RNA capture sequencing enabled liquid biopsy screening
|
|
|
- Claude Shaw
- 5 years ago
- Views:
Transcription
1 RNA capture sequencing enabled liquid biopsy screening Jo Vandesompele, Biogazelle CSO LKI symposium Liquid Biopsies & Cancer Leuven, Belgium, August 30, Biogazelle. All rights reserved. 1
2 Acknowledgements (A>Z) Carolina Fierro Manuel Luypaert Nele Nijs Pieter Mestdagh Sandra Steyaert Thomas Piofczyk Scott Kuersten Gary Schroth David Creytens Anneleen Decock Olivier De Wever Bert Dhondt An Hendrix Pieter Mestdagh Piet Ost Annouck Philippron Isabelle Rottiers Jo Van Dorpe Joni Van der Meulen Glen Vergauwen Kimberly Verniers Ken Op de Beeck Patrick Pauwels Marc Peeters Laure Sorber 2017 Biogazelle. All rights reserved. 2
3 RNA centric biotech company biomarker development disease characterization drug mode of action sequencing all types of RNA in tissue and fluids qpcr and dpcr assay design and validation antisense against lncrnas in cancer specialty lab services in the field of clinical trials or in routine diagnostics ISO17025 / GCLP 2017 Biogazelle. All rights reserved. 3
4 Liquid biopsies at Biogazelle digital PCR CNV/mutations microrna sequencing mrna/lncrna sequencing 2017 Biogazelle. All rights reserved. 4
5 Unmet needs in oncology more effective and less toxic treatments for durable responses combination therapies companion diagnostic tests > the right drug for the right patient better laboratory tests early diagnosis monitoring of treatment effectivity early detection of relapse or recurrence 2017 Biogazelle. All rights reserved. 5
6 Liquid biopsies are the holy grail of precision oncology easy to obtain low risk for the patient serial profiling > longitudinal studies reflects entire tumor load full of biomarker potential cell-free nucleic acids (DNA & RNA) circulating tumor cells extracellular vesicles tumor educated platelets 2017 Biogazelle. All rights reserved. 6
7 Active secretion and passive release of RNA into circulation vesicles exosomes, microvesicles, apoptotic bodies ribonucleoprotein complexes AGO2, high-density lipoproteins platelets intercellular communication biomarker potential abundance levels structural information (fusion, mutation, ) Wan et al., Nature Reviews Cancer, Biogazelle. All rights reserved. 7
8 Challenges in mrna sequencing (of clinical samples) fragmented/degraded RNA abundant unwanted RNA (ribosomal, hemoglobin) low input (0.2 ml liquid biopsy, 1 FFPE scroll, fine needle biopsy,) sense / antisense overlapping transcripts solution: probe based cdna enrichment, RNA capture sequencing 2017 Biogazelle. All rights reserved. 8
9 RNA capture sequencing history Levin, 2009 Ueno, 2012 Mercer, 2012 Halvardson, 2013 Cabanski, 2014 Biogazelle 467 genes 913 genes 2265 loci, 0.77 Mb exome exome on FFPE exome on plasma higher sensitivity higher transcriptome complexity fusion genes, variants 2017 Biogazelle. All rights reserved. 9
10 mrna capture sequencing fragmented RNA random primed ds cdna adaptor ligation PCR 2x capture PCR cleanup & quant 3 days of work; optimized conditions 21,415 mrnas 214,000 exons 425,000 probes 20M reads FFPE, 15M reads plasma +200 cases so far colon, lung, ovarium, breast, esophageal, pancreas custom probe set (452,000) for 52,000 human long non-coding RNAs 2017 Biogazelle. All rights reserved. 10
11 Colon & lung cancer samples sensitivity detected genes matching tumor FFPE, plasma and serum (n=2) detected genes with FPKM>=1 FFPE > 12,000 genes plasma > 8500 genes serum > 7500 genes 2017 Biogazelle. All rights reserved. 11
12 Colon & lung cancer samples strandedness, read distribution, coverage >99% strandedness coding regions enriched whole transcripts are covered (excl. UTR) 2017 Biogazelle. All rights reserved. 12
13 GAS5 lncrna sashimi plot in plasma 2017 Biogazelle. All rights reserved. 13
14 Colon & lung cancer samples reproducibility high reproducibility in plasma low abundant genes more variable in serum 2017 Biogazelle. All rights reserved. 14
15 Colon vs lung cancer plasma top 5 enriched significant pathways upon GSEA PI3K-AKT signaling pathway cell cycle osteoclast differentiation oxidative phosphorylation focal adhesion 2017 Biogazelle. All rights reserved. 15
16 Esophageal cancer plasma titration experimental design platelet-free / platelet-poor plasma cancer male : 100% 50% cancer 10% cancer 2x replicates for each sample 2% cancer healthy female : 0% FFPE from cancer tissue : 1x 2017 Biogazelle. All rights reserved. 16
17 Platelet-poor plasma (PPP) shows best reproducibility 0% cancer 2% cancer 10% cancer 50% cancer 100% cancer PFP PPP 2017 Biogazelle. All rights reserved. 17
