9:37:00AM 6/3/2018 9:39:05AM 6/3/2018 1:44:56PM A/c Status. Test Name Results Units Bio. Ref. Interval Bilirubin Direct 0.
LL - LL-ROHINI (NATIONAL REFERENCE 140222511 Age 45 Years Gender Male 6/3/2018 93700AM 6/3/2018 93905AM 6/3/2018 14456M Ref By Final Swasth lus Tax Saver anel 1 LIVER & KIDNEY ANEL, SERUM (Spectrophotometry,
More informationANNUAL HEALTH CHECKUP BASIC HEALTH PACKAGE
ANNUAL HEALTH CHECKUP Taking care of your health is our responsibility and to make sure that you remain at a distance from the serious maladies, we also step forward in providing health checkups. This
More informationREFERENCE INTERVALS. Units Canine Feline Bovine Equine Porcine Ovine
REFERENCE INTERVALS Biochemistry Units Canine Feline Bovine Equine Porcine Ovine Sodium mmol/l 144-151 149-156 135-151 135-148 140-150 143-151 Potassium mmol/l 3.9-5.3 3.3-5.2 3.9-5.9 3.0-5.0 4.7-7.1 4.6-7.0
More information5/6/ :35:00AM 5/6/ :57:28AM 5/6/2017 3:49:09PM A/c Status. Test Name Results Units Bio. Ref. Interval
LL - LL-ROHINI (NATIONAL REFERENCE 136235211 Age Unknown Gender Unknown 5/6/2017 103500AM 5/6/2017 105728AM 5/6/2017 34909M Ref By Final Swasth lus Health Advance anel LIVER & KIDNEY ANEL, SERUM (Spectrophotometry,
More informationNORMAL LABORATORY VALUES FOR CHILDREN
Pediatric Drug Lookup Normal Laboratory Values for NORMAL LABORATORY VALUES FOR CHILDREN CHEMISTRY Normal Values Albumin 0-1 y 2.0-4.0 g/dl 1 y to adult 3.5-5.5 g/dl Ammonia Newborns 90-150 mcg/dl 40-120
More informationClinician Blood Panel Results
Page 1 of 8 Blood Panel - Markers Out of Range and Patterns (Pattern: proprietary formula using one or more Blood Markers) Blood Panel: Check for Markers that are out of Lab Range ***NOTE*** Only one supplement
More informationThe LaboratoryMatters
Laboratory Medicine Newsletter for clinicians, pathologists & clinical laboratory technologists. A Initiative. Complete Blood Count This issue highlights: CBC, while ubiquitous, is an excellent diagnostic
More informationInterpreting Blood Tests Part 1. Dr Andrew Smith
Interpreting Blood Tests Part 1 Dr Andrew Smith Outline Part 1 (This Week) Introduction Which Tube!?! FBCs U+Es Part 2 (Next Week): More Electrolytes LFTs Clotting Extras Introduction Bloods are a core
More informationWHAT IS YOUR DIAGNOSIS?
WHAT IS YOUR DIAGNOSIS? A 12 year old, female neutered domestic shorthaired cat was presented to the R(D)SVS Feline Clinic with a 6 week history of polydipsia and polyuria, which was not quantified. The
More informationRapid Laboratories In House Tests
Electrolytes CL CL (CHLORIDE) Electrolytes CO2 CO2 (BICARBONATE) Electrolytes K K (POTASSIUM) Electrolytes NA NA (SODIUM) Basic Metabolic Panel (BMP) GLU GLU (GLUCOSE) Basic Metabolic Panel (BMP) CA CA
More informationSydPath Reference Intervals for Clinical Trials (Contract Pathology Unit) Unauthorised Copy
HAEMATOLOGY APTT 1 150 M 25 35 sec APTT 1 150 F 25 35 sec Basophils Cord 2 weeks M 0.0 0.4 10^9/L Basophils Cord 2 weeks F 0.0 0.4 10^9/L Basophils 2 wks 3 mths M 0.0 0.2 10^9/L Basophils 2 wks 3 mths
More informationA test that can measure the levels of minerals, as well as toxic heavy metals, through a hair mineral analysis.
