ipsc genomic instability and impact on product safety Prof Peter Andrews, University of Sheffield, UK

Size: px
Start display at page:

Download "ipsc genomic instability and impact on product safety Prof Peter Andrews, University of Sheffield, UK"

Transcription

1 ipsc genomic instability and impact on product safety Prof Peter Andrews, University of Sheffield, UK

2 PSC genomic instability and impact on product safety Peter W Andrews

3 variability PSC genomic instability and impact on product safety Peter W Andrews

4 The Pluripotent Stem Cell Problem Self Renewal Differentiation Death Fate Determination

5 The Pluripotent Stem Cell Problem Selection Self Renewal Differentiation Death Fate Determination

6 Normal and Culture Adapted H7 Human ES Cells Cells ( x 1-5 ) Day 4 Day 6 Days after Seeding H7 Normal H7 Adapted 1 5 Cells Seeded H7 S6 - der(6)t(6;17)(q27q1)

7 Distribution of cytogentic abnormalities from literature ISCI - Nature Biotechnology (211) 29:

8 Non-Random Mutation or Selection? Rate of Take over of Abnormal Cells that Appear Spontaneously Mixing Exp S = 2. Olariu et al 21. Stem Cell Research 4: 5-56.

9 Driver Gene in Chr2 Minimal Amplicon is BCL2L1 Chr2 HM13 ID1 BCL2L1 TPX2 Expressed gene But other amplicons much larger (more genes)! Avery, Hirst, et al. 213 Stem Cell Reports. 1:

10 Genetic Variants What are the Issues? Mutation Detection What is mutation rate? << Can it be reduced? Types of mutation? Selection Source of selective advantage? Survival; differentiation; proliferation? Can it be reduced? Consequences What is sensitivity? Can it be improved? ISCI 217 Stem Cell Reports 9: 1 4. Differentiation? Function? Engraftment Cancer?

11 Sensitvity of G-Band Karyotype Each row represents a level of mosaicism. The columns have upper (ul) and lower (ll) limits on the expected number of abnormal cells Number of Metaphases Scored ll ul ll ul ll ul ll ul ll ul ll ul ll ul ll ul ll ul ll ul ll ul ll ul

12 PCR and FISH Mixing of normal and trisomic cells (17q) Copy Number qpcr % Abnormal cells 8 1 % abnormal cells as detected by FISH FISH % abnormal cells 1

13 ROCK inhibitor Minimises the Selective Advantage of Chr 2q Variants (Y-27632)

14 Assessing the Consequences of Variants Isogenic sets of clonal lines with and without common variants Ø Gains of chr 1, 12, 17, 2 Ø Losses from chr 1, 18, 22 Ø Point mutations p53 Chromosome 2 2q ,, 31,25, 31,5, 31,75, 32,, 32,25, 32,5, 32,75, 33,, DEFB115 BCL2L1 TTLL9 DEFB123 REM1 TPX2 MYLK2 XKR7 TM9SF4 ASXL1 DNMT3B NCRM1 Shef5 ESI35 H1 HES3

15 ES Cells in Culture & EC Cells in Tumours Are they subject to similar selective pressures? Human EC cells in testicular Teratocarcinomas commonly gain 17q, 12p chromosomes Self Renewal Selection Differentiation Death

16 Pluripotent Stem Cells Can Form Teratomas Teratomas contain differentiated derivatives of all three germ layers Damjanov and Andrews 216 A Histopathology Atlas Int. J. Dev. Biol. 6:

17 Pluripotent Stem Cells Can Form Teratocarcinomas Undifferentiated Stem Cells Yolk Sac extraembryonic endoderm Damjanov and Andrews 216 A Histopathology Atlas Int. J. Dev. Biol. 6:

18 No Correlation between Aneuploidy and Persistence of Primitive Cells 12 1 Tig18 4f3 TIG18-4f3 DF T.H DF T.4 ips(imr9)-4 IMR9-4 Shef3 H14 ipsc RM3.5 TeratoScore Analysis % Expression Undifferentiated Markers Xenograft tumors with persisting stem cells or yolk sac elements - Diploid Karyotype 2 Tissues Teratomas Nissim Benvenisty and Yishai Avior The International Stem Cell Initiative 218 Assessment of established techniques to determine developmental and malignant potential of human pluripotent stem cells. Nature Communications, in press

19 Tumours from ES Cells Teratoma - benign? Teratocarcinoma - malignant Secondary Cancer

20 Addressing the Issues Freezing & thawing ISCI Genetic Group, Steering Committee Martin Pera (Chair) Peter Andrews Nissim Benvenisty Kevin Eggan Tenneille Ludwig Yoji Sato Derivation Expansion Differentiation Transplantation Mutation & Selection Variants of Origin Acquired Variants

21 Sheffield Duncan Baker Ivana Barbaric Jonathan Draper Paul Gokhale Jason Halliwell Neil Harrison Adam Hirst Oliver Thompson Acknowledgements Collaborators Stuart Avery AStar Barbara Knowles AStar Martin Pera Jackson laboratory Nissim Benvenisty - Israel Paul Robson AStar Glyn Stacey NIBSC/UKSCB Horizon 22

The Pathology of Germ Cell Tumours of the Ovary

The Pathology of Germ Cell Tumours of the Ovary The Pathology of Germ Cell Tumours of the Ovary Professor Mike Wells University of Sheffield Amman, Jordan November 2013 Professor Francisco Paco Nogales I. Primitive germ cell tumors A. Dysgerminoma