18 Titration series to determine consistency of RNA abundance signal if healthy > cancer then 0 > 2 > 10 > 50 > 100 if cancer > healthy then 100 > 50 > 10 > 2 > 0 bin the fold-changes healthy vs. cancer determine fraction per bin that is titrating showing correct order 100% cancer 50% cancer 10% cancer 2% cancer healthy : 0% 2017 Biogazelle. All rights reserved. 18
19 Excellent titration response 25% lower expression is detected in 80% of the cases platelet-free platelet-poor titrating gene fraction titrating gene fraction 2017 Biogazelle. All rights reserved. 19
20 Ovarian cancer longitudinal study experimental design platelet-free plasma diagnosis before treatment during treatment post-surgery relapse FFPE tumor patient patient Biogazelle. All rights reserved. 20
21 Plasma samples tend to cluster by time point cluster dendogram during treatment before treatment patient 15: relapse 2017 Biogazelle. All rights reserved. 21
22 Plasma samples tend to cluster by time point samples after 1st chemotherapy cycle stand out hemolytic sample 2017 Biogazelle. All rights reserved. 22
23 Changes upon 1 st chemo treatment GSEA : lysome, lipid metabolism, ECM-receptor lysosome glycerophospholipid metabolism alpha-linolenic acid metabolism linoleic acid metabolism ether lipid metabolism ECM-receptor interaction not clear yet what these changes effectively mean intriguing and first time that mrna profiles in plasma provide insights 2017 Biogazelle. All rights reserved. 23
24 RNA seq variant calling pipeline (paired-end) RNA sequencing basecalling, demultiplexing, QC, trimming, adaptor removal raw RNA seq reads (FASTQ) map to reference STAR 2-pass alignment (BAM) remove duplicate reads & sort fusion detection FusionCatcher analysis-ready reads raw variants (VCF) SNVs variant calling reads mpileup VarScan InDels variant filtering (strand bias, base quality, depth, allelic ratio, ) filtered variants SNVs InDels variant annotation functional/genic annotation dbsnp/cosmic/civic RNAediting HGVS/SIFT-PolyPhen report annotated variants (VCF & CSV) SNVs InDels further evaluation, candidate selection, troubleshooting, 2017 Biogazelle. All rights reserved. 24
25 Testing of the RNA seq variant pipeline HCC1143 DNA exome sequencing vs polya+ RNA sequencing variant positions covered > 4 reads good concordance , mono-allelic expression low coverage RNA editing low coverage 2017 Biogazelle. All rights reserved. 25
26 Testing of the RNA seq variant pipeline 16 matched tumor / normal FFPE from diagnostic cases with known mutation 15/16 correctly called myxoid liposarcoma: FUS-DDIT3 fusion rhabdomyosarcoma: FOXO1-PAX3 fusion synovial sarcoma: SS18-SSX2 fusion Ewing sarcoma: ESWR1-FLI1 fusion colon cancer: KRAS SNV (n=2) melanoma: BRAF SNV (n=2) lung cancer: EGFR SNV + EGFR deletion of 15 bp GIST: PDGFRA SNV + KIT deletion of 21 bp 2017 Biogazelle. All rights reserved. 26
27 RNA editing event variant present in colon cancer FFPE RNA and plasma RNA, not in FFPE DNA 2017 Biogazelle. All rights reserved. 27
28 Therapy response monitoring FCGR2A mutation present in FFPE and plasma at diagnosis disappears during treatment and pops up again at time point 4 -> sign of relapse? Biogazelle. All rights reserved. 28
29 Colon cancer longitudinal study platelet-free/poor plasma metastatic setting (anti-vegf, anti-egfr, chemo) diagnosis before treatment 2 weeks after start treatment 1st CT scan 1 month after CT scan 2 months after CT scan patient G patient H patient J 2017 Biogazelle. All rights reserved. 29
30 Colon cancer longitudinal study large fold changes (CT scan vs diagnosis) POLB is the most upregulated gene involved in mismatch repair upregulated upon chemotherapy mutated in colon cancer 2017 Biogazelle. All rights reserved. 30
31 Colon cancer longitudinal study large fold changes (CT scan vs diagnosis) pathway enrichment (CT scan vs 1 st treatment) 2017 Biogazelle. All rights reserved. 31
32 Colon cancer longitudinal study gene set enrichment analysis DNA mismatch repair (anti-)proliferation T-cell stimulation inflammatory response t2 t3 t Biogazelle. All rights reserved. 32
33 Conclusions high level RNA is a fascinating molecule with a lot of biomarker potential liquid biopsies are emerging as holy grail for precision medicine novel application of mrna capture sequencing in body fluids 2017 Biogazelle. All rights reserved. 33
34 Conclusions - details platelet rich > platelet poor > platelet free plasma > serum gene expression: ~10,000 genes reproducibly detected variants: ~5-10,000 detected PCR duplicates require attention in variant calling larger plasma volumes, other extraction kits, adaptor ligation, robust plasma SOP many biological questions remain function circulating RNA, where does it come from, different cargo in different plasma fractions (RNP, EV, platelet) 2017 Biogazelle. All rights reserved. 34
