Conv. R GF Col. GF. Sham Ovx. E. coli. Veh. E. coli. E. coli. Veh. E. coli
|
|
- Maude Berenice Cox
- 5 years ago
- Views:
Transcription
1 B A Uterus weight (mg) 5 5 Body Weight (g) - - Uterus Weight (mg) - - Supplemental Figure. Effects of prolide and treatment with probiotics on uterus weight and body weight. Data are expressed as ean + SE. All data were normally distributed according to the Shapiro-Wilk normality test and analyzed by two-way analysis-of-variance and post hoc tests applying the Bonferroni correction for multiple compariso A. Effects of prolide on the uterus weight in onv. R, GF and ol. ice. n = mice per group. = p<. compared to the corresponding vehicle group. B. Effects of probiotic supplementation on body weight in sham operated and ovx mice. n=- mice per group. = p<. compared to sham vehicle group.. Effects of probiotic supplementation on uterus weight in sham operated and ovx mice. n=- mice per group = p<. compared to sham vehicle group. In panels B and conventional ovariectomized (ovx) and sham operated mice were supplemented twice a week with x 9 cfu of either T, Lactobacillus rhamnosus GG (), an pili mutant (Δ Spa) referred to as -,, or vehicle.
2 A 5 B 5 B IFNγ (pg/ml) B IL- (pg/ml) SI cells IFNγ mrna Ve h D SI cells IL- mrna Supplemental Figure. Effects of prolide treatment on the generation of osteoclastogenic cytokines by B T cells. A-B. Levels of IFNγ and IL- in the bone marrow (B) of conventionally raised (onv.r), of germ-free (GF), and of colonized GF (ol.gf) mice following either prolide (75 µg/month) or vehicle control treatment for weeks. -D. RT-qPR analysis measuring tracript levels of IFNγ and IL- in the small intestine of mice in experimental groups described in A-B. n = mice per group. Data were normally distributed according to the Shapiro-Wilk normality test and analyzed by two-way analysis-of-variance and post hoc tests applying the Bonferroni correction for multiple compariso. = p <.5, and = p<., compared to the indicated group.
3 B T cells TNF mrna B T cells RANKL mrna B T cells IL-7 mrna Supplemental Figure. Effects of prolide treatment on the generation of osteoclastogenic cytokines by B T cells. RT-qPR analysis measuring tracript levels of TNF, RANKL and IL-7 in purified B T cells. Data are expressed as ean + SE. n = mice per group. Data were normally distributed according to the Shapiro-Wilk normality test and analyzed by two-way analysis-of-variance and post hoc tests applying the Bonferroni correction for multiple compariso. = p <.5, = p<., = p<. and = compared to the indicated group.
4 A D Spine-Tb.Th (µm) a oli oli E 5 5 Femur-Tb.Th (µm) B Spine-Tb.N (/mm) a a a oli oli F Femur-Tb.Sp (µm) Femur Tb.N (/mm) Spine-Tb.Sp (µm) oli oli G Femur t.th (µm) Supplemental Figure. Supplementation of the indigenous microbiota with probiotics prevents the alteratio of bone structure induced by sex-steroid deficiency. onventional ovariectomized (ovx) and sham operated mice were supplemented twice a week with x 9 cfu of either T, Lactobacillus rhamnosus GG (), an pili mutant (Δ Spa) referred to as -,, or vehicle. Data are expressed as ean + SE. All data were normally distributed according to the Shapiro-Wilk normality test and analyzed by ANOVA for repeated measures and post hoc tests applying the Bonferroni correction for multiple compariso. n = to mice per group. A-. In vivo prospective analysis of spinal trabecular thickness (Tb.Th), trabecular space (Tb.Sp), and trabecular number (Tb.N) by µt scanning at baseline and and. a = p <.5, = p<. a= p<. and = p<. compared to baseline. = p <.5, = p<. = p<. and = p<. compared to sham vehicle, = p <.5, = p<. = p<. and = p<. compared to ovx vehicle. D-G. In vitro analysis of femoral indices of trabecular structure (Tb.Th, Tb.N, and Tb.Sp) and cortical structure (t.th) by µt scanning.. = p <.5, = p<., = p<. and = p<. compared to sham vehicle, = p <.5,= p<., = p<. and = p<. compared to ovx vehicle.
