2013/11/29 Version 2
|
|
|
- Cordelia Franklin
- 5 years ago
- Views:
Transcription
1 1 2013/11/29 Version 2
2 2
3 3
4 4
5 5
6 6
7 7
8 8
9 9
10 wew.bhp.doh.gov.tw/bhpnet/portal/file/statisticsfile/ /99.pdf
11 wew.bhp.doh.gov.tw/bhpnet/portal/file/statisticsfile/ /99.pdf
12 12 NCI Cancer Research UK
13 13
14 14
15 99 15
16 ( ) 20 X pdf 16
17 30 ( ) ( )
18 50-74 ( ) ( ) pdf
19 30 18 ( ) 3 ( ) pdf 19
20 20
21 P.45
22 22
23 23
24 24
25 25 -
26 26 -
27 27 -
28 28 -
29 29 -
30 HPV HPV 30 HPV 30 Centers for Disease Control and Prevention
31
32 ( ) 32
33 % 33
34 P
35 / (WBC) (RBC) (Hb) (PLT) ; (Hb) (Ht) (MCV) (MCHC) (RDW) MCV MCH MCHC Ht 35
36 BC GOT GPT GOT GPT GOT GPT 36
37 B B B CC GOT/GPTC B HBsAg B Anti-HBs B B ( ) B Anti-HBc B C Anti-HCV C 37
38 Tumor marker P.272
39 Tumor marker / (AFP) (PSA) (CEA) (CA125)
40 X 40
41 () ( ) 7-8(10~12 c.c. ) 41
42 42
43
44 44
45 X X X 45
46 X X 46
47 X X4 ( )( ) 47
48 48
49 X 49
50
51 Jelly
52 52
53 Jelly 53
54 54
55 ( ( 200ml)) (Dulcolax supp) 0.5~1 html 55
56 56
57 57
58 95% 58
59 3D 1 90% % % 15% 59
60 ( ( cm)
61 2-3 ( ( 200ml)) 61
62 62
63 () ( ) ( ) 63
64 64
65 65
66 PSA 66
67 67
68 68
69 69
70 CT LDCT MRI PET 70
71 CT X X X CRE
72 CT X
73 CT 73
74 CT
75 LDCT X 20X 1 X 1-3cm X 0.5cm 75 1.Reference: National Lung Screening Trial Research Team. Reduced Lung-Cancer Mortality with Low-Dose Computed Tomographic Screening. NEJM. Online June 29, In print, August 4,
76 LDCT 76
77 MRI 77
78 MRI 4-6 X 78
79 MRI 79
80 PET FDG E5%8E%9F%E7%90%862.htm#c 80
81 PET 4-6 FDG 45 FDG %b8%e9%86%ab%e6%aa%a2%e6%9f%a5.aspx
82 PET 82
83 PET FDG E8%85%A6%E6%96%B7%E5%B1%A4%E9%80%A0%E5%BD%B1%E5%8E%9F%E7%90%862.htm#c
84 84
85
86 2 5 2 X
87 BC X X
88 B X
89 89
90 90
91 91
92 ( ) 92
93 / X 20 ( ) ( ) ( ) 3 93
94
95 SGOT SGPT 95
96 96
97 97
98 98
99 ( ) 100 NCI ACS Cancer Research UK Centers for Disease Control and Prevention National Lung Screening Trial Research Team. Reduced Lung-Cancer Mortality with Low-Dose Computed Tomographic Screening. NEJM. 99
100 - X - 100
101 - 101
102 National Cancer Institute - 102
103 103
104 104
NOTE: This table will be discontinued after this lot.
AS037-011 Rev. 11/14 ASSAY VALUES AND EXPECTED RANGES QCP DATA MONTHS: DEC, JAN, FEB Beckman Coulter STKS / MAXM / HMX LEVEL 1 + Lot No.: Exp. Date: LOT 871086 Parameter Mean Range WBC 10 3 /µl 4.0 ± 0.6
ACCREDITATION DOCUMENT
Accreditation No: Awarded to Dow Diagnostic Reference and Research Laboratory (DDRRL), Dow University of Health Sciences Suparco Road Gulzar e Hijri KDA Scheme-35, Karachi, Pakistan. The scope of accreditation
Icd code for cbc with differential/ platelet
Icd code for cbc with differential/ platelet Code. Description. Test. Code. dialysis status. Medically Supportive ICD Codes are listed. The complete blood count (CBC) includes a CBC (includes Differential
Get to know yourself better. Attend our health screening event.