35 Biogazelle. All rights reserved. 35
Exploiting extracellular body fluid RNA for precision medicine purposes
Exploiting extracellular body fluid RNA for precision medicine purposes Jo Vandesompele, Biogazelle CSO Precision LBx Summit San Diego, USA, January 30, 2018 2018 Biogazelle. All rights reserved. 1 Beyond
Deploying the full transcriptome using RNA sequencing. Jo Vandesompele, CSO and co-founder The Non-Coding Genome May 12, 2016, Leuven
Deploying the full transcriptome using RNA sequencing Jo Vandesompele, CSO and co-founder The Non-Coding Genome May 12, 2016, Leuven Roadmap Biogazelle the power of RNA reasons to study non-coding RNA
AVENIO family of NGS oncology assays ctdna and Tumor Tissue Analysis Kits
AVENIO family of NGS oncology assays ctdna and Tumor Tissue Analysis Kits Accelerating clinical research Next-generation sequencing (NGS) has the ability to interrogate many different genes and detect
ACE ImmunoID Biomarker Discovery Solutions ACE ImmunoID Platform for Tumor Immunogenomics
ACE ImmunoID Biomarker Discovery Solutions ACE ImmunoID Platform for Tumor Immunogenomics Precision Genomics for Immuno-Oncology Personalis, Inc. ACE ImmunoID When one biomarker doesn t tell the whole
Whole Genome and Transcriptome Analysis of Anaplastic Meningioma. Patrick Tarpey Cancer Genome Project Wellcome Trust Sanger Institute
Whole Genome and Transcriptome Analysis of Anaplastic Meningioma Patrick Tarpey Cancer Genome Project Wellcome Trust Sanger Institute Outline Anaplastic meningioma compared to other cancers Whole genomes
Analysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers
Analysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers Gordon Blackshields Senior Bioinformatician Source BioScience 1 To Cancer Genetics Studies
Single-strand DNA library preparation improves sequencing of formalin-fixed and paraffin-embedded (FFPE) cancer DNA
www.impactjournals.com/oncotarget/ Oncotarget, Supplementary Materials 2016 Single-strand DNA library preparation improves sequencing of formalin-fixed and paraffin-embedded (FFPE) DNA Supplementary Materials
AVENIO ctdna Analysis Kits The complete NGS liquid biopsy solution EMPOWER YOUR LAB
Analysis Kits The complete NGS liquid biopsy solution EMPOWER YOUR LAB Analysis Kits Next-generation performance in liquid biopsies 2 Accelerating clinical research From liquid biopsy to next-generation
ACE ImmunoID. ACE ImmunoID. Precision immunogenomics. Precision Genomics for Immuno-Oncology
ACE ImmunoID ACE ImmunoID Precision immunogenomics Precision Genomics for Immuno-Oncology Personalis, Inc. A universal biomarker platform for immuno-oncology Patient response to cancer immunotherapies
NGS in tissue and liquid biopsy
NGS in tissue and liquid biopsy Ana Vivancos, PhD Referencias So, why NGS in the clinics? 2000 Sanger Sequencing (1977-) 2016 NGS (2006-) ABIPrism (Applied Biosystems) Up to 2304 per day (96 sequences
NGS in Cancer Pathology After the Microscope: From Nucleic Acid to Interpretation
NGS in Cancer Pathology After the Microscope: From Nucleic Acid to Interpretation Michael R. Rossi, PhD, FACMG Assistant Professor Division of Cancer Biology, Department of Radiation Oncology Department
Frequency(%) KRAS G12 KRAS G13 KRAS A146 KRAS Q61 KRAS K117N PIK3CA H1047 PIK3CA E545 PIK3CA E542K PIK3CA Q546. EGFR exon19 NFS-indel EGFR L858R
Frequency(%) 1 a b ALK FS-indel ALK R1Q HRAS Q61R HRAS G13R IDH R17K IDH R14Q MET exon14 SS-indel KIT D8Y KIT L76P KIT exon11 NFS-indel SMAD4 R361 IDH1 R13 CTNNB1 S37 CTNNB1 S4 AKT1 E17K ERBB D769H ERBB
Current and future applications of Molecular Pathology. Kathy Walsh Clinical Scientist NHS Lothian
Current and future applications of Molecular Pathology Kathy Walsh Clinical Scientist NHS Lothian Molecular Pathology in Solid tumours Cancer type Genes tested Purpose Associated treatments Non small cell
Characterisation of structural variation in breast. cancer genomes using paired-end sequencing on. the Illumina Genome Analyser
Characterisation of structural variation in breast cancer genomes using paired-end sequencing on the Illumina Genome Analyser Phil Stephens Cancer Genome Project Why is it important to study cancer? Why
Breast and ovarian cancer in Serbia: the importance of mutation detection in hereditary predisposition genes using NGS
Breast and ovarian cancer in Serbia: the importance of mutation detection in hereditary predisposition genes using NGS dr sc. Ana Krivokuća Laboratory for molecular genetics Institute for Oncology and