5 B T cells TNF mrna - - B T cells RANKL mrna - - B T cells IL-7 mrna - - Supplemental Figure 5. Supplementation of the indigenous microbiota with probiotics modulates the generation of osteoclastogenic cytokines by B T cells following sex-steroid depletion. RT-qPR analysis measuring tracript levels of TNF, RANKL and IL-7 in purified B T cells. n = mice per group in all panels. Data are expressed as ean + SE. All data were normally distributed according to the Shapiro-Wilk normality test and analyzed by two-way analysis-of-variance and post hoc tests applying the Bonferroni correction for multiple compariso. = p<. compared to sham vehicle, = p<. compared to ovx vehicle.
Supplemental Information. The Microbial Metabolite Butyrate Stimulates. Bone Formation via T Regulatory Cell-Mediated. Regulation of WNT10B Expression
Immunity, Volume 9 Supplemental Information The Microbial Metabolite yrate Stimulates Bone Formation via T Regulatory Cell-Mediated Regulation of WNT1B Expression Abdul Malik Tyagi, Mingcan Yu, Trevor
More informationMouse Glu-OC (undercarboxylated osteocalcin) and Gla-OC (carboxylated osteocalcin) levels were
Supplemental Data Supplemental Materials and Methods Plasma measurements Mouse Glu-OC (undercarboxylated osteocalcin) and Gla-OC (carboxylated osteocalcin) levels were determined using ELISA kits according
More informationSupplementary Figure 1
Supplementary Figure 1 Supplementary Figure 1 Schematic depiction of the tandem Fc GDF15. Supplementary Figure 2 Supplementary Figure 2 Gfral mrna levels in the brains of both wild-type and knockout Gfral
More informationQuantitative PPARγ expression affects the balance between tolerance and immunity
Quantitative PPARγ expression affects the balance between tolerance and immunity Ya-Hui Liu 1, Yau-Sheng Tsai 1,2,3, Shih-Chieh Lin 4, Nan-Shih Liao 5, Ming-Shiou Jan 6, Chung-Tiang Liang 7, Shih-Wen Hsu
More informationNature Immunology: doi: /ni Supplementary Figure 1
Supplementary Figure 1 NLRP12 is downregulated in biopsy samples from patients with active ulcerative colitis (UC). (a-g) NLRP12 expression in 7 UC mrna profiling studies deposited in NCBI GEO database.
More informationSupplementary fig. 1. Crystals induce necroptosis does not involve caspases, TNF receptor or NLRP3. A. Mouse tubular epithelial cells were pretreated
Supplementary fig. 1. Crystals induce necroptosis does not involve caspases, TNF receptor or NLRP3. A. Mouse tubular epithelial cells were pretreated with zvad-fmk (10µM) and exposed to calcium oxalate
More informationFig. S1 A. week 4 week 6
Fig. S1 Trabecular Number Trabecular Thickness number/mm 3.5 3. 2.5 2. 1.5 1..5 mm.45.4.35.3.25.2.15.1.5 SKG-c SKG-A mm 1.4 1.2 1..8.6.4.2 Trabecular Spacing D. week 4 week 6 Figure S1. MicroCT analysis
More informationSupplementary Figure 1. Characterization of basophils after reconstitution of SCID mice
Supplementary figure legends Supplementary Figure 1. Characterization of after reconstitution of SCID mice with CD4 + CD62L + T cells. (A-C) SCID mice (n = 6 / group) were reconstituted with 2 x 1 6 CD4
More informationSupplementary Figure 1. Deletion of Smad3 prevents B16F10 melanoma invasion and metastasis in a mouse s.c. tumor model.