Gateway Technical College Get to know yourself better. Attend our health screening event. Putting your knowledge to action is Powerful. Get the information and guidance you need with the Wellness Screening
3. Blood Cell Histograms:
LECTURE MODULE 6c: ELECTRONIC CELL COUNTING PART III 3. Blood Cell Histograms: a. The Coulter cell counters today provides size distributions of the cellular content: 1) volume given in µm 3 or fl vs relative
Investigation into the molecular mechanism of action of Triticum aestivum for its activity in Thalassemia
Investigation into the molecular mechanism of action of Triticum aestivum for its activity in Thalassemia Clinical study: The clinical study Investigation into the molecular mechanism of action of Triticum
Get to know yourself better. Attend our health screening event.
Get to know yourself better. Attend our health screening event. Putting your knowledge to action is Powerful. Get the information and guidance you need with the Wellness Screening Program. 1 SIMPLE ACTION
Annex to the Accreditation Certificate D-EP according to DIN EN ISO/IEC 17043:2010
Deutsche Akkreditierungsstelle GmbH Annex to the Accreditation Certificate D-EP-19851-01-00 according to DIN EN ISO/IEC 17043:2010 Period of validity: 10.04.2017 to 21.01.2021 Holder of certificate: ESfEQA
Reduction of metastatic and angiogenic potency of malignant cancer by Eupatorium. fortunei via suppression of MMP-9 activity and VEGF production
Supplementary Information Reduction of metastatic and angiogenic potency of malignant cancer by Eupatorium fortunei via suppression of MMP-9 activity and VEGF production Aeyung Kim, Minju Im, Nam-Hui Yim
JKMU. Introduction. Original article. Oxidative stress Total antioxidant capacity Hematological parameters Diabetes Rosa canina Mice
JKMU Journal of Kerman University of Medical Sciences, 2017; 24(2): 132-140 The Effects of Fruit Hydro alcoholic Extract on Oxidative Stress, Total Antioxidant Capacity and Haematological Parameters in
Wellness is a state of complete harmony of BODY, MIND & SPIRIT
Wellness is a state of complete harmony of BODY, MIND & SPIRIT Index About Us Specialty Clinics Corporate Wellness Jehangir Silver & Gold Jehangir Platinum (Whole Body Screening) Jehangir Comprehensive
NORMAL LABORATORY VALUES FOR CHILDREN
Pediatric Drug Lookup Normal Laboratory Values for NORMAL LABORATORY VALUES FOR CHILDREN CHEMISTRY Normal Values Albumin 0-1 y 2.0-4.0 g/dl 1 y to adult 3.5-5.5 g/dl Ammonia Newborns 90-150 mcg/dl 40-120
Have a Health Screening once a year!
Have a Health Screening once a year! It is everybody s wish to be healthy in body and mind. A full Japan Green Medical Centre Health Screening can support you in attaining this goal by comprehensively
Laboratory Millennium Special Pathology Laboratory, Office No. 10, 11, 12, First Floor, N.K. Image, Tilak Road, 2015 Sadashiv Peth, Pune, Maharashtra
Last Amended on - Page 1 of 18 Specific Method Range of ing / I. CLINICAL BIOCHEMISTRY ENDOCRINOLOGY TESTS THYROID HORMONES 1. SERUM Triiodothyronine (T3) Chemiluminescence 0.1 8 ng/ml 6.8 2. SERUM Thyroxine
Annex to the Accreditation Certificate D-EP according to DIN EN ISO/IEC 17043:2010
Deutsche Akkreditierungsstelle GmbH Annex to the Accreditation Certificate D-EP-19851-01-00 according to DIN EN ISO/IEC 17043:2010 Period of validity: 24.08.2018 to 21.01.2021 Holder of certificate: ESfEQA
Hepatitis A virus (HAV)
Volume 3, Issue 1 (Jan 2010) Editor s note Happy New Year and welcome to the first issue of QA Highlights of year 2010! In this issue, we are happy to bring to you Hepatitis Infection and Clinical Detection
CASE-BASED SMALL GROUP DISCUSSION
MHD II, Session XII, STUDENT Copy Page 1 CASE-BASED SMALL GROUP DISCUSSION Session XII MHD II April 21, 2014 STUDENT COPY Helpful Resource: ACP Medicine online available through LUHS Library Infectious
SMALL GROUP DISCUSSION
MHD II, Seesion II Student Copy - Page 1 SMALL GROUP DISCUSSION MHD II Session II JANUARY 15, 2014 Recent Review highlighting disease process in Case 2: Fasano A, Catassi, C. NEJM 2012; 367: 2419-26 STUDENT
E#ect of Iron Solubilized by Lactoferrin on Iron Status in Adult Women