More information

WAO9 P-32 August 1, 2008 Bank Characterization Report

WAO9 P-32 August 1, 2008 Bank Characterization Report WAO9 P-32 August 1, 2008 Bank Characterization Report Cell Line description 3 Karyotype.. 4 5 Fluorescent in Situ Hybridization 6 7 Teratoma Assay 8 10 Flow Cytometry.. 11 Post Thaw Recovery 12 2 Cell

More information

Karyotype analysis of teratocarcinomas and embryoid bodies of C3H mice

Karyotype analysis of teratocarcinomas and embryoid bodies of C3H mice /. Embryol. exp. Morph. Vol., pp. 77-, 77 77 Printed in Great Britain Karyotype analysis of teratocarcinomas and embryoid bodies of CH mice By S. A. ILES AND E. P. EVANS From the Department of Zoology

More information

Testicular Germ Cell Tumors; A Simplistic Approach

Testicular Germ Cell Tumors; A Simplistic Approach Testicular Germ Cell Tumors; A Simplistic Approach Merce Jorda, MD, PhD, MBA Professor and Vice Chair, Director of Anatomic Pathology Director of Genitourinary Pathology Service Interim Director of Cytopathology

More information

Do acgh analysis have a place in routine cytogenetic workup in leukemia/cancer? - A single institution experience. Cambridge, April 9 th 2013

Do acgh analysis have a place in routine cytogenetic workup in leukemia/cancer? - A single institution experience. Cambridge, April 9 th 2013 Do acgh analysis have a place in routine cytogenetic workup in leukemia/cancer? - A single institution experience. Cambridge, April 9 th 2013 Aarhus University Hospital Eigil Kjeldsen, Cancercytogenetic

More information

IN THE UNITED STATES PATENT AND TRADEMARK OFFICE

IN THE UNITED STATES PATENT AND TRADEMARK OFFICE IN THE UNITED STATES PATENT AND TRADEMARK OFFICE In the matter of: Reexamination Control. No. 95/000,154 Art Unit: 3991 U.S. Patent No. 7,029,913 Issued: April 18, 2006 Examiner: Gary L. Kunz Inventor:

More information

Mitosis & Meiosis. Practice Questions. Slide 1 / 68. Slide 2 / 68. Slide 3 / Identify two differences between meiosis and mitosis.

Mitosis & Meiosis. Practice Questions. Slide 1 / 68. Slide 2 / 68. Slide 3 / Identify two differences between meiosis and mitosis. New Jersey Center for Teaching and Learning Slide 1 / 68 Progressive Science Initiative This material is made freely available at www.njctl.org and is intended for the non-commercial use of students and

More information

Mitosis & Meiosis. Practice Questions. Slide 1 / 68. Slide 2 / 68. Slide 3 / 68. Slide 4 / 68. Slide 6 / 68. Slide 5 / 68

Mitosis & Meiosis. Practice Questions. Slide 1 / 68. Slide 2 / 68. Slide 3 / 68. Slide 4 / 68. Slide 6 / 68. Slide 5 / 68 Slide 1 / 68 Slide 2 / 68 New Jersey Center for Teaching and Learning Progressive Science Initiative This material is made freely available at www.njctl.org and is intended for the non-commercial use of

More information

Aneuploidy in pluripotent stem cells and implications for cancerous transformation INTRODUCTION

Aneuploidy in pluripotent stem cells and implications for cancerous transformation INTRODUCTION Protein Cell 2014, 5(8):569 579 DOI 10.1007/s13238-014-0073-9 Aneuploidy in pluripotent stem cells and implications for cancerous transformation Jie Na 1&, Duncan Baker 2, Jing Zhang 1, Peter W. Andrews

More information

Supplementary methods:

Supplementary methods: Supplementary methods: Primers sequences used in real-time PCR analyses: β-actin F: GACCTCTATGCCAACACAGT β-actin [11] R: AGTACTTGCGCTCAGGAGGA MMP13 F: TTCTGGTCTTCTGGCACACGCTTT MMP13 R: CCAAGCTCATGGGCAGCAACAATA

More information

Teratomas produced from human pluripotent stem cells xenografted into immunodeficient mice - a histopathology atlas

Teratomas produced from human pluripotent stem cells xenografted into immunodeficient mice - a histopathology atlas Human Experimental Teratoma Atlas 337 Teratomas produced from human pluripotent stem cells xenografted into immunodeficient mice - a histopathology atlas IVAN DAMJANOV*,1 and PETER W. ANDREWS 2 1 Department

More information

Germ cell tumours UK SH. Ivo Leuschner. Kiel Pediatric Tumor Registry, Institute of Pathology University Hospital of Schleswig-Holstein Campus Kiel

Germ cell tumours UK SH. Ivo Leuschner. Kiel Pediatric Tumor Registry, Institute of Pathology University Hospital of Schleswig-Holstein Campus Kiel Germ cell tumours Ivo Leuschner Kiel Pediatric Tumor Registry, Institute of Pathology University Hospital of Schleswig-Holstein Campus Kiel UK SH Old histogenetic Concept of Germ cell tumours Pluripotent

More information

Copyright The McGraw-Hill Companies, Inc. Permission required for reproduction or display. Chapter 9 MITOSIS

Copyright The McGraw-Hill Companies, Inc. Permission required for reproduction or display. Chapter 9 MITOSIS Copyright The McGraw-Hill Companies, Inc. Permission required for reproduction or display. Chapter 9 MITOSIS Copyright The McGraw-Hill Companies, Inc. Permission required for reproduction or display. 9.1

More information

Sharan Goobie, MD, MSc, FRCPC

Sharan Goobie, MD, MSc, FRCPC Sharan Goobie, MD, MSc, FRCPC Chromosome testing in 2014 Presenter Disclosure: Sharan Goobie has no potential for conflict of interest with this presentation Objectives Review of standard genetic investigations

More information

Stem cells: units of development and regeneration. Fernando D. Camargo Ph.D. Whitehead Fellow Whitehead Institute for Biomedical Research.