Mutation Detection and CNV Analysis for Illumina Sequencing data from HaloPlex Target Enrichment Panels using NextGENe Software for Clinical Research
Mutation Detection and CNV Analysis for Illumina Sequencing data from HaloPlex Target Enrichment Panels using NextGENe Software for Clinical Research Application Note Authors John McGuigan, Megan Manion,
ncounter TM Analysis System
ncounter TM Analysis System Molecules That Count TM www.nanostring.com Agenda NanoString Technologies History Introduction to the ncounter Analysis System CodeSet Design and Assay Principals System Performance
Cell-free tumor DNA for cancer monitoring
Learning objectives Cell-free tumor DNA for cancer monitoring Christina Lockwood, PhD, DABCC, DABMGG Department of Laboratory Medicine 1. Define circulating, cell-free tumor DNA (ctdna) 2. Understand the
Disclosure. Summary. Circulating DNA and NGS technology 3/27/2017. Disclosure of Relevant Financial Relationships. JS Reis-Filho, MD, PhD, FRCPath
Circulating DNA and NGS technology JS Reis-Filho, MD, PhD, FRCPath Director of Experimental Pathology, Department of Pathology Affiliate Member, Human Oncology and Pathogenesis Program Disclosure of Relevant
BWA alignment to reference transcriptome and genome. Convert transcriptome mappings back to genome space
Whole genome sequencing Whole exome sequencing BWA alignment to reference transcriptome and genome Convert transcriptome mappings back to genome space genomes Filter on MQ, distance, Cigar string Annotate
Genomic explorations have offered us a great deal. Buried Treasure
18 Buried Treasure Noncoding DNA makes up the majority of our genomes, much of it being conserved and transcribed. Though the functions of small regulatory RNA molecules are well known, what about so-called
genomics for systems biology / ISB2020 RNA sequencing (RNA-seq)
RNA sequencing (RNA-seq) Module Outline MO 13-Mar-2017 RNA sequencing: Introduction 1 WE 15-Mar-2017 RNA sequencing: Introduction 2 MO 20-Mar-2017 Paper: PMID 25954002: Human genomics. The human transcriptome
Transform genomic data into real-life results
CLINICAL SUMMARY Transform genomic data into real-life results Biomarker testing and targeted therapies can drive improved outcomes in clinical practice New FDA-Approved Broad Companion Diagnostic for
Simple, rapid, and reliable RNA sequencing
Simple, rapid, and reliable RNA sequencing RNA sequencing applications RNA sequencing provides fundamental insights into how genomes are organized and regulated, giving us valuable information about the
Performance Characteristics BRCA MASTR Plus Dx
Performance Characteristics BRCA MASTR Plus Dx with drmid Dx for Illumina NGS systems Manufacturer Multiplicom N.V. Galileïlaan 18 2845 Niel Belgium Table of Contents 1. Workflow... 4 2. Performance Characteristics
A complete next-generation sequencing workfl ow for circulating cell-free DNA isolation and analysis
APPLICATION NOTE Cell-Free DNA Isolation Kit A complete next-generation sequencing workfl ow for circulating cell-free DNA isolation and analysis Abstract Circulating cell-free DNA (cfdna) has been shown
Exosome DNA Extraction Kits
Exosome DNA Extraction Kits Summary Section 5 Introduction 40 EXO-DNAc 41 EXO-DNA 43 Introduction Genomic DNA Extractiom Kits Ordering informations Products can be purchased directly in our on-line shop:
Fluxion Biosciences and Swift Biosciences Somatic variant detection from liquid biopsy samples using targeted NGS
APPLICATION NOTE Fluxion Biosciences and Swift Biosciences OVERVIEW This application note describes a robust method for detecting somatic mutations from liquid biopsy samples by combining circulating tumor
Research Strategy: 1. Background and Significance
Research Strategy: 1. Background and Significance 1.1. Heterogeneity is a common feature of cancer. A better understanding of this heterogeneity may present therapeutic opportunities: Intratumor heterogeneity
Iso-Seq Method Updates and Target Enrichment Without Amplification for SMRT Sequencing
Iso-Seq Method Updates and Target Enrichment Without Amplification for SMRT Sequencing PacBio Americas User Group Meeting Sample Prep Workshop June.27.2017 Tyson Clark, Ph.D. For Research Use Only. Not
Analysis with SureCall 2.1
Analysis with SureCall 2.1 Danielle Fletcher Field Application Scientist July 2014 1 Stages of NGS Analysis Primary analysis, base calling Control Software FASTQ file reads + quality 2 Stages of NGS Analysis
Advance Your Genomic Research Using Targeted Resequencing with SeqCap EZ Library
Advance Your Genomic Research Using Targeted Resequencing with SeqCap EZ Library Marilou Wijdicks International Product Manager Research For Life Science Research Only. Not for Use in Diagnostic Procedures.