Hair Mineral Analysis A test that can measure the levels of minerals, as well as toxic heavy metals, through a hair mineral analysis. Your hair contains every single mineral that exists in your body. These
More information15/9/2017 4:23:00PM 15/9/2017 4:26:06PM 20/9/2017 4:58:24PM A/c Status. Test Name Results Units Bio. Ref. Interval < >40.00 mg/dl <150.
Lab No 135091258 Age 30 Years Gender Male 15/9/2017 42300M 15/9/2017 42606M 20/9/2017 45824M Ref By UNKNWON Final Test Results Units Bio Ref Interval SWASTH LUS HEALTH ADVANCE ANEL LIID ROFILE, BASIC,
More informationPOSTGRADUATE INSTITUTE OF MEDICINE UNIVERSITY OF COLOMBO
POSTGRADUATE INSTITUTE OF MEDICINE UNIVERSITY OF COLOMBO Selection Examination for Enrolment to the in-service Training Programme in Postgraduate Certificate in Basic Laboratory Sciences leading to the
More informationBC Biomedical Laboratories Adult Reference Ranges
BC Biomedical Laboratories Adult s Name Age 25 OH VITAMIN D Blood B 0-100 nmol/l Interpretation: < 25 Deficient 25-74 Insufficient 75-199 Sufficient > 200 Toxic 5HIAA (CALC) Urine B 0-100
More information* * : : : Final. (Automated Strip Test, Microscopy) Colour Specific Gravity Nil
LL - LL-ROHINI (NATIONAL REFERENCE 136235212 Age Unknown Gender Unknown 5/6/2017 103400AM 5/6/2017 105702AM 5/6/2017 35028M Ref By Final Swasth lus Health Basic anel URINE EXAMINATION, ROUTINE; URINE,
More information* * Interpretation
LL - LL-ROHINI (NATIONAL REFERENCE 139242049 Age Unknown Gender Unknown 9/3/2018 120000AM 9/3/2018 40032M 10/3/2018 24647M Ref By Final SUGAR ADVANCE ANEL MICROALBUMIN,1ST MORNING/RANDOM URINE (Immunoturbidimetry,Spectrophotometry)
More informationLaboratory for diagnosis of THALASSEMIA
SCBM343 CLINICAL PATHOLOGY 2(1-2-3) Laboratory for diagnosis of THALASSEMIA PORNTHIP CHAICHOMPOO pornthip.chh@mahidol.ac.th Acknowledgements Dr. Pranee Winichagoon Fucharoen Ms. Pornnapa Khampan Thalassemia
More informationGet to know yourself better. Attend our health screening event.
Gateway Technical College Get to know yourself better. Attend our health screening event. Putting your knowledge to action is Powerful. Get the information and guidance you need with the Wellness Screening
More informationWhat Does My Blood Test Mean
What Does My Blood Test Mean CBC with Differential This means that your doctor wants to know the amounts and proportions among the various components of your blood, explained below. The term differential
More informationChapter 4. M.G.Rajanandh, Department of Pharmacy Practice, SRM College of Pharmacy, SRM University.
Chapter 4 M.G.Rajanandh, Department of Pharmacy Practice, SRM College of Pharmacy, SRM University. RBC (Erythrocytes): RBC COUNT: NORMAL VALUES: For men: 4.3-5.9 millions/mm 3 of blood. For women: 3.5-5.0
More informationResults Report. Welcome to Your ABT Report!