Stem cells: units of development and regeneration. Fernando D. Camargo Ph.D. Whitehead Fellow Whitehead Institute for Biomedical Research. Stem cells: units of development and regeneration Fernando D. Camargo Ph.D. Whitehead Fellow Whitehead Institute for Biomedical Research Concepts 1. Embryonic vs. adult stem cells 2. Hematopoietic stem

More information

An epigenetic approach to understanding (and predicting?) environmental effects on gene expression

An epigenetic approach to understanding (and predicting?) environmental effects on gene expression www.collaslab.com An epigenetic approach to understanding (and predicting?) environmental effects on gene expression Philippe Collas University of Oslo Institute of Basic Medical Sciences Stem Cell Epigenetics

More information

A. Incorrect! All the cells have the same set of genes. (D)Because different types of cells have different types of transcriptional factors.

A. Incorrect! All the cells have the same set of genes. (D)Because different types of cells have different types of transcriptional factors. Genetics - Problem Drill 21: Cytogenetics and Chromosomal Mutation No. 1 of 10 1. Why do some cells express one set of genes while other cells express a different set of genes during development? (A) Because

More information

Retroperitoneal Teratoma Heather Borders, MD

Retroperitoneal Teratoma Heather Borders, MD Retroperitoneal Teratoma Heather Borders, MD 03/04/2012 History Newborn with congenitally diagnosed mass. No other clinical symptoms. Diagnosis Retroperitoneal Teratoma; Immature teratoma, grade 1, with

More information

Characterisation of structural variation in breast. cancer genomes using paired-end sequencing on. the Illumina Genome Analyser

Characterisation of structural variation in breast. cancer genomes using paired-end sequencing on. the Illumina Genome Analyser Characterisation of structural variation in breast cancer genomes using paired-end sequencing on the Illumina Genome Analyser Phil Stephens Cancer Genome Project Why is it important to study cancer? Why

More information

Session 5. Pre-malignant clonal hematopoietic proliferations. Chairs: Frank Kuo and Valentina Nardi

Session 5. Pre-malignant clonal hematopoietic proliferations. Chairs: Frank Kuo and Valentina Nardi Session 5 Pre-malignant clonal hematopoietic proliferations Chairs: Frank Kuo and Valentina Nardi Pre-malignant clonal hematopoietic proliferations Clonal LYMPHOID proliferations: - Monoclonal gammopathy

More information

Role of FISH in Hematological Cancers

Role of FISH in Hematological Cancers Role of FISH in Hematological Cancers Thomas S.K. Wan PhD,FRCPath,FFSc(RCPA) Honorary Professor, Department of Pathology & Clinical Biochemistry, Queen Mary Hospital, University of Hong Kong. e-mail: wantsk@hku.hk

More information

Leukaemia 35% Lymphoma 14%

Leukaemia 35% Lymphoma 14% Distribution ib ti of Cancers in Children under 15 years Leukaemia 35% Lymphoma 14% Neuroblastoma 9% Other 5% Liver 1% Retinoblastoma 3% Bone and STS 15% CNS 20% Wilms' 8% 30-40% Mortality Germ Cell Tumours

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 10.1038/ncb2566 Figure S1 CDKL5 protein expression pattern and localization in mouse brain. (a) Multiple-tissue western blot from a postnatal day (P) 21 mouse probed with an antibody against CDKL5.

More information

FINALIZED SEER SINQ QUESTIONS

FINALIZED SEER SINQ QUESTIONS 0076 Source 1: WHO Class CNS Tumors pgs: 33 MP/H Rules/Histology--Brain and CNS: What is the histology code for a tumor originating in the cerebellum and extending into the fourth ventricle described as

More information

Molecular Markers. Marcie Riches, MD, MS Associate Professor University of North Carolina Scientific Director, Infection and Immune Reconstitution WC

Molecular Markers. Marcie Riches, MD, MS Associate Professor University of North Carolina Scientific Director, Infection and Immune Reconstitution WC Molecular Markers Marcie Riches, MD, MS Associate Professor University of North Carolina Scientific Director, Infection and Immune Reconstitution WC Overview Testing methods Rationale for molecular testing

More information

Fragile X Syndrome. Genetics, Epigenetics & the Role of Unprogrammed Events in the expression of a Phenotype

Fragile X Syndrome. Genetics, Epigenetics & the Role of Unprogrammed Events in the expression of a Phenotype Fragile X Syndrome Genetics, Epigenetics & the Role of Unprogrammed Events in the expression of a Phenotype A loss of function of the FMR-1 gene results in severe learning problems, intellectual disability

More information

Differential Connexin Function Enhances Self-Renewal in Glioblastoma

Differential Connexin Function Enhances Self-Renewal in Glioblastoma CSU ID: 2558414 Name: Sonal Patel Differential Connexin Function Enhances Self-Renewal in Glioblastoma Cancer is one of the most common disease in the US with more than a million people affected every