La biopsia liquida. Aldo Scarpa. Anatomia Patologica e ARC-NET Centro di Ricerca Applicata sul Cancro
La biopsia liquida Aldo Scarpa Anatomia Patologica e ARC-NET Centro di Ricerca Applicata sul Cancro Azienda Ospedaliera Universitaria Integrata di Verona Obstacles to precision oncology Genomic heterogeneity
The feasibility of circulating tumour DNA as an alternative to biopsy for mutational characterization in Stage III melanoma patients
The feasibility of circulating tumour DNA as an alternative to biopsy for mutational characterization in Stage III melanoma patients ASSC Scientific Meeting 13 th October 2016 Prof Andrew Barbour UQ SOM
RNA-seq Introduction
RNA-seq Introduction DNA is the same in all cells but which RNAs that is present is different in all cells There is a wide variety of different functional RNAs Which RNAs (and sometimes then translated
DNA-seq Bioinformatics Analysis: Copy Number Variation
DNA-seq Bioinformatics Analysis: Copy Number Variation Elodie Girard elodie.girard@curie.fr U900 institut Curie, INSERM, Mines ParisTech, PSL Research University Paris, France NGS Applications 5C HiC DNA-seq
Detection of low-frequent mitochondrial DNA variants using SMRT sequencing
Detection of low-frequent mitochondrial DNA variants using SMRT sequencing Marjolein J.A. Weerts SMRT Leiden 2018 June 13 Content Mitochondrial DNA & liquid biopsy in oncology Pitfalls when studying human
Supplementary Figures
Supplementary Figures Supplementary Figure 1. Heatmap of GO terms for differentially expressed genes. The terms were hierarchically clustered using the GO term enrichment beta. Darker red, higher positive
USE OF EXOSOMES IN TRANSLATIONAL AND CLINICAL RESEARCH. Eva Colás Ortega Postdoc researcher IRBLleida
USE OF EXOSOMES IN TRANSLATIONAL AND CLINICAL RESEARCH Eva Colás Ortega Postdoc researcher IRBLleida ecolas@irblleida.cat THERE ARE DIFFERENT TYPE OF VESICLES RELEASED BY CELLS MICROVESICLES Size: 100-1000nm
Cancer Gene Panels. Dr. Andreas Scherer. Dr. Andreas Scherer President and CEO Golden Helix, Inc. Twitter: andreasscherer
Cancer Gene Panels Dr. Andreas Scherer Dr. Andreas Scherer President and CEO Golden Helix, Inc. scherer@goldenhelix.com Twitter: andreasscherer About Golden Helix - Founded in 1998 - Main outside investor:
Investigating rare diseases with Agilent NGS solutions
Investigating rare diseases with Agilent NGS solutions Chitra Kotwaliwale, Ph.D. 1 Rare diseases affect 350 million people worldwide 7,000 rare diseases 80% are genetic 60 million affected in the US, Europe
QIAGEN Complete Solutions for Liquid Biopsy Molecular Testing
QIAGEN Complete Solutions for Liquid Biopsy Molecular Testing Christopher Swagell, PhD Market Development Manager, Advanced Molecular Pathology QIAGEN 1 Agenda QIAGEN Solid Tumor Testing and Liquid Biopsy
Accel-Amplicon Panels
Accel-Amplicon Panels Amplicon sequencing has emerged as a reliable, cost-effective method for ultra-deep targeted sequencing. This highly adaptable approach is especially applicable for in-depth interrogation
NGS ONCOPANELS: FDA S PERSPECTIVE
NGS ONCOPANELS: FDA S PERSPECTIVE CBA Workshop: Biomarker and Application in Drug Development August 11, 2018 Rockville, MD You Li, Ph.D. Division of Molecular Genetics and Pathology Food and Drug Administration
Small RNAs and how to analyze them using sequencing
Small RNAs and how to analyze them using sequencing RNA-seq Course November 8th 2017 Marc Friedländer ComputaAonal RNA Biology Group SciLifeLab / Stockholm University Special thanks to Jakub Westholm for
Golden Helix s End-to-End Solution for Clinical Labs
Golden Helix s End-to-End Solution for Clinical Labs Steven Hystad - Field Application Scientist Nathan Fortier Senior Software Engineer 20 most promising Biotech Technology Providers Top 10 Analytics
RNA SEQUENCING AND DATA ANALYSIS
RNA SEQUENCING AND DATA ANALYSIS Length of mrna transcripts in the human genome 5,000 5,000 4,000 3,000 2,000 4,000 1,000 0 0 200 400 600 800 3,000 2,000 1,000 0 0 2,000 4,000 6,000 8,000 10,000 Length
AD (Leave blank) TITLE: Genomic Characterization of Brain Metastasis in Non-Small Cell Lung Cancer Patients
AD (Leave blank) Award Number: W81XWH-12-1-0444 TITLE: Genomic Characterization of Brain Metastasis in Non-Small Cell Lung Cancer Patients PRINCIPAL INVESTIGATOR: Mark A. Watson, MD PhD CONTRACTING ORGANIZATION:
NGS IN ONCOLOGY: FDA S PERSPECTIVE
NGS IN ONCOLOGY: FDA S PERSPECTIVE ASQ Biomed/Biotech SIG Event April 26, 2018 Gaithersburg, MD You Li, Ph.D. Division of Molecular Genetics and Pathology Food and Drug Administration (FDA) Center for
SU2C TOP SCIENCE ACCOMPLISHMENTS
SU2C TOP SCIENCE ACCOMPLISHMENTS INTRODUCTION Since our founding in 2008, Stand Up To Cancer has funded 87 team science projects, with budgets ranging from $250,000 for a short research project to over
EXO-DNAc Circulating and EV-associated DNA extraction kit
Datasheet EXO-DNAc Circulating and EV-associated DNA extraction kit This product is for research use only. It is highly recommended to read this users guide in its entirety prior to using this product.