442 Nippon Shokuhin Kagaku Kogaku Kaishi Vol. /., No.+*,..,..0 (,**1) 18 E#ect of Iron Solubilized by Lactoferrin on Iron Status in Adult Women Mutsumi Motouri, Ran Emilie Yoshise, Hiroaki Matsuyama, Tomohiro
Complete Blood Count (CBC)
Complete Blood Count (CBC) Objectives 1. To estimate the number of RBC in blood sample 2. To estimate the number of total WBC in blood sample 3. To perform a differential count for a blood sample Introduction
Thyroid Care & Diagnostic Centre
Thyroid Care & Diagnostic Centre Laboratory Test List DEPARTMENT OF CLINICAL PATHOLOGY BLOOD : CBC HCT/ PCV Hb, TC, DC & ESR MCV CE MCH PC MCHC MP Reticulocyte count PBF LE Cell Hb-Electrophoresis Protin
Non-transfusion-dependent thalassemia (NTDT) Bor-Sheng Ko, M.D. Ph.D. Meng-Yao Lu, M.D. National Taiwan University Hospital
Non-transfusion-dependent thalassemia (NTDT) Bor-Sheng Ko, M.D. Ph.D. Meng-Yao Lu, M.D. National Taiwan University Hospital Introduction Transfusion dependency in thalassemia Transfusions seldom required
MHD I SESSION X. Renal Disease
MHD I, Session X, Student Copy Page 1 CASE-BASED SMALL GROUP DISCUSSION MHD I SESSION X Renal Disease Monday, November 11, 2013 MHD I, Session X, Student Copy Page 2 Case #1 Cc: I have had weeks of diarrhea
14/05/2013,, 50,,, 16 /4/2012, 2,. 38,5,.,.., (30py).,. ( t:36,7%, Hb:11,8g/dl), (PLT: ) (WBC:2400, lymph:700),, 2 /2012,. 1
,, 50,,, 16 /4/2012, 2,. 38,5,.,.., (30py).,. ( t:36,7%, Hb:11,8g/dl), (PLT:114.000) (WBC:2400, lymph:700),, 2 /2012,. 1 Ht 36.7 Hb 11.8 2.400 67/29 114 MCV 88 33 CRP 0.54 PCT 0.24 Fe 58 790 ng/ml INR
HEALTH SCREEN CARE. VIGNE Healthcare provides a comprehensive Health Screening Package of EXCLUSIVE HEALTH SCREENING EXPERIENCE
HEALTH SCREEN CARE VIGNE Healthcare provides a comprehensive Health Screening Package of Silver Gold Platinum Cancer EXCLUSIVE HEALTH SCREENING EXPERIENCE Meet & Greet Medical Review with Doctor Appointment
Clinician Blood Panel Results
Page 1 of 7 Blood Panel - Markers Out of Range and Patterns (Pattern: proprietary formula using one or more Blood Markers) Blood Panel: Check for Markers that are out of Lab Range ***NOTE*** Only one supplement
ד"ר דוד ירדני המכון לגסטרואנטרולוגיה ומחלות כבד מרכז רפואי סורוקה
ד"ר דוד ירדני המכון לגסטרואנטרולוגיה ומחלות כבד מרכז רפואי סורוקה Presentaion: S.A is 38 years old. Referred for rectal bleeding investigation. Describes several occasions of bleeding and abdominal pain.
Collect and label sample according to standard protocols. Gently invert tube 8-10 times immediately after draw. DO NOT SHAKE. Do not centrifuge.
Complete Blood Count CPT Code: CBC with Differential: 85025 CBC without Differential: 85027 Order Code: CBC with Differential: C915 Includes: White blood cell, Red blood cell, Hematocrit, Hemoglobin, MCV,
AN INTERESTING CASE OF ANEMIA WITH AN UNEXPECTED TWIST. Dr SUDHEER
AN INTERESTING CASE OF ANEMIA WITH AN UNEXPECTED TWIST Dr SUDHEER A 53 yrs old female PRESENTED WITH - Sudden onset of Loss of consciousness at 10 pm in night : - lasting for 5 minutes - sustained head
BASIC METABOLIC PANEL
Update 2/12/2018 BASIC METABOLIC PANEL CPT 80048 Stability: 3 days at 15-25 C; 7 days at 2-8 C; > 7 days at -70 C Colorimetric Assay, Rate reaction, ISE Components: BUN, Calcium, Chloride, CO2, Creatinine,
Institute of Singapore Chartered Accountants Classic Package - $280 (before GST)
Institute f Singapre Chartered Accuntants Classic Package - $280 (befre GST) 1. Cmplete Medical Examinatin 2. Persnal/ Family Medical Histry 3. Height/ Weight/ Waist Circumference 4. Bdy & Visceral Fat
Cavitary Pulmonary Nontuberculous Mycobacterium Infection in an Adult Patient with Cyanotic Congenital Heart Disease
PEDIATRIC CARDIOLOGY and CARDIAC SURGERY VOL. 25 NO. 1 (56 60) 1 1 1 2 2 3 4 1 2 3 4 Cavitary Pulmonary Nontuberculous Mycobacterium Infection in an Adult Patient with Cyanotic Congenital Heart Disease
ד"ר דוד ירדני המכון לגסטרואנטרולוגיה ומחלות כבד מרכז רפואי סורוקה
ד"ר דוד ירדני המכון לגסטרואנטרולוגיה ומחלות כבד מרכז רפואי סורוקה Presentation: S.A is 25 years old. Referred to a gastroentrologist because of abdominal pain and bloody diarrhea in the last few weeks.
