The Mechanism of Action of Macrolides, Lincosamides and Streptogramin B Reveals the Nascent Peptide Exit Path in the Ribosome

Transcription

1 doi: /s (03) J. Mol. Biol. (2003) 330, The Mechanism of Action of Macrolides, Lincosamides and Streptogramin B Reveals the Nascent Peptide Exit Path in the Ribosome Tanel Tenson 1 *, Martin Lovmar 2 and Måns Ehrenberg 2 1 Institute of Technology Tartu University, Riia 23 Tartu 51010, Estonia 2 Department of Cell and Molecular Biology, BMC Box 596, Uppsala University S Uppsala, Sweden *Corresponding author The macrolide lincosamide streptogramin B class (MLS) of antibiotics contains structurally different but functionally similar drugs, that all bind to the 50 S ribosomal subunit. It has been suggested that these compounds block the path by which nascent peptides exit the ribosome. We have studied the mechanisms of action of four macrolides (erythromycin, josamycin, spiramycin and telithromycin), one lincosamide (clindamycin) and one streptogramin B (pristinamycin IA). All these MLS drugs cause dissociation of peptidyl-trna from the ribosome. Josamycin, spiramycin and clindamycin, that extend to the peptidyl transferase center, cause dissociation of peptidyl-trnas containing two, three or four amino acid residues. Erythromycin, which does not reach the peptidyl transferase center, induces dissociation of peptidyl-trnas containing six, seven or eight amino acid residues. Pristinamycin IA causes dissociation of peptidyl-trnas with six amino acid residues and telithromycin allows polymerisation of nine or ten amino acid residues before peptidyl-trna dissociates. Our data, in combination with previous structural information, suggest a common mode of action for all MLS antibiotics, which is modulated by the space available between the peptidyl transferase center and the drug. q 2003 Elsevier Ltd. All rights reserved Keywords: erythromycin; ketolides; clindamycin; pristinamycin IA; peptidyl-trna Introduction Macrolides, lincosamides and streptogramin B (MLS) are clinically useful antibiotics (Figure 1), which all bind to the large ribosomal subunit, close to the peptidyl transferase center. 1 3 This center is composed entirely of RNA and catalyzes formation of peptide bonds during protein elongation. 4,5 Several alterations in 23 S ribosomal RNA, e.g. methylation of A2058, give resistance against all members of the MLS group. 6 The macrolides contain a 14-, 15- or 16-membered lactone ring, substituted with several neutral or amino sugars. The 14-membered ring erythromycin is probably the best known macrolide 7 (Figure 1). Josamycin and spiramycin exemplify 16-membered lactone ring macrolides (Figure 1). Abbreviations used: MLS, macrolides, lincosamides and streptogramin B; ORF, open reading frame; Pth, peptidyl-trna hydrolase. address of the corresponding author: ttenson@ebc.ee Recently, ketolides (including telithromycin) with wider spectra of activity against pathogens were developed from 14-membered macrolides. These drugs contain a keto group instead of the cladinose residue at position 3 of the lactone ring and have alkyl aryl side-chains (Figure 1) Although functionally similar to the macrolides, the lincosamides and streptogramin B-type antibiotics have quite different structures (Figure 1). Lincosamides and macrolides that contain a mycarose sugar inhibit the peptidyl transferase reaction, 12,13 having binding sites partly overlapping with substrates of the peptidyl transferase. 2,3 In contrast, macrolides of the erythromycin group and streptogramin B type antibiotics do not inhibit the peptidyl transfer reaction per se. 14,15 Rather, they block the entrance to the tunnel in the large ribosomal subunit, 4,16,17 through which many, if not all, nascent peptide chains exit the ribosome. 18 Blocking of the exit tunnel by macrolides induces premature dissociation of peptidyl-trnas from the ribosome. 19,20 Such drop-off events occur just after initiation of protein synthesis, when the /$ - see front matter q 2003 Elsevier Ltd. All rights reserved

2 1006 Nascent Peptide Exit Path in the Ribosome Figure 1. Chemical structures of antibiotics used in the current study. Spiramycin is a mixture of three compounds as indicated in the Figure. nascent polypeptide chain is short. In contrast, ribosomes that have entered polysomes are refractory to the drug. It has been proposed that MLS antibiotics destabilise the binding of nascent peptides to the ribosome, 24 but their inhibitory mechanisms have remained obscure due to lack of structural information about the interactions between nascent peptides and the ribosome. Recently solved X-ray crystal structures now reveal molecular details of how MLS antibiotics bind to the 50 S subunit. 