A B16F1 s.c. Lung LN Distant lymph nodes Colon B B16F1 s.c. Supplementary Figure 1. Deletion of Smad3 prevents B16F1 melanoma invasion and metastasis in a mouse s.c. tumor model. Highly invasive growth
More informationSupplementary Table 2. Plasma lipid profiles in wild type and mutant female mice submitted to a HFD for 12 weeks wt ERα -/- AF-1 0 AF-2 0
Supplementary Table 1. List of specific primers used for gene expression analysis. Genes Primer forward Primer reverse Hprt GCAGTACAGCCCCAAAATGG AACAAAGTCTGGCCTGTATCCA Srebp-1c GGAAGCTGTCGGGGTAGCGTC CATGTCTTCAAATGTGCAATCCAT
More informationOriginal Article Establishing a rapid animal model of osteoporosis with ovariectomy plus low calcium diet in rats
Int J Clin Exp Pathol 2014;7(8):5123-5128 www.ijcep.com /ISSN:1936-2625/IJCEP0001041 Original Article Establishing a rapid animal model of osteoporosis with ovariectomy plus low calcium diet in rats Xiang
More informationFat and HIV persistence, role of fat metabolism and inflammation
NIDDK Workshop Obesity and Fat Metabolism in HIV infected individuals Rockville, MD May 22-23, 2018 Centro de Investigación Biomédica En Red Fisiopatología de la Obesidad y Nutrición Fat and HIV persistence,
More information1. Supplementary Prevention Experiment Additional Results
1. Supplementary 1. 1. Prevention Experiment Additional Results Figure 1 presents the NMR measurements of tibiae and femurs bones, which were measured 6 weeks post operation at the central zone of bone
More informationAndrea Bonetto, PhD. Bone and Muscle Crosstalk: mechanical and biochemical interactions (2)
Andrea Bonetto, PhD Bone and Muscle Crosstalk: mechanical and biochemical interactions (2) March 29, 218 Osteokines vs. Myokines Muscle wasting Osteokines Activin A TGF-β IGF-1 BMP-2 Myokines IL-6 IGF-1
More informationAQUAMIN. Marine Minerals for Health The Importance of Bioavailability.
AQUAMIN Marine Minerals for Health. www.aquamin.org What is Aquamin Aquamin is a natural, marine-derived, multi- mineral, from the Lithothamnion species of red algae, rich in calcium and magnesium as well
More informationBryan D. Johnston, BSc
The effect of 17- estradiol therapy on bone mineral density and structure of alveolar bone in the ovariectomized rat model of postmenopausal osteoporosis Bryan D. Johnston, BSc Submitted in partial fulfillment
More informationSupplemental Figure 1. Western blot analysis indicated that MIF was detected in the fractions of
Supplemental Figure Legends Supplemental Figure 1. Western blot analysis indicated that was detected in the fractions of plasma membrane and cytosol but not in nuclear fraction isolated from Pkd1 null
More informationSUPPLEMENTARY INFORMATION
1. Supplementary Figures and Legends Supplementary Fig. 1. S1P-mediated transcriptional regulation of integrins expressed in OP/monocytoid cells. Real-time quantitative PCR analyses of mrna for two integrins,
More informationSupplemental Table 1. Primers used for RT-PCR analysis of inflammatory cytokines Gene Primer Sequence
Supplemental Table 1. Primers used for RT-PCR analysis of inflammatory cytokines Gene Primer Sequence IL-1α Forward primer 5 -CAAGATGGCCAAAGTTCGTGAC-3' Reverse primer 5 -GTCTCATGAAGTGAGCCATAGC-3 IL-1β
More informationDHEA administration has limited effect onintestinal Ca absorption in ovariectomized rats
J. Exerc. Nutr. Biochem. 2014;18(4):333-337 ISSN : 2233-6834 (Print) ISSN : 2233-6842 (Online) http://dx.doi.org/10.5717/jenb.2014.18.4.333 ORIGINAL PAPER DHEA administration has limited effect onintestinal
More informationMicrostructural changes in the bone tissue and in the bone callus of diabetic rats with and without insulin treatment