DATA DRIVEN TUMOR MARKER PREDICTION SYSTEM
DATA DRIVEN TUMOR MARKER PREDICTION SYSTEM Witold Jacak (a), Karin Proell (b), Herbert Stekel (c) (a) Department of Software Engineering Upper Austria University of Applied Sciences Hagenberg, Softwarepark
DATA DRIVEN TUMOR MARKER PREDICTION SYSTEM
DATA DRIVEN TUMOR MARKER PREDICTION SYSTEM Witold Jacak (a), Karin Proell (b), Herbert Stekel (c) (a) Department of Software Engineering Upper Austria University of Applied Sciences Hagenberg, Softwarepark
Complete Blood Count (CBC) Assist.Prof. Filiz BAKAR ATEŞ
Complete Blood Count (CBC) Assist.Prof. Filiz BAKAR ATEŞ The complete blood count (CBC) is one of the most common blood test used. It analyzes the three major types of cells in blood 1. red blood cells,
AVAILABLE CHECK-UP PACKAGES FOR HOSPITALS
Hospital Standart Economic Cardiology Antalya Training & Research Hospital For smokers Pediatric Women under 40 Women over 40 Men under 40 Men over 40 VIP Women X X X Kemer State Hospital X X X X X X X
M. Velizarova, T. Yacheva and K. Tzatchev Department of Clinical Laboratory and Clinical Immunology, MU Sofia
50, 48, 2012, 3, ADVIA 2120.,.., ANALYSIS OF DIAGNOSTIC RED CELL CYTOGRAMS, GENERATED BY THE ADVIA 2120 HEMATOLOGY ANALYZER M. Velizarova, T. Yacheva and K. Tzatchev Department of Clinical Laboratory and
Clinician Blood Panel Results
Page 1 of 8 Blood Panel - Markers Out of Range and Patterns (Pattern: proprietary formula using one or more Blood Markers) Blood Panel: Check for Markers that are out of Lab Range ***NOTE*** Only one supplement
A Look Into the Determination of Cell Morphology in Hematology in the 21 st Century. Ramon Simon-Lopez, MD Global Scientific Director Beckman Coulter
A Look Into the Determination of Cell Morphology in Hematology in the 21 st Century Ramon Simon-Lopez, MD Global Scientific Director Beckman Coulter Is cell morphology important? AML M7 CLL CD5 CD19 NHL
10 Essential Blood Tests PART 1
Presents 10 Essential Blood Tests PART 1 The Blood Chemistry Webinars With DR. DICKEN WEATHERBY Creator of the Blood Chemistry Software Essential Blood Test #1: Basic Chem Screen and CBC http://bloodchemsoftware.com
Laboratory for diagnosis of THALASSEMIA
SCBM343 CLINICAL PATHOLOGY 2(1-2-3) Laboratory for diagnosis of THALASSEMIA PORNTHIP CHAICHOMPOO pornthip.chh@mahidol.ac.th Acknowledgements Dr. Pranee Winichagoon Fucharoen Ms. Pornnapa Khampan Thalassemia
Case 72 y/o male Past hx : 1. Ampulla of Vater cancer s/p whipple operation 2. Liver abscess with K.P. 3. GI bleeding 4. DM No drug allergy
Presenter : R2 周光緯 Supervisor :VS 連楚明 Case 72 y/o male Past hx : 1. Ampulla of Vater cancer s/p whipple operation 2. Liver abscess with K.P. 3. GI bleeding 4. DM No drug allergy 2012.08.15 2/45 ER visit
ADPedKD: detailed description of data which will be collected in this registry
ADPedKD: detailed description of data which will be collected in this registry I. Basic data 1. Patient ID: will be given automatically 2. Personal information - Date of informed consent: DD/MM/YYYY -
HM5. Hematology Analyzer BETTER. ACTUALLY.