Results Report Athlete Name: SHEPPARD, JOSEPH Date of Blood Draw: Feb 10, 2018 Panel: ABT Bronze Panel ABT Expert: Dr. Rock Welcome to Your ABT Report! Thank you for trusting AthleteBloodTest.com to be
More informationCOMMITTEE FOR MEDICINAL PRODUCTS FOR VETERINARY USE (CVMP) LIST ON
European Medicines Agency Veterinary Medicines and Inspections London, 20 November 2006 EMEA/CVMP/556/04- Rev.1 COMMITTEE FOR MEDICINAL PRODUCTS FOR VETERINARY USE (CVMP) LIST ON ADDITIONAL CONTROLLED
More informationThe Complete Blood Count
The Complete Blood Count (Cartesian Thinking at Its Best) A SEM Image of Normal Human Blood Laurie Larsson February 22, 2010 Anatomy and Philology II Dr. Danil Hammoudi Introduction A complete blood count
More informationBASIC METABOLIC PANEL
Update 2/12/2018 BASIC METABOLIC PANEL CPT 80048 Stability: 3 days at 15-25 C; 7 days at 2-8 C; > 7 days at -70 C Colorimetric Assay, Rate reaction, ISE Components: BUN, Calcium, Chloride, CO2, Creatinine,
More informationTotal Cholesterol A Type of Fat. LDL "Bad" Cholesterol. HDL "Good" Cholesterol. Triglycerides Type of Fat. vldl-c Precursor to LDL Cholest
Lab Results for Ben Greenfield Last Test Date: 2013-08-13 Let us know what you think How likely are you to recommend WellnessFX to a friend or colleague? 1 2 3 4 5 6 7 Not at all likely Neutral Extremely
More information2013/11/29 Version 2
1 2013/11/29 Version 2 2 3 4 5 6 7 8 9 99 1 2 3 4 5 6 7 8 9 10 10 99 wew.bhp.doh.gov.tw/bhpnet/portal/file/statisticsfile/201305061037065219 /99.pdf 99 1 2 3 4 5 6 7 8 9 10 11 99 wew.bhp.doh.gov.tw/bhpnet/portal/file/statisticsfile/201305061037065219
More informationCollect and label sample according to standard protocols. Gently invert tube 8-10 times immediately after draw. DO NOT SHAKE. Do not centrifuge.
Complete Blood Count CPT Code: CBC with Differential: 85025 CBC without Differential: 85027 Order Code: CBC with Differential: C915 Includes: White blood cell, Red blood cell, Hematocrit, Hemoglobin, MCV,
More informationENROLLMENT CONFIRMATION
Step 1: Please review the Facility/Contact information. If any of the information is incorrect, please make the appropriate changes below: Facility/Contact Phone: (850)474-3660 Fax: (850)474-3659 6431
More informationGet to know yourself better. Attend our health screening event.
Get to know yourself better. Attend our health screening event. Putting your knowledge to action is Powerful. Get the information and guidance you need with the Wellness Screening Program. 1 SIMPLE ACTION
More informationClinician Blood Panel Results
Page 1 of 8 Blood Panel - Markers Out of Range and Patterns (Pattern: proprietary formula using one or more Blood Markers) Blood Panel: Check for Markers that are out of Lab Range ***NOTE*** Only one supplement
More informationTests Explained. General Lab Panels
Tests Explained General Lab Panels Blood Group (ABO & Rh) A blood type (also called a blood group) is a classification of blood based on the presence or absence of inherited antigenic substances on the
More informationASPEN MOUNTAIN MEDICAL CENTER. Lab Health Fair
ASPEN MOUNTAIN MEDICAL CENTER Lab Health Fair GENERAL HEALTH PANEL: CMP CMP The Comprehensive Metabolic Panel is used as a broad screening tool to evaluate organ function and check for conditions such
More information1/9/ :00:00AM 1/9/ :39:34AM 6/9/2017 9:08:54AM A/c Status. Test Name Results Units Bio. Ref. Interval 70.00
Lab No 135091545 Age 31 Years Gender Female 1/9/2017 120000AM 1/9/2017 103934AM 6/9/2017 90854AM Ref By Dr UNKNWON Final Test Results Units Bio Ref Interval ANTENATAL ANEL 1 SUGAR CHOICE (Hexokinase) 7000
More informationMEDICAL HISTORY. 23-Jan-2018 to 23-Jan VCA Miller-Robertson Animal Hospital 8807 Melrose Ave, Los Angeles, CA (310)
8807 Melrose Ave, Los Angeles, CA 90069 (310) 657-7050 MEDICAL HISTORY 23-Jan-2018 to 23-Jan-2018 Client Linnea Engdahl (1810) C: Linnea: (310) 351-9547 Patient Abby (6487) Canine Mixed Breed 3y (22-Jan-2015)
More informationADPedKD: detailed description of data which will be collected in this registry
ADPedKD: detailed description of data which will be collected in this registry I. Basic data 1. Patient ID: will be given automatically 2. Personal information - Date of informed consent: DD/MM/YYYY -
More informationSurvey of blood transfusion-induced malaria and other diseases in Thalassemia patients from Solapur District (M.S.) India.