More information

Higher Human Biology Unit 1: Human Cells

Higher Human Biology Unit 1: Human Cells Higher Human Biology Unit 1: Human Cells Key Area 1.1: Division & differentiation in human cells Learning Outcomes Somatic stem cells divide by mitosis to form more somatic cells. Germline stem cells divide

More information

Research programs involving human early embryos

Research programs involving human early embryos Research programs involving human early embryos 1. Understanding normal mammalian embryo development 2. Understanding errors in genetic and epigenetic programs 3. Providing research and therapeutic tools

More information

(a) Schematic diagram of the FS mutation of UVRAG in exon 8 containing the highly instable

(a) Schematic diagram of the FS mutation of UVRAG in exon 8 containing the highly instable Supplementary Figure 1. Frameshift (FS) mutation in UVRAG. (a) Schematic diagram of the FS mutation of UVRAG in exon 8 containing the highly instable A 10 DNA repeat, generating a premature stop codon

More information

The diagnostic and prognostic value of genetic aberrations in resectable distal bile duct cancer Rijken, A.M.

The diagnostic and prognostic value of genetic aberrations in resectable distal bile duct cancer Rijken, A.M. UvA-DARE (Digital Academic Repository) The diagnostic and prognostic value of genetic aberrations in resectable distal bile duct cancer Rijken, A.M. Link to publication Citation for published version (APA):

More information

Product Information and Testing - Amended. Product Information

Product Information and Testing - Amended. Product Information Product Information and Testing - Amended Product Information Product Name ips(foreskin)-3 Alias ips(foreskin) clone (#3) Lot Number WB0002 Depositor University of Wisconsin Laboratory of Dr. James Thomson

More information

"BRCAness," PARP and the Triple-Negative Phenotype

BRCAness, PARP and the Triple-Negative Phenotype "BRCAness," PARP and the Triple-Negative Phenotype Prof Alan Ashworth, FRS Disclosures for Professor Alan Ashworth, FRS Consulting Agreements GlaxoSmithKline, Pfizer Inc Patent AstraZeneca Pharmaceuticals

More information

Objectives. Morphology and IHC. Flow and Cyto FISH. Testing for Heme Malignancies 3/20/2013

Objectives. Morphology and IHC. Flow and Cyto FISH. Testing for Heme Malignancies 3/20/2013 Molecular Markers in Hematologic Malignancy: Ways to locate the needle in the haystack. Objectives Review the types of testing for hematologic malignancies Understand rationale for molecular testing Marcie

More information

Challenges of CGH array testing in children with developmental delay. Dr Sally Davies 17 th September 2014

Challenges of CGH array testing in children with developmental delay. Dr Sally Davies 17 th September 2014 Challenges of CGH array testing in children with developmental delay Dr Sally Davies 17 th September 2014 CGH array What is CGH array? Understanding the test Benefits Results to expect Consent issues Ethical

More information

Teratoma Formation Pluripotency Analysis Report

Teratoma Formation Pluripotency Analysis Report Teratoma Formation Pluripotency Analysis Report Project and Customer Information Service Title: Teratoma formation pluripotency analysis Customer: PepGel LLC PI/Contact: Susan, Email: sun.pepgel@gmail.com

More information

Cancer and Cell Differentiation

Cancer and Cell Differentiation Cancer and Cell Differentiation Recall The cell cycle consists of interphase, mitosis, and cytokinesis. Recall During S phase of interphase, the DNA is replicated to prepare for mitosis. Each daughter

More information

Derivation of Euploid Human Embryonic Stem Cells from Aneuploid Embryos

Derivation of Euploid Human Embryonic Stem Cells from Aneuploid Embryos EMBRYONIC STEM CELLS Derivation of Euploid Human Embryonic Stem Cells from Aneuploid Embryos NETA LAVON, a KAVITA NARWANI, a TAMAR GOLAN-LEV, b NICOLE BUEHLER, c DAVID HILL, c NISSIM BENVENISTY a,b a The

More information

Chromosome Abnormalities

Chromosome Abnormalities Chromosome Abnormalities Chromosomal abnormalities vs. molecular mutations Simply a matter of size Chromosomal abnormalities are big errors Two types of abnormalities 1. Constitutional problem present

More information

Clonal hematopoiesis of indeterminate potential and MDS. Siddhartha Jaiswal AAMDS Meeting 3/17/16

Clonal hematopoiesis of indeterminate potential and MDS. Siddhartha Jaiswal AAMDS Meeting 3/17/16 Clonal hematopoiesis of indeterminate potential and MDS Siddhartha Jaiswal AAMDS Meeting 3/17/16 Clonal evolution from birth to death Might pre-malignant clones, bearing only the initiating lesion, be

More information

DISCLOSURE. I have the following financial relationships:

DISCLOSURE. I have the following financial relationships: DISCLOSURE I have the following financial relationships: Consultant for: Fate Therapeutics, GlaxoSmithKline, Bone Therapeutics, G1 Therapeutics Contracted Research for: GlaxoSmithKline Royalties from:

More information

Cancer Cytogenetics: Chromosomal And Molecular Genetic Abberations Of Tumor Cells By Sverre Heim READ ONLINE

Cancer Cytogenetics: Chromosomal And Molecular Genetic Abberations Of Tumor Cells By Sverre Heim READ ONLINE Cancer Cytogenetics: Chromosomal And Molecular Genetic Abberations Of Tumor Cells By Sverre Heim READ ONLINE If you are looking for the ebook by Sverre Heim Cancer Cytogenetics: Chromosomal and Molecular