2,3,11 To clarify the structure function relations of this group of drugs and other inhibitors of protein synthesis, we have developed an experimental system that allows detailed studies of their modes of action. The results put the action of the MLS antibiotics into a new perspective and help to track the path along which nascent peptides exit the ribosome through the tunnel in the 50 S subunit. Results To study the mechanism of action of the MLS antibiotics, a cell-free system for protein synthesis was reconstituted from Escherichia coli components. 25 Different nascent peptides can have very different chemical properties. Therefore, their interactions with the ribosome can be different, leading to differences in their sensitivity against MLS antibiotics. For instance, synthesis of polyphenylalanine is poorly inhibited by erythromycin and streptogramin B, while these drugs strongly inhibit incorporation of basic amino acids. Peptides translated from homopolymeric ribonucleotides and other chemically synthesized mrna analogues have amino acid compositions that are not likely to be found in nature. In contrast, the current study uses naturally occurring peptide sequences. Two different mrnas were translated in the absence or in the presence of the antibiotics. The first mrna contained an open reading frame (ORF) encoding the 12 N-terminal amino acids of the phage MS2 coat protein (to improve the efficiency of peptide production, the alanine residue in position 2 was substituted with valine), 29,30 and the second an ORF encoding the first nine amino acid residues of the ermc operon leader peptide. 31 The translation reactions did not contain polypeptide chain release factors. Therefore, complexes between ribosomes and peptidyltrnas corresponding to the last codon of the ORF

3 Nascent Peptide Exit Path in the Ribosome 1007 Figure 2. Experimental design for quantification of peptidyl-trnas bound to the ribosome and peptidyltrnas dissociated in drop-off events. Peptidyl-tRNAs that dissociate from the ribosome by drop-off are hydrolyzed by the action of peptidyl-trna hydrolase (Pth). The translation reactions are stopped by addition of formic acid, a treatment that precipitates all high molecular mass molecules (including peptidyl-trnas and ribosomes), but leaves the hydrolyzed peptides in solution. After centrifugation, peptides in both pellet and supernatant are quantified by reverse-phase HPLC with on-line radiometry (Figure 3). were formed in the absence of antibiotics. The translation reactions contained the enzyme peptidyl-trna hydrolase (Pth). 32 Peptidyl-tRNAs that dissociated from the ribosome by drop-off were hydrolyzed by the action of Pth, but not those remaining bound to the ribosome. 33 The incubations were stopped by addition of formic acid; a treatment that precipitated peptidyl-trnas and left most of the free peptides in solution. After centrifugation, peptides in both pellet and supernatant were quantified by reverse-phase HPLC with on-line radiometry (Figures 2 and 3). Some of the free, full-length erm and MS2 peptides precipitated in the presence of formic acid. This made estimates of their amounts less precise than those of shorter peptides (Figures 4 and 5). With every drug, the experiment was repeated at least three times, and the relative amounts of the shorter peptides varied by less than 20%. The conclusions presented in Figure 6 are based on at least three independent experiments, all showing the same tendency and with little variation between them. The experiments revealed that all MLS antibiotics in our study caused dissociation of peptidyl-trna from the ribosome, but the lengths of their peptides differed from drug to drug. Spiramycin and clindamycin, which bind close to the peptidyl transferase center, 2,3 as well as josamycin induced dissociation of peptidyl-trnas containing Figure 3. Examples of chromatograms that were used for quantification of MS2 peptides produced in the cell-free translation system. Retention times for different peptides are indicated below the chromatograms. (Small amounts of [ 3 H]methionine, formyl-[ 3 H]methionine and [ 3 H]Met-tRNA were present in the [ 3 H]fMet-tRNA preparation.) (a) In the absence of antibiotics, mostly full-length peptides are produced. Because no polypeptide chain release factor is present, the full-length peptides remain on the ribosomes in the form of peptidyl-trnas and precipitate with formic acid. (b) In the absence of antibiotics, no significant accumulation of peptides is observed in the formic acid supernatant. (c) Erythromycin decreases the amount of full-length product in the formic acid precipitate. (d) The biggest effect of erythromycin is observed in the formic acid supernatant, where peptides containing six, seven or eight amino acid residues accumulate.