7. CONCLUSION Over 125 patients affected by thalassemia live in Solapur District, Maharashtra, India. Thalassemia is a blood disease and is common in both sexes. Thalassemia was suspected in all these
More informationOccupation Agency Code Work Location Work Supervisor Duty tel. #
PRIVACY ACT STATEMENT: This information is subject to the Privacy Act of 1974 (5 U.S.C. Section 552a). This information may be provided to appropriate Government agencies when relevant to civil, criminal
More informationESM Table 2 Data extraction form and key data from included studies
ESM Table 2 Data extraction form and key data from included studies Author, year and title Behan, 2006 [21] Cessation of menstruation improves the correlation of FPG to hemoglobin A 1c in Caucasian women
More informationIt is our pleasure to announce that we are organizing a Preventive Care Health Checkup Camp for you members, Associates, Staff & their families.
Dear Friends, It is our pleasure to announce that we are organizing a Preventive Care Health Checkup Camp for you members, Associates, Staff & their families. It is said that Health is Wealth, but in this
More informationEffect of Vidahi-Tikshna-Ushna-Snigdh Ahara on Raktavaha Srotas An Experimental Study
Effect of Vidahi-Tikshna-Ushna-Snigdh Ahara on Raktavaha Srotas An Experimental Study Vd. Hitesh Vyas Dr. Anil D. Avhad Department of Basic Principles Institute for Post Graduate Teaching and Research
More informationGRADING CRITERIA for CMS Regulated Analytes
CLIA '88 AND GRADING The Clinical Laboratory Improvement Amendments of 1988 (CLIA '88) were established by the federal government (CMS) to regulate clinical laboratories and proficiency test providers
More informationChapter 14. Blood. Blood Volume. Blood Composition. Blood
Blood connective tissue transports vital substances maintains stability of interstitial fluid distributes heat Chapter 14 Blood Blood Cells form mostly in red bone marrow red blood cells white blood cells
More informationHamilton Regional Laboratory Medicine Program
Created: April 2002 of Review: February 2004 of Review: June 2006 of Review: July 2007, St. Joseph s Healthcare went live with Meditech as of June18, 2007. of Review: August 2009 of Review: December 2011;
More informationSMALL ANIMAL SOFT TISSUE CASE-BASED EXAMINATION
SMALL ANIMAL SOFT TISSUE CASE-BASED EXAMINATION CASE-BASED EXAMINATION INSTRUCTIONS The case-based examination measures surgical principles in case management prior to, during, and after surgery. Information
More informationHamilton Regional Laboratory Medicine Program
Created: April 2002 of Review: February 2004 of Review: June 2006 of Review: July 2007, St. Joseph s Healthcare went live with Meditech as of June18, 2007. of Review: August 2009 of Review: December 2011;
More informationBlood Test Results Report
Blood Test Results Report The Blood Test Results Report lists the results of the patient s Chemistry Screen and CBC and shows you whether or not an individual element is outside of the optimal range and/or
More informationHAEMATOLOGICAL EVALUATION OF ANEMIA. Sitalakshmi S Professor and Head Department of Clinical Pathology St John s medical College, Bangalore
HAEMATOLOGICAL EVALUATION OF ANEMIA Sitalakshmi S Professor and Head Department of Clinical Pathology St John s medical College, Bangalore Learning Objectives Laboratory tests for the evaluation of anemia
More informationHEMOLYTIC ANEMIA DUE TO ABNORMAL HEMOGLOBIN SYNTHESIS
Hemolytic Anemia Due to Abnormal Hemoglobin Synthesis MODULE 19 HEMOLYTIC ANEMIA DUE TO ABNORMAL HEMOGLOBIN SYNTHESIS 19.1 INTRODUCTION There are two main mechanisms by which anaemia is produced (a) Thalassemia:
More information1.) 3 yr old FS Siamese cat: 3 day history of lethargy, anorexia. Dyspneic, thin, febrile.