CRISPR/Cas9 Enrichment and Long-read WGS for Structural Variant Discovery
CRISPR/Cas9 Enrichment and Long-read WGS for Structural Variant Discovery PacBio CoLab Session October 20, 2017 For Research Use Only. Not for use in diagnostics procedures. Copyright 2017 by Pacific Biosciences
Molecular Genetics of Paediatric Tumours. Gino Somers MBBS, BMedSci, PhD, FRCPA Pathologist-in-Chief Hospital for Sick Children, Toronto, ON, CANADA
Molecular Genetics of Paediatric Tumours Gino Somers MBBS, BMedSci, PhD, FRCPA Pathologist-in-Chief Hospital for Sick Children, Toronto, ON, CANADA Financial Disclosure NanoString - conference costs for
EXAMPLE. - Potentially responsive to PI3K/mTOR and MEK combination therapy or mtor/mek and PKC combination therapy. ratio (%)
Dr Kate Goodhealth Goodhealth Medical Clinic 123 Address Road SUBURBTOWN NSW 2000 Melanie Citizen Referring Doctor Your ref Address Dr John Medico 123 Main Street, SUBURBTOWN NSW 2000 Phone 02 9999 9999
Supplementary Tables. Supplementary Figures
Supplementary Files for Zehir, Benayed et al. Mutational Landscape of Metastatic Cancer Revealed from Prospective Clinical Sequencing of 10,000 Patients Supplementary Tables Supplementary Table 1: Sample
RNA-Seq Preparation Comparision Summary: Lexogen, Standard, NEB
RNA-Seq Preparation Comparision Summary: Lexogen, Standard, NEB CSF-NGS January 22, 214 Contents 1 Introduction 1 2 Experimental Details 1 3 Results And Discussion 1 3.1 ERCC spike ins............................................
Liquid biopsy in lung cancer: The EGFR paradigm
Liquid biopsy in lung cancer: The EGFR paradigm Lynette M. Sholl, M.D. Brigham and Women s Hospital Dana Farber Cancer Institute Department of Pathology Boston, MA Disclosure of Relevant Financial Relationships
Selective depletion of abundant RNAs to enable transcriptome analysis of lowinput and highly-degraded RNA from FFPE breast cancer samples
DNA CLONING DNA AMPLIFICATION & PCR EPIGENETICS RNA ANALYSIS Selective depletion of abundant RNAs to enable transcriptome analysis of lowinput and highly-degraded RNA from FFPE breast cancer samples LIBRARY
Enterprise Interest Thermo Fisher Scientific / Employee
Enterprise Interest Thermo Fisher Scientific / Employee A next-generation sequencing assay to estimate tumor mutation load from FFPE research samples Fiona Hyland. Director of R&D, Bioinformatics Clinical
Obstacles and challenges in the analysis of microrna sequencing data
Obstacles and challenges in the analysis of microrna sequencing data (mirna-seq) David Humphreys Genomics core Dr Victor Chang AC 1936-1991, Pioneering Cardiothoracic Surgeon and Humanitarian The ABCs
Supplementary Figure 1. Schematic diagram of o2n-seq. Double-stranded DNA was sheared, end-repaired, and underwent A-tailing by standard protocols.
Supplementary Figure 1. Schematic diagram of o2n-seq. Double-stranded DNA was sheared, end-repaired, and underwent A-tailing by standard protocols. A-tailed DNA was ligated to T-tailed dutp adapters, circularized
Next generation diagnostics Bringing high-throughput sequencing into clinical application
Next generation diagnostics Bringing high-throughput sequencing into clinical application Leonardo A. Meza-Zepeda, PhD Translational Genomics Group Institute for Cancer Research Leonardo.Meza-Zepeda@rr-research.no
Abstract. Optimization strategy of Copy Number Variant calling using Multiplicom solutions APPLICATION NOTE. Introduction
Optimization strategy of Copy Number Variant calling using Multiplicom solutions Michael Vyverman, PhD; Laura Standaert, PhD and Wouter Bossuyt, PhD Abstract Copy number variations (CNVs) represent a significant
EPIGENOMICS PROFILING SERVICES
EPIGENOMICS PROFILING SERVICES Chromatin analysis DNA methylation analysis RNA-seq analysis Diagenode helps you uncover the mysteries of epigenetics PAGE 3 Integrative epigenomics analysis DNA methylation
Variant Classification. Author: Mike Thiesen, Golden Helix, Inc.