4 1008 Nascent Peptide Exit Path in the Ribosome Figure 4. Accumulation of peptides during translation of the MS2 mrna. (a) Sequence of the MS2 peptide. (b) Peptides in the formic acid precipitate (corresponding to the peptidyl-trnas that did not dissociate from the ribosome, stalled peptidyl-trna). (c) Peptides in the formic acid-soluble fraction (corresponding to the peptidyltrna drop-off events). two, three or four amino acid residues (Figures 4 and 5). Josamycin has a structure similar to that of carbomycin, which also binds close to the peptidyl transferase center, 3 and therefore in this study carbomycin has been used to model josamycin ribosome interactions. Erythromycin, which does not reach the peptidyl transferase center, 2,3 as well as pristinamycin IA induced drop-off of peptidyltrnas with six, seven or eight amino acid residues (Figures 4 and 5). Telithromycin, the smallest of the macrolides tested, allowed polymerisation of nine or ten amino acid residues before dissociation of peptidyl-trna occurred (Figure 4). The effects of the drugs on the synthesis of the two peptides were quite similar, but small differences in the peptide length spectra could be seen for the antibiotics that extend to the vicinity of the peptidyl transferase center (Figures 4 and 5). For instance, josamycin induced drop-off of dipeptidyl-trna and tripeptidyl-trna during synthesis of the erm peptide, which contains glycine in the second position. In contrast, this drug caused dissociation only of dipeptidyl-trna during synthesis of the MS2 peptide, which contains valine in the second position. Furthermore, spiramycin caused mainly accumulation of tetrapeptidyltrna during synthesis of the erm peptide and dipeptidyl-trna in the case of the MS2 peptide. Clindamycin caused accumulation of dipeptidyltrna and tetrapeptidyl-trna in the case of the erm peptide and di- and tripeptidyl-trna in the case of the MS2 peptide. For erythromycin, which does not reach the peptidyl transferase center, as well as pristinamycin IA, the inhibition pattern was identical for the two peptides tested. These drugs induced dissociation of peptidyl-trnas containing six, seven or eight amino acid residues. Finally, telithromycin caused drop-off of peptidyltrnas containing nine or ten amino acid residues during synthesis of the MS2 peptide, and failed to inhibit synthesis of the full-length erm peptide with nine amino acid residues. Discussion The experiments described here have probed what happens during translation of the mrnas for two different peptide chains (the N-terminal sequence of the phage MS2 coat protein and the ermc operon leader peptide) by ribosomes in complex with macrolides (erythromycin, josamycin, spiramycin and telithromycin), a lincosamide (clindamycin) and a streptogramin B (pristinamycin IA). We found that all these drugs cause dissociation of peptidyl-trnas from the ribosome. It

5 Nascent Peptide Exit Path in the Ribosome 1009 Figure 5. Accumulation of peptides during translation of the erm mrna. (a) Sequence of the erm peptide. (b) Peptides in the formic acid precipitate (corresponding to the peptidyl-trnas that did not dissociate from the ribosome, stalled peptidyl-trna). (c) Peptides in the formic acid-soluble fraction (corresponding to the peptidyltrna drop-off events). was observed previously that erythromycin and streptogramin B cause dissociation of peptidyltrna from the ribosome during translation of poly(u) or poly(a,c) messengers. 15,19,27,28 These in vitro studies are in line with other previous in vivo experiments showing that macrolides and lincosamides cause accumulation of peptidyl-trna in the cell. 20,34,35 It is known that accumulation of peptidyl-trna in the cell causes depletion of free trna pools and is therefore toxic. 33,36,37 It is likely that most nascent peptides exit the ribosome through a tunnel in the 50 S subunit. 4,18 The binding sites for the MLS antibiotics are located in the beginning of this tunnel, before it is constricted by the ribosomal proteins L4 and L22. 2,3,11 Figure 6(a) shows the 23 S RNA nucleotides A2058, A2059 and A2062 (E. coli numbering) that are essential for binding of the MLS antibiotics. All three nucleotides interact directly with the macrolides; A2062 forms a covalent bond with the ethylaldehyde group in 16-membered macrolides. 3 One explanation for the effects of the MLS drugs could therefore be that they prevent nascent peptides from entering the tunnel. When this happens one would expect that further peptide elongation is inhibited, and that the only way a peptidyl-trna can leave the ribosome is in a drop-off event. Figures 6(b) (f) show the crystal structures of carbomycin, clindamycin, spiramycin, erythromycin and a ketolide, ABT 773, in complex with the large ribosomal subunit. 2,3,11 In this study, carbomycin has been used to model josamycin ribosome interactions because these compounds have very similar structures; moreover, the chemical groups approaching the peptidyl transferase center are identical. In the ketolides ABT 773 and telithromycin, the large hydrophobic group (alkyl aryl or quinollylallyl, respectively) is attached to the lactone ring in different positions. However, the same cis-acting small peptides containing a specific consensus sequence confer resistance to all ketolides, 8,38 but not to other macrolides, 8,39 suggesting that this subgroup of macrolides has members with the same structural and functional modes of action. Accordingly, we use the ABT 773:50 S subunit complex 11 as a guide to how telithromycin binds to the ribosome. The distance between drug and peptidyl transferase center is shortest for josamycin (4.2 Å), about the same for clindamycin (4.6 Å), significantly larger for spiramycin (7 Å), even larger for