1.) 3 yr old FS Siamese cat: 3 day history of lethargy, anorexia. Dyspneic, thin, febrile. NUCLEATED CELLS 19.5 High 4.0-14.0 x 10^3/ul METAMYELOCYTES 9 % 1.8 High 0.0-0.0 x 10^3/ul BAND NEUTROPHILS 61
More informationSMALL ANIMAL SOFT TISSUE CASE- BASED EXAMINATION
SMALL ANIMAL SOFT TISSUE CASE- BASED EXAMINATION CASE-BASED EXAMINATION INSTRUCTIONS The case-based examination measures surgical principles in case management prior to, during, and after surgery. Information
More informationThe Blood Chemistry Panel Explained
The Blood Chemistry Panel Explained The Senior Profile (for senior and geriatric patients) As our dogs and cats enter their senior years, we recognize that they are more likely to have health problems
More informationNEW RCPCH REFERENCE RANGES-
s vary between populations and age groups and it is important to always check the reference Haematology: Haemoglobin Male 130 175 g/l 0 6 days 145-220 g/l Female 115 165 g/l 7 days 140-186 g/l 8 days 3
More informationPitfalls in the premarital testing for thalassaemia
Pitfalls in the premarital testing for thalassaemia Dr. Riad Amer MB ChB, MSc, FRCP, FRCPath, JBH Assistant Professor of Medicine Al Najah University Consultant Haematologist Case 1 Husband and Wife are
More informationIt is our pleasure to announce that we are organizing a Preventive Care Health Checkup Camp for you members, Associates, Staff & their families.
Dear Friends, It is our pleasure to announce that we are organizing a Preventive Care Health Checkup Camp for you members, Associates, Staff & their families. It is said that Health is Wealth, but in this
More informationno concerns hepatic shunt, high protein diet, kidney failure, metabolic acidosis
TAKING THE WORK OUT OF INTERPRETING LAB WORK CACVT 2017 SPRING CONFERENCE - GREENWOOD VILLAGE, CO Brandy Helewa, CVT, RVT, VTS (ECC) Penn Foster College - Scranton, PA Knowing what the results on your
More informationSenior Executive Wellness Profile
Senior Executive Wellness Profile Comprehensive 86 tests from one blood sample to check your current health Patient Name: Elite Business Center, st Floor, # 05 Al Barsha, Behind Mall of Emirates, Dubai,
More informationAustralian and New Zealand College of Veterinary Scientists. Membership Examination. Small Animal Medicine Paper 1
Australian and New Zealand College of Veterinary Scientists Membership Examination June 2017 Small Animal Medicine Paper 1 Perusal time: Fifteen (15) minutes Time allowed: Two (2) hours after perusal Answer
More informationComplete Blood Count (CBC) Assist.Prof. Filiz BAKAR ATEŞ
Complete Blood Count (CBC) Assist.Prof. Filiz BAKAR ATEŞ The complete blood count (CBC) is one of the most common blood test used. It analyzes the three major types of cells in blood 1. red blood cells,
More informationCOMPANY OR UNIVERSITY