HM5 Hematology Analyzer BETTER. ACTUALLY. Advanced Hematology Five-Part Differential The VetScan HM5 is a fully automated five-part differential hematology analyzer displaying a comprehensive 24-parameter
Clinical Pathology Data from Cynomolgus Monkeys from China in which Diarrhea Was Observed during Quarantine
Exp. Anim. 57(2), 139 143, 2008 Note Clinical Pathology Data from Cynomolgus Monkeys from China in which Diarrhea Was Observed during Quarantine Yan-Wei LIU 1, 2), Syusaku SUZUKI 1), Masatoshi KASHIMA
Color: Gray/Yellow. 5/7/2018 L Hematology results from IDEXX VetLab In-clinic Laboratory Requisition ID: 0 Posted Final Test Result Reference Range
5/7/2018 L LD AA-Urinalysis results from IDEXX VetLab In-clinic COLLECTION = free catch COLOR = yellow CLARITY = clear SP GR = 1.020 GLUCOSE = neg BILIRUBIN = neg KETONE = neg BLOOD = neg PH = 6.0 PROTEIN
LABORATORY NORMAL RANGES. Prepared by Date Adopted Supersedes Procedure # / Dated William T. Pope, PhD and
Prepared by Date Adopted Supersedes Procedure # / Dated William T. Pope, PhD and 3-31-09 Normal Ranges / 12-30-08 Christy O Brien, MT (ASCP) CHEMISTRY Acetone None detected Albumin, g/dl 3.5-5.0 Adult
Full Blood Count analysis Is a 3 part-diff good enough? Dr Marion Münster, Sysmex South Africa
Full Blood Count analysis Is a 3 part-diff good enough? Dr Marion Münster, Sysmex South Africa The Role of the FBC in clinical decision making History Examination Investigations Decision 70% FBC Laboratory
Parkview Health Laboratories Health Fair Information
FAX SHEET.doc Thank you for choosing Parkview Health Laboratories (PHL) for your laboratory needs. We value the opportunity in providing laboratory services for your specific group or organization. PHL
Cytochrome-C (rat, mouse) forward GGAGGCAAGCATAAGACTGG. mouse hexokinase 2 gene, intron 9 reverse GGGAACACAAAAGACCTCTTCTGG
Supplementary Table 1. The sequences of oligonucleotide primers. Genes Sequence rat actin forward CGAGTACAACCTTCTTGCAG rat actin reverse GAGTCCTTCTGACCCATACC tubulin (rat, mouse) forward TAGCAGAGATCACCAATGCC
"The injury prevented need not be mended"
"The injury prevented need not be mended" The secret to a long, healthy life is to detect early and treat early. It is well known around the world that Japan has a high life expectancy even among advanced
MEDICAL HISTORY. 23-Jan-2018 to 23-Jan VCA Miller-Robertson Animal Hospital 8807 Melrose Ave, Los Angeles, CA (310)
8807 Melrose Ave, Los Angeles, CA 90069 (310) 657-7050 MEDICAL HISTORY 23-Jan-2018 to 23-Jan-2018 Client Linnea Engdahl (1810) C: Linnea: (310) 351-9547 Patient Abby (6487) Canine Mixed Breed 3y (22-Jan-2015)
CHARACTERISATION OF THE PHYSIOLOGICAL STATUS OF HARE HERDS
Lucrări Ştiinţifice - Seria Zootehnie, vol. 61 CHARACTERISATION OF THE PHYSIOLOGICAL STATUS OF HARE HERDS Il. Mihalache 1*, M. Munteanu 2, Roxana Lazăr 2, P.C. Boişteanu 2 1 Transilvania University of
A Study on the Relationship between CBC and EEG for Epilepsy Patients
ORIGINAL ARTICLE Korean J Clin Lab Sci. 2015, 47(4):225-229 http://dx.doi.org/10.15324/kjcls.2015.47.4.225 pissn 1738-3544 eissn 2288-1662 Korean J Clin Lab Sci. Vol. 47, No. 4, Dec. 2015 225 A Study on
ANNUAL HEALTH CHECKUP BASIC HEALTH PACKAGE
ANNUAL HEALTH CHECKUP Taking care of your health is our responsibility and to make sure that you remain at a distance from the serious maladies, we also step forward in providing health checkups. This
Testing Kits. Pregnancy Test Kits. Hepatitis Test Kits. HIV - 1 & 2 Test Kits
Pregnancy Test Kits Sr Item Name Store At Pack Size 1 hcg Card Test 2 hcg Card Test 3 Hope hcg Card Test 4 hcg Dipstick Test 5 LH Surge Card Test 5 T 6 LH Surge Card Test 10 T Hepatitis Test Kits 7 HCsAg