Variant Classification Author: Mike Thiesen, Golden Helix, Inc. Overview Sequencing pipelines are able to identify rare variants not found in catalogs such as dbsnp. As a result, variants in these datasets
Eukaryotic small RNA Small RNAseq data analysis for mirna identification
Eukaryotic small RNA Small RNAseq data analysis for mirna identification P. Bardou, C. Gaspin, S. Maman, J. Mariette, O. Rué, M. Zytnicki INRA Sigenae Toulouse INRA MIA Toulouse GenoToul Bioinfo INRA MaIAGE
An ultrasensitive method for quantitating circulating tumor DNA with broad patient coverage
An ultrasensitive method for quantitating circulating tumor DNA with broad patient coverage Aaron M Newman1,2,7, Scott V Bratman1,3,7, Jacqueline To3, Jacob F Wynne3, Neville C W Eclov3, Leslie A Modlin3,
Computer Science, Biology, and Biomedical Informatics (CoSBBI) Outline. Molecular Biology of Cancer AND. Goals/Expectations. David Boone 7/1/2015
Goals/Expectations Computer Science, Biology, and Biomedical (CoSBBI) We want to excite you about the world of computer science, biology, and biomedical informatics. Experience what it is like to be a
Supplementary Figure 1. Estimation of tumour content
Supplementary Figure 1. Estimation of tumour content a, Approach used to estimate the tumour content in S13T1/T2, S6T1/T2, S3T1/T2 and S12T1/T2. Tissue and tumour areas were evaluated by two independent
Liquid biopsy: the experience of real life case studies
Liquid biopsy: the experience of real life case studies 10 th September 2018 Beatriz Bellosillo Servicio de Anatomía Patológica Hospital del Mar, Barcelona Agenda Introduction Experience in colorectal
Profiles of gene expression & diagnosis/prognosis of cancer. MCs in Advanced Genetics Ainoa Planas Riverola
Profiles of gene expression & diagnosis/prognosis of cancer MCs in Advanced Genetics Ainoa Planas Riverola Gene expression profiles Gene expression profiling Used in molecular biology, it measures the
OverView Circulating Nucleic Acids (CFNA) in Cancer Patients. Dave S.B. Hoon John Wayne Cancer Institute Santa Monica, CA, USA
OverView Circulating Nucleic Acids (CFNA) in Cancer Patients Dave S.B. Hoon John Wayne Cancer Institute Santa Monica, CA, USA cfna Blood Assays Cell-free nucleic acids as biomarkers in cancer patients.
Multiplex target enrichment using DNA indexing for ultra-high throughput variant detection
Multiplex target enrichment using DNA indexing for ultra-high throughput variant detection Dr Elaine Kenny Neuropsychiatric Genetics Research Group Institute of Molecular Medicine Trinity College Dublin
Proteogenomic analysis of alternative splicing: the search for novel biomarkers for colorectal cancer Gosia Komor
Proteogenomic analysis of alternative splicing: the search for novel biomarkers for colorectal cancer Gosia Komor Translational Gastrointestinal Oncology Collect clinical samples (Tumor) tissue Blood Stool
Next Generation Sequencing in Clinical Practice: Impact on Therapeutic Decision Making
Next Generation Sequencing in Clinical Practice: Impact on Therapeutic Decision Making November 20, 2014 Capturing Value in Next Generation Sequencing Symposium Douglas Johnson MD, MSCI Vanderbilt-Ingram
From reference genes to global mean normalization
From reference genes to global mean normalization Jo Vandesompele professor, Ghent University co-founder and CEO, Biogazelle qpcr Symposium USA November 9, 2009 Millbrae, CA outline what is normalization
Introduction. Introduction
Introduction We are leveraging genome sequencing data from The Cancer Genome Atlas (TCGA) to more accurately define mutated and stable genes and dysregulated metabolic pathways in solid tumors. These efforts
Liquid Biopsy Applications on the Idylla Fully Integrated Sample-to-Result MDx System
Liquid Biopsy Applications on the Idylla Fully Integrated Sample-to-Result MDx System Erwin Sablon, Head of R&D, Biocartis NV World CDx, Boston, September 10 th 2015 0 About Biocartis Innovative molecular
Supplemental Data. Integrating omics and alternative splicing i reveals insights i into grape response to high temperature
Supplemental Data Integrating omics and alternative splicing i reveals insights i into grape response to high temperature Jianfu Jiang 1, Xinna Liu 1, Guotian Liu, Chonghuih Liu*, Shaohuah Li*, and Lijun
ECMC cfdna consensus meeting
ECMC cfdna consensus meeting State of the art for cfdna technologies 24 th November 2014 Applications of ctdna analysis for drug development Potential of ctdna analysis to: Identify the right patients
Circular RNAs (circrnas) act a stable mirna sponges
Circular RNAs (circrnas) act a stable mirna sponges cernas compete for mirnas Ancestal mrna (+3 UTR) Pseudogene RNA (+3 UTR homolgy region) The model holds true for all RNAs that share a mirna binding
New Drug development and Personalized Therapy in The Era of Molecular Medicine
New Drug development and Personalized Therapy in The Era of Molecular Medicine Ramesh K. Ramanathan MD Virginia G. Piper Cancer Center Translational Genomics Research Institute Scottsdale, AZ Clinical
Genomic Medicine: What every pathologist needs to know
Genomic Medicine: What every pathologist needs to know Stephen P. Ethier, Ph.D. Professor, Department of Pathology and Laboratory Medicine, MUSC Director, MUSC Center for Genomic Medicine Genomics and
Qué hemos aprendido hasta hoy? What have we learned so far?