CONTRIBUTOR NAME Daniel Heinrich, DVM CONTRIBUTOR EMAIL dheinric@umn.edu COAUTHORS Jed Overmann, DVM, DACVP; Davis Seelig DVM, PhD, DACVP & Matthew Sturos, DVM COMPANY OR UNIVERSITY University of Minnesota
More informationMHD I Session VIII Renal Disease November 6, 2013 STUDENT COPY
MHD I, Session VIII, Student Copy Page 1 MHD I Session VIII Renal Disease November 6, 2013 STUDENT COPY MHD I, Session VIII, Student Copy Page 2 Case #1 Chief Complaint: I have been feeling just lousy
More informationEfficacy of the AGRO-JET MIT-II NEEDLE-LESS JET INJECTOR for Iron Dextran Administration in Piglets
Almond, Page 1 Efficacy of the AGRO-JET MIT-II NEEDLE-LESS JET INJECTOR for Iron Dextran Administration in Piglets Final Report to Karim Menassa Medical International Technologies 2281 Guenette St-Laurent,
More informationBiol Chapter 17 Cardiovascular & Blood
Collin County Community College Biol. 2402 Chapter 17 Cardiovascular & Blood 1 CVS and Public Health 2 1 CVS and Public Health 3 Cardio Vascular System 4 2 Cardio Vascular System: BLOOD Functions of Blood
More informationSMITH, JOHN D.C. Functional Health Report Practitioner Copy JANE DOE. Lab Test on Mar 11, 2017 Conventional US Units
SMITH, JOHN D.C. Functional Health Report Practitioner Copy JANE DOE Conventional US Units Table of Contents Health Improvement Plan 3 This report shows customized recommendations based on the blood test
More informationResults Report. Welcome to Your ABT Report! Introduction to the ABT Report
Results Report Athlete Name: SHEPPARD, JOSEPH Date of Blood Draw: Dec 08, 2017 Panel: ABT Gold Panel ABT Expert: Dr. Rock Welcome to Your ABT Report! Thank you for trusting AthleteBloodTest.com to be a
More informationCytochrome-C (rat, mouse) forward GGAGGCAAGCATAAGACTGG. mouse hexokinase 2 gene, intron 9 reverse GGGAACACAAAAGACCTCTTCTGG
Supplementary Table 1. The sequences of oligonucleotide primers. Genes Sequence rat actin forward CGAGTACAACCTTCTTGCAG rat actin reverse GAGTCCTTCTGACCCATACC tubulin (rat, mouse) forward TAGCAGAGATCACCAATGCC
More informationFBC interpretation. Dr. Gergely Varga
FBC interpretation Dr. Gergely Varga #1 71 Y/O female, c/o weakness Test Undertaken : FBC (FBC) Sample Type: Whole Blood [ - 26.09.11 14:59] Hb 7.3 g/dl* 12.0-15.5 RBC 3.5 10^12/l * 3.80-5.60 Hct 0.24
More informationCASE-BASED SMALL GROUP DISCUSSION
MHD I, Session 13, STUDENT Copy Page 1 CASE-BASED SMALL GROUP DISCUSSION SESSION 13 MHD I Autoimmunity November 10, 2016 STUDENT COPY MHD I, Session 13, STUDENT Copy Page 2 Case 1 CHIEF COMPLAINT: I am
More informationGenetics of Thalassemia
Genetics of Thalassemia Submitted by : Raya Samir Al- Hayaly Sura Zuhair Salih Saad Ghassan Al- Dulaimy Saad Farouq Kassir Sama Naal Salouha Zahraa Jasim Al- Aarajy Supervised by : Dr. Kawkab Adris Mahmod
More informationi. Where is the participant seen?