CARDIOVASCULAR CASE-BASED SMALL GROUP DISCUSSION
MHD I Session VIII Student Copy Page 1 CARDIOVASCULAR CASE-BASED SMALL GROUP DISCUSSION MHD I SESSION VIII OCTOBER 22, 2014 STUDENT COPY MHD I Session VIII Student Copy Page 2 Case 1 Chief Complaint I
1/9/ :00:00AM 1/9/ :39:34AM 6/9/2017 9:08:54AM A/c Status. Test Name Results Units Bio. Ref. Interval 70.00
Lab No 135091545 Age 31 Years Gender Female 1/9/2017 120000AM 1/9/2017 103934AM 6/9/2017 90854AM Ref By Dr UNKNWON Final Test Results Units Bio Ref Interval ANTENATAL ANEL 1 SUGAR CHOICE (Hexokinase) 7000
DR SUDHIR MEHTA MD,MNAMS,FICP. Senior Professor & Head Medical Unit SMS Medical College & Hospital Jaipur
DR SUDHIR MEHTA MD,MNAMS,FICP Senior Professor & Head Medical Unit SMS Medical College & Hospital Jaipur s.smehta@hotmail.com CBC..What is the Utility of performing this basic Hematology Test? 10/31/2010
The LaboratoryMatters
Laboratory Medicine Newsletter for clinicians, pathologists & clinical laboratory technologists. A Initiative. Complete Blood Count This issue highlights: CBC, while ubiquitous, is an excellent diagnostic
Scedosporium apiospermum
223 Scedosporium apiospermum 1 1) 2) 3) 4) 5) 1) 2) 3) 4) 5) 16 7 14 16 10 12 Candida Aspergillus 82 2000 10 2001 1 12 MRI 2 1 Scedosporium apiospermum Key words: Scedosporium apiospermum, Aspergillus,
PROFILES MENU. Page no. 9 Page no. 8 Page no. 7 Page no. 6 Page no. 5. Page no. 2. Page no. 4 Page no. 3
Health Profiles PROFILES MENU Page no. 1 Page no. 2 Page no. 4 Page no. 3 1 Basic Metabolic Panel (BMP) 2 Liver Function Tests (LFT) 3 Comprehensive Metabolic Panel (CMP) 4 Lipid Profile 5 Chem 7 Panel
SMALL GROUP DISCUSSION
MHD II, Session 2 Student Copy - Page 1 SMALL GROUP DISCUSSION MHD II Session 2 Gastroinestinal JANUARY 12, 2017 STUDENT COPY CASE 1 MHD II, Session 2 Student Copy - Page 2 CHIEF COMPLAINT: "My bowels
MHD I Session VIII Renal Disease November 6, 2013 STUDENT COPY
MHD I, Session VIII, Student Copy Page 1 MHD I Session VIII Renal Disease November 6, 2013 STUDENT COPY MHD I, Session VIII, Student Copy Page 2 Case #1 Chief Complaint: I have been feeling just lousy
Case conference. Welcome Dr. Lawrence Tierney
Case conference Welcome Dr. Lawrence Tierney Case: 18 year-old male CC) hamatomesis, Fever and cough HPI) 1 st admission One month ago, he admitted to our hospital because of hematemesis. He had weight
Department of Cardiovascular Medicine Saga University Mitsuhiro Shimomura
Complex Intervention For Hemodialysis Patient Department of Cardiovascular Medicine Saga University Mitsuhiro Shimomura TCTAP 2012 Case A 77 year old female had been treated with hemodialysis(hd) for chronic
CASE-BASED SMALL GROUP DISCUSSION. MHD II Session VII. Friday, March 28, 2014 STUDENT COPY
CASE-BASED SMALL GROUP DISCUSSION MHD II Session VII Friday, March 28, 2014 STUDENT COPY Helpful resources ACP Medicine available online through Loyola Health Science Library Endocrinology and Metabolism
Survey of blood transfusion-induced malaria and other diseases in Thalassemia patients from Solapur District (M.S.) India.
7. CONCLUSION Over 125 patients affected by thalassemia live in Solapur District, Maharashtra, India. Thalassemia is a blood disease and is common in both sexes. Thalassemia was suspected in all these
on fishes are detailed out in the Review of Literature. In this
SUMMARY VI S U M M A R Y The work presented here centers around the toxic action of three pesticides, comprising organochlorine, organophosphate and by bypyridilium compounds, (N1 the euryhaline fish Etroplus
VAD. ALT TP Glb Ca CT MRI. . mg/dl X X A CT VAD VAD. GdhDTPA T.