6 1010 Nascent Peptide Exit Path in the Ribosome Figure 6. The Figure shows the crystal structure of 50 S subunits in complex with a peptidyl-trna analogue and different MLS antibiotics as well as the distance between each drug and N3 of A2451, an atom located very close to the catalytic site of the peptidyl transferase. 4,5,46 It shows, in each case, the lengths of the peptides in the peptidyl-trnas that dissociate from the ribosome by the action of the drug (length of the peptide in the major drop off product is written in bold face). (a) Haloarcula marismortui 50 S subunit with a dipeptidyl-trna analogue in the A site. 47 For clarity, parts of the analogue (caproic acid and biotin residues) are not shown. The N-terminal phenylalanine residue is shown in red, the next, tyrosine residue in black and A76 of trna is shown in magenta. Nucleotides A2058, A2059, A2062 (E. coli numbering) of the 23 S ribosomal RNA, essential for macrolide binding, are shown in green, A2451, an important component of the peptidyl transferase center, 4,5 is shown in red and C2452 is shown in blue. N3 of A2451 of 23 S RNA is shown in yellow and the proteins L4 and L22 that form part of the tunnel wall 4,5,46 are shown in blue and yellow, respectively. (b) Carbomycin A bound to the H. marismortui 50 S ribosomal subunit. 3 Carbomycin has been used as a guide for josamycin ribosome interactions. These compounds have very similar chemical structures and have the same groups (mycaminose, mycarose and isobutyrate residues) approaching the peptidyl-transferase center. The lactone ring is shown in red, the mycaminose and mycarose residues in black and the isobutyrate residue, which approaches the peptidyl transferase center, is shown in magenta. (c) Clindamycin (red), bound to the Deinococcus radiodurans 50 S ribosomal subunit. 2 erythromycin (10.6 Å) and largest for ketolides (12.9 Å). If the mode of action of the antibiotics is to block peptide growth and subsequent entrance to the exit tunnel, there should be a strong positive correlation between the space available between the drug and the peptidyl transferase center on one hand and, on the other, the length of peptides in the peptidyl-trnas that dissociate from ribosomes under the influence of these drugs. To test this hypothesis, we determined the lengths of the peptide chains on peptidyl-trnas that had dissociated from the ribosome by the action of the MLS drugs during translation of two different ORFs. Translation of the ORF for the MS2 N-terminal peptide (Figure 4(a)) resulted in dropoff of dipeptidyl-trna in the presence of josamycin, di- and tripeptidyl-trnas in the case of clindamycin, dipeptidyl-trna in the case of spiramycin and peptidyl-trnas with six or seven amino acid residues in the case of erythromycin (Figure 4(c)). Translation of the ORF for the erm peptide (Figure 5(a)) resulted in drop-off of diand tripeptidyl-trna in the case of josamycin, diand tetrapeptidyl-trna in the case of clindamycin, di-, tri- and tetrapeptidyl-trna in the case of spiramycin and hexa-, hepta- or octapeptidyltrnas for erythromycin (Figure 5(c)). The position of ketolides farther into the tunnel and the absence of the cladinose sugar residue from their structure (Figure 1) suggest that they leave more space for the growing peptide than erythromycin (Figure 6(e)). This is in line with the finding that telithromycin caused drop-off of peptidyl-trnas with peptides ranging from nine to 12 amino acid residues in the case of the MS2 peptide (Figure 4(c)) and did not cause any drop-off during the synthesis of the erm peptide (Figure 5(c)). Pristinamycin IA, a streptogramin B-type antibiotic, caused dissociation of hexapeptidyl-trnas from the ribosome (Figures 4(c) and 5(c)). Although a crystal structure of the 50 S subunit and a streptogramin B drug is still missing, the fact that erythromycin and pristinamycin IA induced drop-off of peptidyl-trnas with similar peptide lengths (Figures 4(c) and 5(c)) suggest that they both block the ribosomal tunnel and give similar space for the nascent peptide to grow. The streptogramin (d) Spiramycin, bound to the H. marismortui 50 S ribosomal subunit. 3 The lactone ring is shown in red, the mycaminose and mycarose residues in black and the forosamine moiety in magenta. (e) Erythromycin, bound to the D. radiodurans 50 S ribosomal subunit. 2 The desosamine residue of erythromycin is shown in black and the cladinose moiety (not present in ketolides) is shown in magenta. (f) ABT 773 in the D. radiodurans 50 S ribosomal subunit, 11 as a guide to the binding of telithromycin to the ribosome. The desosamine residue of ABT 773 is shown in black and the quinollylallyl group in magenta.