Microstructural changes in the bone tissue and in the bone callus of diabetic rats with and without insulin treatment A. Zamarioli 1, M.S. Campos 1, A. Guimarães 1, M. Butezloff 1, G.B. Leoni 2, M.D. Sousa-Neto
More informationTEAM SCIENCE AT A PROGRAMMATIC LEVEL. Sundeep Khosla, M.D. Mayo Clinic College of Medicine
TEAM SCIENCE AT A PROGRAMMATIC LEVEL Sundeep Khosla, M.D. Mayo Clinic College of Medicine APPROACH TO TRANSLATIONAL RESEARCH IN OSTEOPOROSIS Epidemiological Studies Clinical Investigation Mouse and Cellular
More informationPreclinical evaluation of pain in endometriosis
receptor antagonism reduces peripheral and central hyperalgesia in a preclinical mouse model of endometriosis Erin Greaves, Andrew W Horne, Helen Jerina, arta ikolajczak, Lisa Hilferty, Rory itchell, Sue
More informationOsteoporosis in Men Professor Peter R Ebeling
Osteoporosis in Men MD FRACP Head, Department of Medicine, School for Clinical Sciences Monash Health Translation Precinct Monash University, Clayton, Victoria 1 MonashHealth Potential Conflicts Departmental
More informationHierarchical Microimaging of Bone Structure and Function
Hierarchical Microimaging of Bone Structure and Function Prof. Ralph Müller, PhD Institute for Biomechanics, ETH Zürich, Zürich, Switzerland 1 Motivation and aims Engineering endpoints have become an important
More informationTITLE: Effect of a High Bone Turnover State Induced by Estrogen Deficiency on the Development and Progression of Breast Cancer Bone Metastases
AD AWARD NUMBER: W81XWH-5-1-311 TITLE: Effect of a High Bone Turnover State Induced by Estrogen Deficiency on the Development and Progression of Breast Cancer Bone Metastases PRINCIPAL INVESTIGATOR: Wende
More informationNature Medicine: doi: /nm.4324
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 Supplementary Figure 1. Kinetics of SnCs development in surgically-induced OA and effect of GCV-induced SnC clearance on OA disease progression
More informationOsteoporosis update. Dr. Claire Vandevelde Consultant Rheumatologist, LTHT
Osteoporosis update Dr. Claire Vandevelde Consultant Rheumatologist, LTHT Outline Background BMD Tools for assessing fracture risk Case study Denosumab Treatment breaks BMD BMD predicts fracture risk but
More informationSpleen. mlns. E Spleen 4.1. mlns. Spleen. mlns. Mock 17. Mock CD8 HIV-1 CD38 HLA-DR. Ki67. Spleen. Spleen. mlns. Cheng et al. Fig.
C D E F Mock 17 Mock 4.1 CD38 57 CD8 23.7 HLA-DR Ki67 G H I Cheng et al. Fig.S1 Supplementary Figure 1. persistent infection leads to human T cell depletion and hyper-immune activation. Humanized mice
More informationDisruption of PTH Receptor 1 in T Cells Protects against PTH-Induced Bone Loss
Disruption of PTH Receptor 1 in T Cells Protects against PTH-Induced Bone Loss Hesham Tawfeek 1, Brahmchetna Bedi 1, Jau-Yi Li 1, Jonathan Adams 1, Tatsuya Kobayashi 3, M. Neale Weitzmann 1,4, Henry M.
More informationSiglec-15 Is A Potential Therapeutic Target For Postmenopausal Osteoporosis
Siglec-15 Is A Potential Therapeutic Target For Postmenopausal Osteoporosis Yusuke Kameda, Masahiko Takahata, Tomohiro Shimizu, Hiroki Hamano, Norimasa Iwasaki. Department of Orthopedic Surgery, Hokkaido
More informationwell for 2 h at rt. Each dot represents an individual mouse and bar is the mean ±
Supplementary data: Control DC Blimp-1 ko DC 8 6 4 2-2 IL-1β p=.5 medium 8 6 4 2 IL-2 Medium p=.16 8 6 4 2 IL-6 medium p=.3 5 4 3 2 1-1 medium IL-1 n.s. 25 2 15 1 5 IL-12(p7) p=.15 5 IFNγ p=.65 4 3 2 1
More informationNIH Public Access Author Manuscript Nat Med. Author manuscript; available in PMC 2006 April 5.