VAD h h h hh ALTTPGlbCa CTMRI MP Ca VAD QOL VAD MP MP VAD MP VAD kg PCV.;RPI.WBC,/l ALT IU/l TP. g/dlglb. g/dl Ca. mg/dl X X A CT MRI CT BCT MRI T T GdhDTPAT T ChF h h hh FAX hh E-mail : sayochan@vet.osakafu-u.ac.jp
Paper ID: ART
analytical process. Delayed sample analysi changes of measured parameters co interpretation of results. Pre-analytical variables, such as stor temperature affect the measurement parameters collected in
Objectives. Challenging Case Studies in Laboratory Diagnosis: A Focus on WBC and Hepatic Testing
Challenging Case Studies in Laboratory Diagnosis: A Focus on WBC and Hepatic Testing Margaret A. Fitzgerald, DNP, FNP-BC, NP-C, FAANP, CSP President, Fitzgerald Health Education Associates, Inc. North
, copies ml PSL .. -0,2 HIV HCV. ml, HIV- HIV HIV-TP HCV-RNA. HIV ddi, -TC. AZT TDF FTC ratv ,**3 : HIV HIV-TP HIV HIV HIV-TP +
,** The Japanese Society for AIDS Research The Journal of AIDS Research HIV HIV + : HIV HIV-TP HIV HIV HIV-TP + :.. + A,2 HIVHCV -* CD. ddi -., / ml, HIV-RNA +**.** copyml.+ HIV-RNA ++*** copiesml ***
Cancer Screening. Charuwan Akewanlop, MD Division of Medical Oncology Department of Medicine Faculty of Medicine Siriraj Hospital
Cancer Screening Charuwan Akewanlop, MD Division of Medical Oncology Department of Medicine Faculty of Medicine Siriraj Hospital Outline Definition and principles of cancer screening Cancer incidence and
no concerns hepatic shunt, high protein diet, kidney failure, metabolic acidosis
TAKING THE WORK OUT OF INTERPRETING LAB WORK CACVT 2017 SPRING CONFERENCE - GREENWOOD VILLAGE, CO Brandy Helewa, CVT, RVT, VTS (ECC) Penn Foster College - Scranton, PA Knowing what the results on your
Differential Blood Smear H3
Verein für Association pour le Associazione per il medizinische Qualitätskontrolle contrôle de qualité médical controllo di qualità medico Report Differential Blood Smear H3 MQ 2015-4 MQ, Institut für
C-1-Q IMMUNE COMPLEX Immune Complex, C-1-Q Binding Assay
C-1-Q IMMUNE COMPLEX Immune Complex, C-1-Q Binding Assay 5 ml blood, gel tube Special Instructions: Avoid hemolysis. Transfer serum to plastic vial immediately after centrifugation and freeze. Less than
The Complete Blood Count
The Complete Blood Count (Cartesian Thinking at Its Best) A SEM Image of Normal Human Blood Laurie Larsson February 22, 2010 Anatomy and Philology II Dr. Danil Hammoudi Introduction A complete blood count
A Young Male Cardiac Sarcoidosis Case with Complete Atrioventricular Block Which was Improved by Corticosteroid Therapy
28 TBLB 99m Tc-tetrofosmin [ ] A Young Male Cardiac Sarcoidosis Case with Complete Atrioventricular Block Which was Improved by Corticosteroid Therapy Yoko Kida 1), Hiromi Tomioka 2,4), Hiroshi Eizawa
Changes in Automated Complete Blood Cell Count and Differential Leukocyte Count Results Induced by Storage of Blood at Room Temperature
Changes in Automated Complete Blood Cell Count and Differential Leukocyte Count Results Induced by Storage of Blood at Room Temperature Gene L. Gulati, PhD; Lawrence J. Hyland, MD; William Kocher, MD;
AIDS. 1) Mycobacterium avium MRI (T2WI) HTLV-1 AIDS. Key words: Mycobacterium avium AIDS. Mycobacterium. complex MAC M. avium M.
2008 193 AIDS Mycobacterium avium 1) 2) 3) 4) 4) 3) 3) 3) 5) 1) 6) 1) 2) 3) 4) 5) 6) 20 1 30 20 6 13 46 MRI (T2WI) MRI 5 Mycobacterium avium M. avium HIV HTLV-1 AIDS AIDS Key words: Mycobacterium avium
Fullerton Healthcare Screening Centres
Fullerton Healthcare Screening Centres Fullerton Healthcare Screening Centre @ Ngee Ann City The Penthouse, #26-02 Ngee Ann City Tower B, 391B Orchard Road, Singapore 238874 Operating hours: Monday - Friday
Complete Medical History
Lab Results for Ben Greenfield Last Test Date: Your medical history is not complete. Complete Medical History Complete Medical History What's Next Blood Draw Blood draw scheduled Complete your medical
BC Biomedical Laboratories Adult Reference Ranges
BC Biomedical Laboratories Adult s Name Age 25 OH VITAMIN D Blood B 0-100 nmol/l Interpretation: < 25 Deficient 25-74 Insufficient 75-199 Sufficient > 200 Toxic 5HIAA (CALC) Urine B 0-100
American University of Beirut Faculty of Health Sciences Medical Laboratory Sciences Program