7 Nascent Peptide Exit Path in the Ribosome 1011 antibiotics contain two chemically distinct components, A (pristinamycin IIA) and B (pristinamycin IA), which act on the ribosome synergistically. 1,15 It is possible that the low level of inhibition by pristinamycin IA that has been observed in the current study (Figures 4 and 5) could be enhanced by pristinamycin IIA. These data are compatible with a mechanism for inhibition of protein synthesis that is shared by all antibiotics in the MLS group. The suggestion is that they all block the entrance to the ribosomal tunnel, but that the space they allow for nascent peptides is restricted to different degrees (Figure 6). The peptide will in each case grow to a point where further peptidyl-transfer is inhibited by steric hindrance, and this inhibition will eventually lead to dissociation of the peptidyltrna from the ribosome. This would explain previous observations that some MLS drugs inhibit peptidyl transfer due to lack of space for further growth of the nascent peptide Unfortunately, we do not know in which conformation the nascent peptides are in the ribosome. However, we do know that the peptides cannot be in an extended conformation in the presence of erythromycin, pristinamycin IA or telithromycin, since then five amino acid residues would cover a distance of approximately 14 Å. Our experimental design with long incubation times (one minute) allowed estimation of only the probability of drop-off versus the probability of peptidyl transfer for every length of peptide, but did not reveal the absolute rates of these reactions. The increased drop-off probabilities could therefore be caused by enhanced dissociation rates of peptidyl-trna, reduced peptidyl transfer rates or by a combination of these two effects. Our data have shown that clindamycin, erythromycin and pristinamycin IA lose their ability to inhibit protein synthesis on ribosomes with peptides that have grown beyond a critical length (Figures 4 and 5). This is in agreement with in vivo data, that erythromycin can inhibit protein synthesis only at, or just after, initiation of mrna translation. 21 One reason could be that the MLS drugs and the nascent peptide chains have overlapping binding sites in the ribosome. 22,23 Since the affinity of peptidyl-trnas with long peptide chains to the ribosome is very high, the drugs may be unable to compete for these binding sites when the peptides are long. The peptide length at which the MLS antibiotics started to inhibit protein synthesis was remarkably similar for the two ORFs tested (Figures 4 and 5). Only when translation is blocked in the very early stage, as in the case of josamycin, spiramycin and clindamycin, could a difference be seen in the peptide lengths for the two ORFs. For antibiotics causing dissociation of peptidyl-trnas with longer peptides, the inhibition pattern on the two mrnas was essentially identical. This suggests that the nascent peptide is following a backbone track in the tunnel, so that derailments are independent of the amino acid side-chain properties and depend only on where the track is blocked by the antibiotic. With the recent emergence of high-resolution crystal structures, the research on ribosomes and ribosome-targeted antibiotics has made a significant step forward. Previously, most biochemical studies on the mechanism of action of ribosometargeted antibiotics have been performed in translation systems with chemically synthesized mrna analogues, making the results less relevant for the in vivo situation. Moreover, the exact nature of the reaction products has not been determined. The approaches developed in this study have overcome these experimental limitations. Interactive approaches, where structural information at atomic resolution and the results from advanced biochemistry are combined, bear promise of a much deeper understanding of basic mechanisms of protein synthesis as well as of the principles underlying antibiotic action. Materials and Methods Chemicals and buffers GTP, ATP and [ 3 H]Met were from Amersham Biosciences. Putrescine, spermidine, phosphoenolpyruvate, Myokinase and non-radioactive amino acids were from Sigma. Pyruvate kinase was from Boehringer Mannheim. All experiments were performed in Polymix buffer containing 5 mm magnesium acetate, 5 mm ammonium chloride, 95 mm potassium chloride, 0.5 mm calcium chloride, 8 mm putrescine, 1 mm spermidine, 5 mm potassium phosphate and 1 mm dithioerythritol (DTE). 