More information

Addressing the challenges of genomic characterization of hematologic malignancies using microarrays

Addressing the challenges of genomic characterization of hematologic malignancies using microarrays Addressing the challenges of genomic characterization of hematologic malignancies using microarrays Sarah South, PhD, FACMG Medical Director, ARUP Laboratories Department of Pediatrics and Pathology University

More information

Indications for chromosome screening Dagan Wells, PhD, FRCPath dagan.wells@obs-gyn.ox.ac.ukgyn.ox.ac.uk Chromosome imbalance (aneuploidy) Uncontroversial data The incidence of aneuploidy Aneuploidy is

More information

Determination of Genomic Imbalances by Genome-wide Screening Approaches

Determination of Genomic Imbalances by Genome-wide Screening Approaches Overview Determination of Genomic Imbalances by Genome-wide Screening Approaches Károly Szuhai Introduction/Methodologies Applications/Results Conclusion Approaches Introduction/Methodologies Chromosome

More information

Human Pluripotent Stem Cell Cardiomyocyte Differentiation Kit (PSCCDK) Introduction Kit Components Cat. # # of vials Reagent Quantity Storage

Human Pluripotent Stem Cell Cardiomyocyte Differentiation Kit (PSCCDK) Introduction Kit Components Cat. # # of vials Reagent Quantity Storage Human Pluripotent Stem Cell Cardiomyocyte Differentiation Kit (PSCCDK) Catalog #5901 Introduction Human pluripotent stem cells (hpsc), including embryonic stem cells (ESC) and induced pluripotent stem

More information

CODING TUMOUR MORPHOLOGY. Otto Visser

CODING TUMOUR MORPHOLOGY. Otto Visser CODING TUMOUR MORPHOLOGY Otto Visser INTRODUCTION The morphology describes the tissue of the tumour closest to normal tissue Well differentiated tumours are closest to normal Undifferentiated tumours show

More information

Genetics, Mendel and Units of Heredity

Genetics, Mendel and Units of Heredity Genetics, Mendel and Units of Heredity ¾ Austrian monk and naturalist. ¾ Conducted research in Brno, Czech Republic from 1856-1863 ¾ Curious about how traits were passed from parents to offspring. Gregor

More information

Targeted qpcr. Debate on PGS Technology: Targeted vs. Whole genome approach. Discolsure Stake shareholder of GENETYX S.R.L

Targeted qpcr. Debate on PGS Technology: Targeted vs. Whole genome approach. Discolsure Stake shareholder of GENETYX S.R.L Antonio Capalbo, PhD Laboratory Director GENETYX, reproductive genetics laboratory, Italy PGT responsible GENERA centers for reproductive medicine, Italy Debate on PGS Technology: Targeted vs. Whole genome

More information

- is a common disease - 1 person in 3 can expect to contract cancer at some stage in their life -1 person in 5 can expect to die from it

- is a common disease - 1 person in 3 can expect to contract cancer at some stage in their life -1 person in 5 can expect to die from it MBB157 Dr D Mangnall The Molecular Basis of Disease CANCER Lecture 1 One of the simpler (and better) definitions of cancer comes from the American Cancer Society, who define cancer as; 'Cancer is a group

More information

Overview of methodology, tools and reagents for evaluating cell proliferation and invasion using multicellular tumor spheroids.

Overview of methodology, tools and reagents for evaluating cell proliferation and invasion using multicellular tumor spheroids. The Next Step in the Evolution of 3D Culture: Utilizing Extracellular Matrix to Enhance Multicellular Tumor Spheroid Models for Proliferation and Invasion Overview of methodology, tools and reagents for

More information

Stem Cells and Infec/ous Disease

Stem Cells and Infec/ous Disease Stem Cells and Infec/ous Disease Professor Vassie Ware Bioscience in the 21 st Century December 4, 2015 www.gothamgaze+e.com/.../stemcell/stem_cell.jpg Overview Se4ng the stage for the discussion: historical

More information

Laboratory Service Report

Laboratory Service Report Client C7028846-DLP Rochester Rochester, N 55901 Specimen Type Peripheral blood CR PDF Report available at: https://test.mmlaccess.com/reports/c7028846-zwselwql7p.ashx Indication for Test DS CR Pathogenic

More information

Haematopoietic stem cells

Haematopoietic stem cells Haematopoietic stem cells Neil P. Rodrigues, DPhil NIH Centre for Biomedical Research Excellence in Stem Cell Biology Boston University School of Medicine neil.rodrigues@imm.ox.ac.uk Haematopoiesis: An

More information

Pancreas Cancer Genomics

Pancreas Cancer Genomics Pancreas Cancer Genomics Steven Gallinger MD, MSc, FRCS HPB Surgical Oncology Program University Health Network Samuel Lunenfeld Research Institute Mount Sinai Hospital University of Toronto Fate of the

More information

Ductal pancreatic cancer modeling and drug screening using human pluripotent stem cell and patient-derived tumor organoids

Ductal pancreatic cancer modeling and drug screening using human pluripotent stem cell and patient-derived tumor organoids Ductal pancreatic cancer modeling and drug screening using human pluripotent stem cell and patient-derived tumor organoids Ling Huang 1, Audrey Holtzinger 1,2,11, Ishaan Jagan 1,11, Michael BeGora 1, Ines

More information

The Chromosomal Basis Of Inheritance

The Chromosomal Basis Of Inheritance The Chromosomal Basis Of Inheritance Chapter 15 Objectives Explain the chromosomal theory of inheritance and its discovery. Explain why sex-linked diseases are more common in human males than females.