P 1 of 5 American University of Beirut Faculty of Health Sciences Medical Laboratory Sciences Program () Fall Semester 2016-2017 Name Rolla Al-Khatib Course Credits: 3 credits Office Hours: TWRF: 10:00
HAEMATOLOGICAL EVALUATION OF ANEMIA. Sitalakshmi S Professor and Head Department of Clinical Pathology St John s medical College, Bangalore
HAEMATOLOGICAL EVALUATION OF ANEMIA Sitalakshmi S Professor and Head Department of Clinical Pathology St John s medical College, Bangalore Learning Objectives Laboratory tests for the evaluation of anemia
Koostas: Anneli Aus Laboriarst Allkiri Ees- ja perekonnanimi Ametikoht kuupäev
Kinnitas: Elektroonselt Katrin Reimand Osakonnajuhataja 05.07.2017 kinnitatud Koostas: Anneli Aus Laboriarst 05.07.2017 Allkiri Ees- ja perekonnanimi Ametikoht kuupäev Haematology reference values Analyte
BCR-ABL - LSK BCR-ABL + LKS - (%)
Marker Clone BCR-ABL + LSK (%) BCR-ABL + LKS - (%) BCR-ABL - LSK (%) P value vs. BCR-ABL + LKS - P value vs. BCR-ABL - LSK CD2 RM2-5 12.9 ± 3.6 36.7 ± 6.5 19.3 ± 2.4 0.01 0.10 CD5 53-7.3 13.9 ± 3.2 20.8
Case conference. TAKUGA HINOSHITA 2 nd resident ONMC
Case conference TAKUGA HINOSHITA 2 nd resident ONMC 38 y/o female, Japanese CC: Dyspnea, Muscle clump, Numbness HPI Since 1 week PTA, she s been complaining of fever around 38, chills, cold sweat and nocturnal
American University of Beirut Faculty of Health Sciences Medical Laboratory Sciences Program
P 1 of 5 American University of Beirut Faculty of Health Sciences Medical Laboratory Sciences Program MLSP 201 () Fall Semester 2017-2018 Name Rolla Al-Khatib Course Credits: 3 credits Office Hours: TWRF:
Haemoglobinopathies case studies 11 th Annual Sickle Cell and Thalassaemia Conference October 2017
Haemoglobinopathies case studies 11 th Annual Sickle Cell and Thalassaemia Conference 11 13 October 2017 Chris Lambert Haematology Service Delivery Manager Viapath Laboratories Kings College Hospital HUMAN
Interpreting Laboratory Values Keith A. Swanson, PharmD, BCGP University of Oklahoma College of Pharmacy
Interpreting Laboratory Values Keith A., PharmD, BCGP University of Oklahoma College of Pharmacy DISCLOSURE I have no relevant financial disclosures relative to the content of this presentation. 1 LEARNING
Interpreting Laboratory Values Keith A. Swanson, PharmD, BCGP University of Oklahoma College of Pharmacy
Interpreting Laboratory Values Keith A., PharmD, BCGP University of Oklahoma College of Pharmacy DISCLOSURE I have no relevant financial disclosures relative to the content of this presentation. LEARNING
Biodegradable Zwitterionic Nanogels with Long. Circulation for Antitumor Drug Delivery
Supporting Information Biodegradable Zwitterionic Nanogels with Long Circulation for Antitumor Drug Delivery Yongzhi Men, Shaojun Peng, Peng Yang, Qin Jiang, Yanhui Zhang, Bin Shen, Pin Dong, *, Zhiqing
MECHANISMS OF HUMAN DISEASE AND PHARMACOLOGY & THERAPEUTICS
MHD I, Session 16, STUDENT Copy, Page 1 MECHANISMS OF HUMAN DISEASE AND PHARMACOLOGY & THERAPEUTICS CASE-BASED SMALL GROUP DISCUSSION SESSION 16 Pulmonary MHD I December 5, 2016 STUDENT COPY MHD I, Session
Bio-Rad Laboratories EXTERNAL QUALITY ASSURANCE SERVICES EQAS. External Quality Assurance Services
Bio-Rad Laboratories EXTERNAL QUALITY ASSURANCE SERVICES EQAS External Quality Assurance Services Table of Contents About Bio-Rad EQAS EQAS Program Overview.... 3 Online EQAS Resources... 4 Submitting
Rapid Laboratories In House Tests
Electrolytes CL CL (CHLORIDE) Electrolytes CO2 CO2 (BICARBONATE) Electrolytes K K (POTASSIUM) Electrolytes NA NA (SODIUM) Basic Metabolic Panel (BMP) GLU GLU (GLUCOSE) Basic Metabolic Panel (BMP) CA CA
Clinical Case. Dr. Akif BAYYİĞİT Dr. İlker Nihat ÖKTEN Dr. Serkan DUMANLI
Clinical Case Dr. Akif BAYYİĞİT Dr. İlker Nihat ÖKTEN Dr. Serkan DUMANLI Case: Mr. A.D. 44 Male Abdominal pain and fever Past Medical History: Facial paralyses 20 years ago Splenomegaly? Family History:
Summary ID#Z019 Clinical Study Summary: Study B9R-JE-6001
CT Registry ID#Z019 Page 1 Summary ID#Z019 Clinical Study Summary: Study B9R-JE-6001 Title of Study: Evaluation of Growth Promoting Effect and Safety of Growth Hormone in Achondroplasia Investigator(s):