40 Clindamycin, erythromycin and spiramycin were from Sigma; josamycin was from ICN Biomedicals, telithromycin was from Aventis Pharma. mrna The template DNAs for in vitro transcription were prepared by annealing the following oligonucleotides at the complementary sequences (underlined) and filling the gaps by PCR. Forward oligonucleotide: CTCTCTGGTA CCGAAATTAATACGACTCACTATAGGGAATTCGGG CCCTTGTTAACAATTAAGGAGG. Reverse MS: TTTTTTTTTTTTTTTTTTTTTCTGCAGATTTAGTCA ACCAGAACGAACTGGGTGAAGTTAGAAACCATAG TATACCTCCTTAATTGTTAACAAGGGCCCG Reverse erm: TTTTTTTTTTTTTTTTTTTTTCTGCAGATTTAGATTA CAAAAATGCTAAAAATGCCCATAGTATACCTCCTTA ATTGTTAACAAGGGCCCG In vitro transcription and purification of mrnas containing a poly(a) tail were as described by Pavlov & Ehrenberg. 41 Other components of the translation system Ribosomes were prepared from E. coli MRE600 by sucrose-gradient ultracentrifugation essentially accord-

8 1012 Nascent Peptide Exit Path in the Ribosome ing to Rodnina & Wintermeyer, 42 but with minor modifications. Initiation factors were purified from overproducing strains largely according to Soffientini et al. 43 but with some modifications (A. Raine et al. unpublished results). Elongation factors EF-Tu, EF-Ts and EF-G were purified according to Ehrenberg et al. 44 However, the following steps were added to the EF-Tu and EF-G protocols to achieve greater purity. The semi-pure EF-Tu was loaded onto a Q-Sepharose Fast Flow column (Amersham Biosciences) with a gradient of 400 ml þ 400 ml from 80 mm to 400 mm KCl in buffer A (64.4 mm Tris HCl (ph 7.5), 10 mm MgCl 2, 0.5 mm DTE, 100 mm phenylmethylsulphonyl fluoride (PMSF), 3 mm, NaN 3 ). Fractions containing EF-Tu were precipitated with 40 mg/ml of (NH 4 ) 2 SO 4. After centrifugation, the pellet was dissolved in buffer A with 80 mm KCl and run on an Ultrogel AcA 44 (Biosepra) column (5 cm 120 cm) before dialyzing against Polymix buffer. Similarly, the semi-pure EF-G was loaded onto a Q-Sepharose Fast Flow column (using the same gradient as for EF-Tu) before dialysis against Polymix buffer. Details of the cloning, overexpression and purification of E. coli aminoacyl-trna synthetases will be published separately. trna bulk was purified from crude trna (E. coli) essentially according to Lee & Marshall 45 but with minor modifications. [ 3 H]fMet-tRNA Met was prepared from trna bulk largely according to Freistroffer et al. 25 but with minor modifications. Translation reaction An initiation mix containing 1.75 mm ribosomes (,50% active), 2.6 mm [ 3 H]fMet-tRNA Met,5mM mrna, 0.6 mm each IF1, IF2 and IF3 was preincubated for ten minutes at 37 8C together with the antibiotic under study at a concentration of 30 mm. An elongation mix was preincubated for ten minutes at 37 8C. It contained 1.75 mm EF-G, 52.5 mm EF-Tu, 0.5 mm EF-Ts and,0.18 nm trna bulk, unit/ml of AARS (defined by Ehrenberg et al. 44 ), 0.56 mm Pth and 280 mm each amino acid coded for by the mrna. In addition, both initiation and elongation mix contained 1 mm ATP and 1 mm GTP, together with 10 mm phosphoenolpyruvate, 3 mg/ ml of myokinase and 50 mg/ml of pyruvate kinase. 40 After preincubation, these two mixes were combined and incubated at 37 8C. Each reaction of 100 ml contained,40 pmol of active ribosomes. After one minute the reaction was quenched by adding 10 ml of formic acid. Peptide analysis The formic acid quenching causes all high molecular mass molecules to precipitate. This precipitate was pelleted by centrifugation and the supernatant containing peptides released from peptidyl-trnas by Pth (referred to as the soluble fraction) was transferred into new Eppendorf tubes. The volume was adjusted to 170 ml by adding water and 130 ml of this solution was used in the HPLC analysis described below. The pellet was treated with 160 ml of 0.5 M KOH for ten minutes at room temperature to hydrolyze all peptidyl-trnas and aminoacyl trnas still bound to the ribosome after the reaction and thereby not hydrolyzed by Pth. Subsequently, 10 ml of formic acid was added to precipitate the high molecular mass molecules; 130 ml of this supernatant (referred to as the precipitate fraction) was used in HPLC analysis. The peptide contents of the soluble and