More information

Structural Variation and Medical Genomics

Structural Variation and Medical Genomics Structural Variation and Medical Genomics Andrew King Department of Biomedical Informatics July 8, 2014 You already know about small scale genetic mutations Single nucleotide polymorphism (SNPs) Deletions,

More information

Institute of Pathology First Faculty of Medicine Charles University. Ovary

Institute of Pathology First Faculty of Medicine Charles University. Ovary Ovary Barrett esophagus ph in vagina between 3.8 and 4.5 ph of stomach varies from 1-2 (hydrochloric acid) up to 4-5 BE probably results from upward migration of columnar cells from gastroesophageal junction

More information

The Chromosomal Basis of Inheritance

The Chromosomal Basis of Inheritance Chapter 15 The Chromosomal Basis of Inheritance PowerPoint Lectures for Biology, Seventh Edition Neil Campbell and Jane Reece Lectures by Chris Romero Overview: Locating Genes on Chromosomes A century

More information

ADVANCED PGT SERVICES

ADVANCED PGT SERVICES Genomic Prediction ADVANCED PGT SERVICES with PGT-A using SEQ is a cost-effective, rigorously validated, unambiguous, and streamlined test for aneuploidy in blastocyst biopsies, and uses state of the art

More information

Same Day, Cost-Effective Aneuploidy Detection with Agilent Oligonucleotide array CGH and MDA Single Cell Amplification Method

Same Day, Cost-Effective Aneuploidy Detection with Agilent Oligonucleotide array CGH and MDA Single Cell Amplification Method Same Day, Cost-Effective Aneuploidy Detection with Agilent Oligonucleotide array CGH and MDA Single Cell Amplification Method Presenter: Dr. Ali Hellani, Founder, Viafet Genomic Center, Dubai Wednesday,

More information

Copy number and somatic mutations drive tumors

Copy number and somatic mutations drive tumors Detection of copy number alterations, ploidy and loss of heterozygosity across the genome in FFPE specimens Utility for diagnosis and treatment with comparison to FISH-based and as a complement to sequencing

More information

Clasificación Molecular del Cáncer de Próstata. JM Piulats

Clasificación Molecular del Cáncer de Próstata. JM Piulats Clasificación Molecular del Cáncer de Próstata JM Piulats Introduction The Gleason score is the major method for prostate cancer tissue grading and the most important prognostic factor in this disease.

More information

Histomorphological spectrum of tumor and tumor like lesions of testis and paratesticular structures A cross sectional study

Histomorphological spectrum of tumor and tumor like lesions of testis and paratesticular structures A cross sectional study Original Research Article DOI: 10.5958/2394-6792.2016.00098.3 Histomorphological spectrum of tumor and tumor like lesions of testis and paratesticular structures A cross sectional study Sanjay M 1,*, Sushma

More information

Biology Diagrams. Biology Review

Biology Diagrams. Biology Review Biology Diagrams Biology Review Matching A) Light source B) Respiratory System C) Mitochondria D) Nucleus E) Vacuole F) Cytokinesis G) Daughter cells H) Interphase I) Telophase J) Ocular lens K) Fine

More information

Advanced Cell Biology. Lecture 36

Advanced Cell Biology. Lecture 36 Advanced Cell Biology. Lecture 36 Alexey Shipunov Minot State University May 3, 2013 Shipunov (MSU) Advanced Cell Biology. Lecture 36 May 3, 2013 1 / 43 Outline Questions and answers Cellular communities

More information

Association for Molecular Pathology Promoting Clinical Practice, Basic Research, and Education in Molecular Pathology

Association for Molecular Pathology Promoting Clinical Practice, Basic Research, and Education in Molecular Pathology Association for Molecular Pathology Promoting Clinical Practice, Basic Research, and Education in Molecular Pathology 9650 Rockville Pike, Bethesda, Maryland 20814 Tel: 301-634-7939 Fax: 301-634-7990 Email:

More information

CNS SSCRG Work Programme

CNS SSCRG Work Programme National Brain Tumour Registry CNS SSCRG Work Programme Incidence, Mortality and Survival Analysis Produced by NBTR 2012 Area Measure Subjects Year of diagnosis England Persons Cases per Year England Male

More information

Biology 4361 Developmental Biology. October 11, Multiple choice (one point each)

Biology 4361 Developmental Biology. October 11, Multiple choice (one point each) Biology 4361 Developmental Biology Exam 1 October 11, 2005 Name: ID#: Multiple choice (one point each) 1. Sertoli cells a. surround spermatocytes b. are the structural components of the seminiferous tubules

More information

Article Impact of meiotic and mitotic non-disjunction on generation of human embryonic stem cell lines

Article Impact of meiotic and mitotic non-disjunction on generation of human embryonic stem cell lines RBMOn - Vol 18. No 1. 2009 120-126 Reproductive BioMedicine On; www.rbmon.com/article/3656 on web 21 November 2008 Article Impact of meiotic and mitotic non-disjunction on generation of human embryonic

More information

Teratocarcinoma In A Young Boy- An Unusual Presentation

Teratocarcinoma In A Young Boy- An Unusual Presentation Human Journals Case Report November 2015 Vol.:2, Issue:1 All rights are reserved by Atia Zaka-ur-Rab et al. Teratocarcinoma In A Young Boy- An Unusual Presentation Keywords: Boy, Testicular Mass, Teratocarcinoma

More information

Understanding the Human Karyotype Colleen Jackson Cook, Ph.D.