Qué hemos aprendido hasta hoy? What have we learned so far? Luís Costa Hospital de Santa Maria & Instituto de Medicina Molecular Faculdade de Medicina de Lisboa Disclosures Research Grants: Amgen; Novartis;
Welcome. Nanostring Immuno-Oncology Summit. September 21st, FOR RESEARCH USE ONLY. Not for use in diagnostic procedures.
Welcome Nanostring Immuno-Oncology Summit September 21st, 2017 1 FOR RESEARCH USE ONLY. Not for use in diagnostic procedures. FOR RESEARCH USE ONLY. Not for use in diagnostic procedures. Agenda 4:00-4:30
Oncology Biomarker Panel
Oncology Biomarker Panel HTG EdgeSeq Oncology Biomarker Panel The HTG EdgeSeq Oncology Biomarker Panel profiles tumor samples in order to identify therapeutic targets and drug response markers using an
DNA Methylation of Tumor Suppressor and Metastasis Suppressor Genes in Circulating Tumor Cells and corresponding Circulating Tumor DNA
DNA Methylation of Tumor Suppressor and Metastasis Suppressor Genes in Circulating Tumor Cells and corresponding Circulating Tumor DNA Maria Chimonidou 1, Areti Strati 1, Nikos Malamos 2, Vasilis Georgoulias
A novel and universal method for microrna RT-qPCR data normalization
A novel and universal method for microrna RT-qPCR data normalization Jo Vandesompele professor, Ghent University co-founder and CEO, Biogazelle 4 th International qpcr Symposium Weihenstephan, March 1,
Robert Beer
Robert Beer Robert.beer@wales.nhs.uk All Wales Medical Genetics Service Genetic Technologist Training Day 22 nd November 2017 Contents Stratified Medicine NHS EGFR Diagnostic Testing Services Cell free
BIMM 143. RNA sequencing overview. Genome Informatics II. Barry Grant. Lecture In vivo. In vitro.
RNA sequencing overview BIMM 143 Genome Informatics II Lecture 14 Barry Grant http://thegrantlab.org/bimm143 In vivo In vitro In silico ( control) Goal: RNA quantification, transcript discovery, variant
Nature Getetics: doi: /ng.3471
Supplementary Figure 1 Summary of exome sequencing data. ( a ) Exome tumor normal sample sizes for bladder cancer (BLCA), breast cancer (BRCA), carcinoid (CARC), chronic lymphocytic leukemia (CLLX), colorectal
Introduction of an NGS gene panel into the Haemato-Oncology MPN service
Introduction of an NGS gene panel into the Haemato-Oncology MPN service Dr. Anna Skowronska, Dr Jane Bryon, Dr Samuel Clokie, Dr Yvonne Wallis and Professor Mike Griffiths West Midlands Regional Genetics
RNA SEQUENCING AND DATA ANALYSIS
RNA SEQUENCING AND DATA ANALYSIS Download slides and package http://odin.mdacc.tmc.edu/~rverhaak/package.zip http://odin.mdacc.tmc.edu/~rverhaak/rna-seqlecture.zip Overview Introduction into the topic
Transcriptome Analysis
Transcriptome Analysis Data Preprocessing Sample Preparation Illumina Sequencing Demultiplexing Raw FastQ Reference Genome (fasta) Reference Annotation (GTF) Reference Genome Analysis Tophat Accepted hits
Clinical Grade Genomic Profiling: The Time Has Come
Clinical Grade Genomic Profiling: The Time Has Come Gary Palmer, MD, JD, MBA, MPH Senior Vice President, Medical Affairs Foundation Medicine, Inc. Oct. 22, 2013 1 Why We Are Here A Shared Vision At Foundation
See how you can guide the path her cancer takes
See how you can guide the path her cancer takes The need for improved diagnostics At the advanced edge of oncology, rapid access to accurate data on disease state is vital. Current technologies such as
Circulating Tumor DNA in GIST and its Implications on Treatment
Circulating Tumor DNA in GIST and its Implications on Treatment October 2 nd 2017 Dr. Ciara Kelly Assistant Attending Physician Sarcoma Medical Oncology Service Objectives Background Liquid biopsy & ctdna
Cellecta Overview. Started Operations in 2007 Headquarters: Mountain View, CA
Cellecta Overview Started Operations in 2007 Headquarters: Mountain View, CA Focus: Development of flexible, scalable, and broadly parallel genetic screening assays to expedite the discovery and characterization
Dr Rick Tearle Senior Applications Specialist, EMEA Complete Genomics Complete Genomics, Inc.
Dr Rick Tearle Senior Applications Specialist, EMEA Complete Genomics Topics Overview of Data Processing Pipeline Overview of Data Files 2 DNA Nano-Ball (DNB) Read Structure Genome : acgtacatgcattcacacatgcttagctatctctcgccag
Clasificación Molecular del Cáncer de Próstata. JM Piulats
Clasificación Molecular del Cáncer de Próstata JM Piulats Introduction The Gleason score is the major method for prostate cancer tissue grading and the most important prognostic factor in this disease.