precipitate fractions were determined by using a gradient from 10% to 90% (v/v) methanol (with 0.1% (v/v) trifluoroacetic acid) on a C18 RP-HPLC column (Merck). The HPLC was coupled to a flow scintillation counter, which gave a quantitative measurement of the peptide content. Peptides were identified by comparing with the standards produced in the cell-free translation system. Standard peptides were obtained by omitting certain amino acids and aminoacyl-trna synthetases or by using mrnas coding for shorter peptides. Acknowledgements We thank Ülo Maiväli for critical comments on the manuscript. Nick Dixon kindly provided the strains for overexpression of aminoacyl-trna synthetases. We thank Aventis Pharma for providing telithromycin. This work was supported by the Wenner-Grenska Samfundet Foundation, the Swedish Research Council and the Estonian Science Foundation. References 1. Porse, B. T. & Garrett, R. A. (1999). Sites of interaction of streptogramin A and B antibiotics in the peptidyl transferase loop of 23 S rrna and the synergism of their inhibitory mechanisms. J. Mol. Biol. 286, Schlunzen, F., Zarivach, R., Harms, J., Bashan, A., Tocilj, A., Albrecht, R. et al. (2001). Structural basis for the interaction of antibiotics with the peptidyl transferase centre in eubacteria. Nature, 413, Hansen, J. L., Ippolito, J. A., Ban, N., Nissen, P., Moore, P. B. & Steitz, T. A. (2002). The structures of four macrolide antibiotics bound to the large ribosomal subunit. Mol. Cell, 10, Nissen, P., Hansen, J., Ban, N., Moore, P. B. & Steitz, T. A. (2000). The structural basis of ribosome activity in peptide bond synthesis. Science, 289, Moore, P. B. & Steitz, T. A. (2002). The involvement of RNA in ribosome function. Nature, 418, Weisblum, B. (1995). Erythromycin resistance by ribosome modification. Antimicrob. Agents Chemother. 39, Alvarez-Elcoro, S. & Enzler, M. J. (1999). The macrolides: erythromycin, clarithromycin and azithromycin. Mayo Clin. Proc. 74, Tenson, T. & Mankin, A. (2001). Short peptides conferring resistance to macrolide antibiotics. Peptides, 22, Vester, B. & Douthwaite, S. (2001). Macrolide resistance conferred by base substitutions in 23 S rrna. Antimicrob. Agents Chemother. 45, Zhong, P. & Shortridge, V. (2001). The emerging new generation of antibiotic: ketolides. Curr. Drug Targets Infect. Disord. 1, Schlunzen, F., Harms, J. M., Franceschi, F., Hansen, H. A., Bartels, H., Zarivach, R. & Yonath, A. (2003).

9 Nascent Peptide Exit Path in the Ribosome 1013 Structural basis for the antibiotic activity of ketolides and azalides. Structure, 11, Douthwaite, S. (1992). Interaction of the antibiotics clindamycin and lincomycin with Escherichia coli 23 S ribosomal RNA. Nucl. Acids Res. 20, Poulsen, S. M., Kofoed, C. & Vester, B. (2000). Inhibition of the ribosomal peptidyl transferase reaction by the mycarose moiety of the antibiotics carbomycin, spiramycin and tylosin. J. Mol. Biol. 304, doi: /jmbi Mao, J. C.-H. & Robishaw, E. E. (1972). Erythromycin, a peptidyltransferase effector. Biochemistry, 11, Cocito, C., Di Giambattista, M., Nyssen, E. & Vannuffel, P. (1997). Inhibition of protein synthesis by streptogramins and related antibiotics. J. Antimicrob. Chemother. 39, Milligan, R. A. & Unwin, P. N. (1986). Location of exit channel for nascent protein in 80 S ribosome. Nature, 319, Yonath, A., Leonard, K. R. & Wittmann, H. G. (1986). A tunnel in the large ribosomal subunit revealed by three-dimensional image reconstruction. Science, 236, Tenson, T. & Ehrenberg, M. (2002). Regulatory nascent peptides in the ribosomal tunnel. Cell, 108, Otaka, T. & Kaji, A. (1975). Release of (oligo) peptidyl-trna from ribosomes by erythromycin A. Proc. Natl Acad. Sci. USA, 72, Menninger, J. R. & Otto, D. P. (1982). Erythromycin, carbomycin and spiramycin inhibit protein synthesis by stimulating the dissociation of peptidyl-trna from ribosomes. Antimicrob. Agents Chemother. 21, Andersson, S. & Kurland, C. G. (1987). Elongating ribosomes in vivo are refractory to erythromycin. Biochimie, 69, Tai, P. C., Wallace, B. J. & Davis, B. D. (1974). Selective action of erythromycin on initiating ribosomes. Biochemistry, 13, Contreras, A. & Vazquez, D. (1977). Cooperative and antagonistic interactions of peptidyl-trna and antibiotics with bacterial ribosomes. Eur. J. Biochem. 