Understanding the Human Karyotype Colleen Jackson Cook, Ph.D. Understanding the Human Karyotype Colleen Jackson Cook, Ph.D. SUPPLEMENTAL READING Nussbaum, RL, McInnes, RR, and Willard HF (2007) Thompson and Thompson Genetics in Medicine, 7th edition. Saunders: Philadelphia.

More information

ADVANCES IN CHILDHOOD ACUTE LEUKEMIAS : GENERAL OVERVIEW

ADVANCES IN CHILDHOOD ACUTE LEUKEMIAS : GENERAL OVERVIEW ADVANCES IN CHILDHOOD ACUTE LEUKEMIAS : GENERAL OVERVIEW Danièle SOMMELET European Scientific Seminar Luxemburg, 3.11.2009 1 Definition of acute leukemias Malignant process coming from lymphoid (85 %)

More information

Pelvic tumor in childhood Classification, imaging approach and radiological findings

Pelvic tumor in childhood Classification, imaging approach and radiological findings Pelvic tumor in childhood Classification, imaging approach and radiological findings M. Mearadji International Foundation for Pediatric Imaging Aid Rotterdam, The Netherlands Solid pelvic masses in childhood

More information

Effective cryopreservation of human embryonic stem cells by the open pulled straw vitrification method

Effective cryopreservation of human embryonic stem cells by the open pulled straw vitrification method Human Reproduction Vol.16, No.10 pp. 2187 2194, 2001 Effective cryopreservation of human embryonic stem cells by the open pulled straw vitrification method B.E.Reubinoff 1,3, M.F.Pera 2, G.Vajta 2 and

More information

(Epi)Genetics in normal and malignant germ cell development.

(Epi)Genetics in normal and malignant germ cell development. (Epi)Genetics in normal and malignant germ cell development. Leendert Looijenga, Department of Pathology, Lab. Exp. Patho-Oncol. Erasmus MC, Rotterdam OPTIMAL PATIENT CARE MM Basic and Transl. Oncol.,

More information

Learning Outcomes: The following list provides the learning objectives that will be covered in the lectures, and tutorials of each week:

Learning Outcomes: The following list provides the learning objectives that will be covered in the lectures, and tutorials of each week: Course Code Course Title ECTS Credits MED-306 Medical Genetics 6 School Semester Prerequisites Medical School Spring (Semester 6) MED-103 Biology I MED-109 Biology II MED-204 Biochemistry I MED-209 Biochemistry

More information

Transcriptional repression of Xi

Transcriptional repression of Xi Transcriptional repression of Xi Xist Transcription of Xist Xist RNA Spreading of Xist Recruitment of repression factors. Stable repression Translocated Xic cannot efficiently silence autosome regions.

More information

A factor which brings about a mutation is called a mutagen. Any agent that causes cancer is called a carcinogen and is described as carcinogenic.

A factor which brings about a mutation is called a mutagen. Any agent that causes cancer is called a carcinogen and is described as carcinogenic. Cancer Cancer is one of the most common diseases in the developed world: 1 in 4 deaths are due to cancer 1 in 17 deaths are due to lung cancer Lung cancer is the most common cancer in men Breast cancer

More information

Principles of Cancer Biology and Therapy. Prof Dr Solange Peters, MD, PhD Cancer Center Lausanne Switzerland

Principles of Cancer Biology and Therapy. Prof Dr Solange Peters, MD, PhD Cancer Center Lausanne Switzerland Principles of Cancer Biology and Therapy Prof Dr Solange Peters, MD, PhD Cancer Center Lausanne Switzerland Cancer is an umbrella term covering a plethora of conditions characterized by unscheduled and

More information

BIO 302: MARCH 4 & 6, 2014

BIO 302: MARCH 4 & 6, 2014 BIO 302: MARCH 4 & 6, 2014 WEEK 8 LECTURE 2: CANCER AS A COMPLEX ADAPTIVE SYSTEM Dr. George Poste Chief Scientist, Complex Adaptive Systems Initiative and Del E. Webb Chair in Health Innovation Arizona

More information

3 cell types in the normal ovary

3 cell types in the normal ovary Ovarian tumors 3 cell types in the normal ovary Surface (coelomic epithelium) the origin of the great majority of ovarian tumors 90% of malignant ovarian tumors Totipotent germ cells Sex cord-stromal cells

More information

Spermatogonial stem cells: What does the future hold?

Spermatogonial stem cells: What does the future hold? F, V & V IN OBGYN, 2011, 3 (1): 36-40 Viewpoint Spermatogonial stem cells: What does the future hold? H. TOURNAYE, E. GOOSSENS Research unit Biology of the Testis; Department of Embryology and Genetics;

More information

Genetic Studies of Dysgerminoma

Genetic Studies of Dysgerminoma Genetic Studies of Chromosome 12p abnormalities are characteristic of germ cell tumors isochromosome 12p and 12p overrepresentation Some can be detected by karyotyping FISH study of 21 dysgerminomas showed

More information

New methods for embryo selection: NGS and MitoGrade

New methods for embryo selection: NGS and MitoGrade New methods for embryo selection: NGS and MitoGrade Santiago Munné, PhD US: Livingston, Los Angeles, Chicago, Portland, Miami / Europe: Barcelona (Spain), Oxford (UK), Hamburg (Germany) / Asia: Kobe (Japan),

More information

Canadian College of Medical Geneticists (CCMG) Cytogenetics Examination. May 4, 2010