PFU01 method used: Phone/in-person interview 1 Enter PIP # here: Online survey 2 Enter Web # here: Initials of person completing form: Date Form Completed: / / Form Version: 03 / 01 / 18 Is the participant
More informationLABORATORY NORMAL RANGES. Prepared by Date Adopted Supersedes Procedure # / Dated William T. Pope, PhD and
Prepared by Date Adopted Supersedes Procedure # / Dated William T. Pope, PhD and 3-31-09 Normal Ranges / 12-30-08 Christy O Brien, MT (ASCP) CHEMISTRY Acetone None detected Albumin, g/dl 3.5-5.0 Adult
More informationHEMOTOLOGY. B. Helps stabilize body temperature -heats up and cools down slowly which moderates body temp
I. Body H 2 O = HEMOTOLOGY A. Variable quantities 1. sweating and urination ( ) decreases H 2 O 2. drinking H 2 O increases B. Water is found in two compartments 1. contains 2/3 of all water in your body
More information*** To get the most out of this report and the consultation, send us blood test results that cover as many of the following markers as possible:
Rick Gold, Certified FDN Practitioner Gold Functional Wellness, Inc. Web: http://goldfunctionalwellness.com/ Phone: (561)270-6364 Email: Rick@goldfunctionalwellness.com Schedule a consultation: https://snapappointments.com/listing/38c
More informationUTILITY OF ERYTHROCYTE INDICES FOR SCREENING OF β THALASSEMIA TRAIT IN PREGNANT WOMEN ATTENDING ANTENATAL CLINIC
UTILITY OF ERYTHROCYTE INDICES FOR SCREENING OF β THALASSEMIA TRAIT IN PREGNANT WOMEN ATTENDING ANTENATAL CLINIC Dr. Ashok Kumar Sharma* 1, Dr. Sudhir Mehta 2, Dr. Shrikant Sharma 3 1 Medical Officer,
More informationWhat are the functions of blood?
What are the functions of blood? Transportation: oxygen, nutrients, wastes, carbon dioxide, nitrogen from amino acids and hormones, lipoproteins HDL and LDL Hemoglobin carries oxygen and CO2, (CO poisoning)
More informationLabDriver Audit Trail Example
LabDriver Audit Trail Example Sample details:= (SampleDId=82051) Lab no: 0902168 Centre: CR Centre (CentreId=1079) (BatchSId=1317) Status: Checked Blood date: 13/05/2009 time: 11:31:00 lab received: 13/05/2009
More informationWeight. Your weight. Body Mass Index Measure of weight to hei. Total to HDL Ratio Total Cholesterol to HDL
Lab Results for Jason Sissel Last Test Date: 2014-11-18 Vital Signs While vital signs often do not give as much specific information as blood tests, they are commonly tracked as macroscopic measures of
More informationWeight Your weight. Body Mass Index Measure of weight to hei. Total to HDL Ratio Total Cholesterol to HDL
Lab Results for Jason Sissel Last Test Date: 2014-12-19 Vital Signs While vital signs often do not give as much specific information as blood tests, they are commonly tracked as macroscopic measures of
More informationEDUCATIONAL COMMENTARY MORPHOLOGIC CHANGES IN PERIPHERAL BLOOD CELLS
EDUCATIONAL COMMENTARY MORPHOLOGIC CHANGES IN PERIPHERAL BLOOD CELLS Educational commentary is provided through our affiliation with the American Society for Clinical Pathology (ASCP). To obtain FREE CME/CMLE
More informationSMITH, JOHN D.C. Functional Health Report. Patient Copy JANE DOE. Lab Test on Mar 11, 2017 Conventional US Units
SMITH, JOHN D.C. Functional Health Report Patient Copy JANE DOE Conventional US Units Table of Contents Health Improvement Plan 3 This report shows customized recommendations based on the blood test results.