74, Kirillov, S., Porse, B. T., Vester, B., Woolley, P. & Garrett, R. A. (1997). Movement of the 3 0 -end of trna through the peptidyl transferase centre and its inhibition by antibiotics. FEBS Letters, 406, Freistroffer, D. V., Pavlov, M. Y., MacDougall, J., Buckingham, R. H. & Ehrenberg, M. (1997). Release factor RF3 in E. coli accelerates the dissociation of release factors RF1 and RF2 from the ribosome in a GTP dependent manner. EMBO J. 16, Vester, B. & Garrett, R. A. (1987). A plasmid-coded and site-directed mutation in Escherichia coli 23 S RNA that confers resistance to erythromycin: implications for the mechanism of action of erythromycin. Biochimie, 69, Chinali, G., Nyssen, E., Di Giambattista, M. & Cocito, C. (1988). Inhibition of polypeptide synthesis in cellfree systems by virginiamycin S and erythromycin. Evidence for a common mode of action of type B synergimycins and 14-membered macrolides. Biochim. Biophys. Acta, 949, Chinali, G., Nyssen, E., Di Giambattista, M. & Cocito, C. (1988). Action of erythromycin and virginiamycin S on polypeptide synthesis in cell-free systems. Biochim. Biophys. Acta, 951, Min Jou, W., Haegeman, G., Ysebaert, M. & Fiers, W. (1972). Nucleotide sequence of the gene coding for the bacteriophage MS2 coat protein. Nature, 237, Uhlenbeck, O. C. (1998). A coat for all sequences. Nature Struct. Biol. 5, Weisblum, B. (1995). Insights into erythromycin action from studies of its activity as inducer of resistance. Antimicrob. Agents Chemother. 39, Fromant, M., Plateau, P., Schmitt, E., Mechulam, Y. & Blanquet, S. (1999). Receptor site for the 5 -phosphate of elongator trnas governs substrate selection by peptidyl-trna hydrolase. Biochemistry, 38, Heurgué-Hamard, V., Dincbas, V., Buckingham, R. H. & Ehrenberg, M. (2000). Origins of minigenedependent growth inhibition in bacterial cells. EMBO J. 19, Menninger, J. R. & Coleman, R. A. (1993). Lincosamide antibiotics stimulate dissociation of peptidyltrna from ribosomes. Antimicrob. Agents Chemother. 37, Menninger, J. R., Coleman, R. A. & Tsai, L. N. (1994). Erythromycin, lincosamides, peptidyl-trna dissociation, and ribosome editing. Mol. Gen. Genet. 243, Heurgué-Hamard, V., Mora, L., Guarneros, G. & Buckingham, R. H. (1996). The growth defect in Escherichia coli deficient in peptidyl-trna hydrolase is due to starvation for Lys-tRNA(Lys). EMBO J. 15, Tenson, T., Herrera, J. V., Kloss, P., Guarneros, G. & Mankin, A. S. (1999). Inhibition of translation and cell growth by minigene expression. J. Bacteriol. 181, Tripathi, S., Kloss, P. S. & Mankin, A. S. (1998). Ketolide resistance conferred by short peptides. J. Biol. Chem. 273, Tenson, T., Xiong, L., Kloss, P. & Mankin, A. S. (1997). Erythromycin resistance peptides selected from random peptide libraries. J. Biol. Chem. 272, Jelenc, P. C. & Kurland, C. G. (1979). Nucleoside triphosphate regeneration decreases the frequency of translation errors. Proc. Natl Acad. Sci. USA, 76, Pavlov, M. Y. & Ehrenberg, M. (1996). Rate of translation of natural mrnas in an optimized in vitro system. Arch. Biochem. Biophys. 328, Rodnina, M. V. & Wintermeyer, W. (1995). GTP consumption of elongation factor Tu during translation of heteropolymeric mrnas. Proc. Natl Acad. Sci. USA, 92, Soffientini, A., Lorenzetti, R., Gastaldo, L., Parlett, J. H., Spurio, R., La Teana, A. & Islam, K. (1994). Purification procedure for bacterial translational initiation factors IF2 and IF3. Protein Expt. Purif. 5, Ehrenberg, M., Bilgin, N. & Kurland, C. G. (1990). Design and use of a fast and accurate in vitro translation system. In Ribosomes and Protein Synthesis (Spedding, G., ed.), pp , IRL Press, Oxford University Press, Oxford, UK. 45. Lee, K. M. & Marshall, A. G. (1986). High-speed preparative-scale separation and purification of ribosomal 5 S and 5.8 S RNA s via Sephacryl S-300

10 1014 Nascent Peptide Exit Path in the Ribosome gel filtration chromatography. Prep. Biochem. 16, Ramakrishnan, V. (2002). Ribosome structure and the mechanism of translation. Cell, 108, Schmeing, T. M., Seila, A. C., Hansen, J. L., Freeborn, B., Soukup, J. K., Scaringe, S. A. et al. (2002). A pretranslocational intermediate in protein synthesis observed in crystals of enzymatically active 50 S subunits. Nature Struct. Biol. 9, Edited by D. E. Draper (Received 25 March 2003; received in revised form 13 May 2003; accepted 14 May 2003)