Canadian College of Medical Geneticists (CCMG) Cytogenetics Examination. May 4, 2010 Canadian College of Medical Geneticists (CCMG) Cytogenetics Examination May 4, 2010 Examination Length = 3 hours Total Marks = 100 (7 questions) Total Pages = 8 (including cover sheet and 2 pages of prints)

More information

Lung Physiology. Jamie Havrilak, PhD Postdoctoral Research Associate Layden Lab October 26th, 2018

Lung Physiology. Jamie Havrilak, PhD Postdoctoral Research Associate Layden Lab October 26th, 2018 Lung Physiology Jamie Havrilak, PhD Postdoctoral Research Associate Layden Lab October 26th, 2018 Nkx2.1- Lung epithelium Endomucin- Vasculature Alveoli/Capillaries: Site of Gas Exchange in the Lung

More information

Supplementary Figure 1. Estimation of tumour content

Supplementary Figure 1. Estimation of tumour content Supplementary Figure 1. Estimation of tumour content a, Approach used to estimate the tumour content in S13T1/T2, S6T1/T2, S3T1/T2 and S12T1/T2. Tissue and tumour areas were evaluated by two independent

More information

When Cancer Looks Like Something Else: How Does Mutational Profiling Inform the Diagnosis of Myelodysplasia?

When Cancer Looks Like Something Else: How Does Mutational Profiling Inform the Diagnosis of Myelodysplasia? Transcript Details This is a transcript of a continuing medical education (CME) activity accessible on the ReachMD network. Additional media formats for the activity and full activity details (including

More information

Meiosis. Formation of gamete = egg & sperm. Occurs only in ovaries and tees. Makes cells with haploid chromosome number

Meiosis. Formation of gamete = egg & sperm. Occurs only in ovaries and tees. Makes cells with haploid chromosome number Meiosis Formation of gamete = egg & sperm Occurs only in ovaries and tees Makes cells with haploid chromosome number Meiosis Diploid= Full set of chromosomes 46 chromosomes in humans Found in most body

More information

3/31/2014. New Directions in Aplastic Anemia Treatment: What s on the Horizon? Objectives

3/31/2014. New Directions in Aplastic Anemia Treatment: What s on the Horizon? Objectives New Directions in Aplastic Anemia Treatment: What s on the Horizon? AA & MDS International Foundation Living with, MDS, or PNH Patient and Family Conferences in 2014 April 5, 2014 Objectives To provide

More information

Development of Carcinoma Pathways

Development of Carcinoma Pathways The Construction of Genetic Pathway to Colorectal Cancer Moriah Wright, MD Clinical Fellow in Colorectal Surgery Creighton University School of Medicine Management of Colon and Diseases February 23, 2019

More information

Reproduction. Asexual vs Sexual

Reproduction. Asexual vs Sexual Reproduction Asexual vs Sexual Why is Reproduction Important? The means by which an organism produces offspring Biologically and evolutionarily speaking, reproduction is what has made the continuation

More information

5.1. KEY CONCEPT Cells have distinct phases of growth, reproduction, and normal functions. 68 Reinforcement Unit 2 Resource Book

5.1. KEY CONCEPT Cells have distinct phases of growth, reproduction, and normal functions. 68 Reinforcement Unit 2 Resource Book 5.1 THE CELL CYCLE KEY CONCEPT Cells have distinct phases of growth, reproduction, and normal functions. Cells have a regular pattern of growth, DNA duplication, and division that is called the cell cycle.

More information

SALSA MLPA probemix P383-A1 T-ALL Lot A

SALSA MLPA probemix P383-A1 T-ALL Lot A SALSA MLPA probemix P383-A1 T-ALL Lot A1-0213. T-lineage acute lymphoblastic leukaemia (T-ALL) is a clonal malignant disorder of immature T-cells, which accounts for about 15% of paediatric and 25% of

More information

Insights into the Cell-of-Origin of the Histiocytoses Using Patient-Derived Xenograft Models

Insights into the Cell-of-Origin of the Histiocytoses Using Patient-Derived Xenograft Models Insights into the Cell-of-Origin of the Histiocytoses Using Patient-Derived Xenograft Models 4 th Annual International Erdheim-Chester Disease Medical Symposium Paris, France September 15, 2016 Benjamin

More information

OVARIES. MLS Basic histological diagnosis MLS HIST 422 Semester 8- batch 7 L13 Dr: Ali Eltayb.

OVARIES. MLS Basic histological diagnosis MLS HIST 422 Semester 8- batch 7 L13 Dr: Ali Eltayb. OVARIES MLS Basic histological diagnosis MLS HIST 422 Semester 8- batch 7 L13 Dr: Ali Eltayb. OBJECTIVES Recognize different disease of ovaries Classify ovarian cyst Describe the pathogenesis, morphology

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION doi:1.138/nature11463 %Sox17(+) 9 8 7 6 5 4 3 2 1 %Sox17(+) #Sox17(+) d2 d4 d6 d8 d1 d12 d14 d18 25 2 15 1 5 Number of Sox17(+) cells X 1 Supplementary Figure 1: Expression of

More information

DISORDERS OF MALE GENITALS

DISORDERS OF MALE GENITALS Wit JM, Ranke MB, Kelnar CJH (eds): ESPE classification of paediatric endocrine diagnosis. 9. Testicular disorders/disorders of male genitals. Horm Res 2007;68(suppl 2):63 66 ESPE Code Diagnosis OMIM ICD10

More information