More informationFull Blood Count analysis Is a 3 part-diff good enough? Dr Marion Münster, Sysmex South Africa
Full Blood Count analysis Is a 3 part-diff good enough? Dr Marion Münster, Sysmex South Africa The Role of the FBC in clinical decision making History Examination Investigations Decision 70% FBC Laboratory
More informationChemistry Reference Ranges and Critical Values
Alanine Aminotransferase (ALT, SGPT) 3-9 years 9-18 years 1-9 years 9-18 years 10-30 U/L 10-30 U/L 10-20 U/L Albumin 0-6 days 6 days - 37 months 37 months - 7 years 7-20 years 2.6-3.6 g/dl 3.4-4.2 g/dl
More informationChemistry Reference Ranges and Critical Values
Alanine Aminotransferase (ALT, SGPT) 3-9 years 9-18 years 1-9 years 9-18 years 10-25 U/L 10-35 U/L 10-30 U/L 10-25 U/L 10-30 U/L 10-35 U/L 10-25 U/L 10-35 U/L 10-25 U/L 10-20 U/L 10-35 U/L Albumin 0-6
More informationHLS Midterm ( )
HLS Midterm (2012-2013) 1. Which of the following cells increase in level during allergic reactions? (a) Neutrophils (b) Basophils (c) Eosinophils (d) Lymphocytes (e) Monocytes 2. Which of the following
More informationMHD I SESSION X. Renal Disease
MHD I, Session X, Student Copy Page 1 CASE-BASED SMALL GROUP DISCUSSION MHD I SESSION X Renal Disease Monday, November 11, 2013 MHD I, Session X, Student Copy Page 2 Case #1 Cc: I have had weeks of diarrhea
More informationWELLNESS LABS EXPLANATION OF RESULTS BASIC METABOLIC PANEL
WELLNESS LABS EXPLANATION OF RESULTS BASIC METABOLIC PANEL BUN Blood Urea Nitrogen (BUN) is a waste product of protein breakdown and is produced when excess protein in your body is broken down and used
More informationPHYSICAL PROPERTIES AND DETECTION OF NORMAL CONSTITUENTS OF URINE
PHYSICAL PROPERTIES AND DETECTION OF NORMAL CONSTITUENTS OF URINE - OBJECTIVES: 1- The simple examination of urine. 2- To detect some of the normal organic constituents of urine. 3- To detect some of the
More informationChapter 19: The Cardiovascular System: The Blood. Copyright 2009, John Wiley & Sons, Inc.
Chapter 19: The Cardiovascular System: The Blood Blood Liquid connective tissue 1. Transportation - Gases, nutrients, hormones, and waste. 2. Regulation - ph, body temperature, and blood pressure. 3. Protection
More informationCASE-BASED SMALL GROUP DISCUSSION
MHD I, Session XII, Student Copy Page 1 CASE-BASED SMALL GROUP DISCUSSION Session XII MHD I Friday, November 15, 2013 STUDENT COPY MHD I, Session XII, Student Copy Page 2 Case 1 CHIEF COMPLAINT: I am very
More informationOnline catalog
This catalog contains information about tests performed at Green Clinic Laboratory. For samples to be sent to Quest Diagnostics or any other reference lab please contact the Green Clinic Laboratory (318-251-6378)
More informationStudy. Human Tolerance of Low Molecular Weight. Polyethylene Markers. Prof. Dr. Dr. Ruprecht Keller. Krankenhaus Merheim Zentrallabor
Study Human Tolerance of Low Molecular Weight Polyethylene Markers Prof. Dr. Dr. Ruprecht Keller Krankenhaus Merheim Zentrallabor Ostmerheimerstr. 00 509 Köln Human Tolerance of Low Molecular Weight Polyethylene
More informationAustralian and New Zealand College of Veterinary Scientists. Fellowship Examination. Veterinary Clinical Pathology Paper 1
Australian and New Zealand College of Veterinary Scientists Fellowship Examination June 2012 Veterinary Clinical Pathology Paper 1 Perusal time: Twenty (20) minutes Time allowed: Three (3) hours after
More informationCASE-BASED SMALL GROUP DISCUSSION MHD II
MHD II, Session 11, Student Copy Page 1 CASE-BASED SMALL GROUP DISCUSSION MHD II Session 11 April 11, 2016 STUDENT COPY MHD II, Session 11, Student Copy Page 2 CASE HISTORY 1 Chief complaint: Our baby
More informationPaper ID: ART
analytical process. Delayed sample analysi changes of measured parameters co interpretation of results. Pre-analytical variables, such as stor temperature affect the measurement parameters collected in
More informationPediatric and Adult Reference Intervals for Chemistry, Immunoassay, and Hematology Markers based on the CHMS
Pediatric and Adult Reference Intervals for Chemistry, Immunoassay, and Hematology Markers based on the CHMS Victoria Higgins, MSc Candidate CALIPER Project The Hospital for Sick Children, Toronto, Canada
More information