NIH Public Access Author Manuscript Published in final edited form as: Nat Med. 2005 July ; 11(7): 774 779. Regulation of bone mass, bone loss and osteoclast activity by cannabinoid receptors Aymen I Idris,
More informationThe host bone mass is critical to oral implantation
RESEARCH LETTER Relative Skeletal Effects in Different Sites of the Mandible With the Proximal Tibia During Ovariectomy and the Subsequent Estrogen Treatment Hao Liu, MS 1 Kai Gao, MS 2 Hong Lin, PhD 3
More informationHuman intestinal microbiology and probiotics
Human intestinal microbiology and probiotics Michiel Kleerebezem Wageningen Centre for Food Sciences Wageningen University NIZO food research P.O. Box 20 6710 BA Ede The Netherlands phone: +31-(0)318-659629
More informationAge-dependent variations of cancellous bone in response to ovariectomy in C57BL/6J mice
EXPERIMENTAL AND THERAPEUTIC MEDICINE 15: 3623-3632, 2018 Age-dependent variations of cancellous bone in response to ovariectomy in C57BL/6J mice SHENG ZHOU 1*, GUANGHU WANG 1*, LIANG QIAO 1, QITING GE
More informationThe Regulation of Bone Formation by the Met-5-enkephalin-Opioid Growth Factor Receptor Signaling Axis
The Regulation of Bone Formation by the Met-5-enkephalin-Opioid Growth Factor Receptor Signaling Axis Nikhil Thakur, MD, Sean D. DeBoyace, BS, Bryan S. Margulies, PhD. SUNY Upstate Medical University,
More informationHealth benefits of probiotics via serum cholesterol reduction and immune modulation
Health benefits of probiotics via serum cholesterol reduction and immune modulation Division of Food Bioscience and Technology Korea University Sae-Hun Kim Probiotics? Live microorganisms Adequate amounts
More informationBeyond BMD: Bone Quality and Bone Strength
Beyond BMD: Bone Quality and Bone Strength Mary L. Bouxsein, PhD Center for Advanced Orthopedic Studies Department of Orthopedic Surgery, Harvard Medical School MIT-Harvard Health Sciences and Technology
More informationPathophysiology of Postmenopausal & Glucocorticoid Induced Osteoporosis. March 15, 2016 Bone ECHO Kate T Queen, MD
Pathophysiology of Postmenopausal & Glucocorticoid Induced Osteoporosis March 15, 2016 Bone ECHO Kate T Queen, MD Review: normal bone formation Bone Modeling Remodeling Peak Bone Mass Maximum bone mass
More informationTGF-β Signaling Regulates Neuronal C1q Expression and Developmental Synaptic Refinement
Supplementary Information Title: TGF-β Signaling Regulates Neuronal C1q Expression and Developmental Synaptic Refinement Authors: Allison R. Bialas and Beth Stevens Supplemental Figure 1. In vitro characterization
More informationSupplementary Figure 1
Supplementary Figure 1 AAV-GFP injection in the MEC of the mouse brain C57Bl/6 mice at 4 months of age were injected with AAV-GFP into the MEC and sacrificed at 7 days post injection (dpi). (a) Brains
More informationOpg/Rankl mrna dynamic expression in the bone tissue of ovariectomized rats with osteoporosis
Opg/Rankl mrna dynamic expression in the bone tissue of ovariectomized rats with osteoporosis C.W. Li 1 *, B. Liang 2 *, X.L. Shi 3 and H. Wang 3 * 1 Zhejiang Chinese Medical University, Hangzhou, China
More informationSupplementary Figure 1. Expression of CUGBP1 in non-parenchymal liver cells treated with TGF-β
Supplementary Figures Supplementary Figure 1. Expression of CUGBP1 in non-parenchymal liver cells treated with TGF-β and LPS. Non-parenchymal liver cells were isolated and treated with or without TGF-β
More informationSupplementary Figure 1
Combination index (CI) Supplementary Figure 1 2. 1.5 1. Ishikawa AN3CA Nou-1 Hec-18.5...2.4.6.8 1. Fraction affected (Fa) Supplementary Figure 1. The synergistic effect of PARP inhibitor and PI3K inhibitor
More informationSUPPLEMENTARY INFORMATION
doi:1.138/nature1554 a TNF-α + in CD4 + cells [%] 1 GF SPF 6 b IL-1 + in CD4 + cells [%] 5 4 3 2 1 Supplementary Figure 1. Effect of microbiota on cytokine profiles of T cells in GALT. Frequencies of TNF-α
More informationArticle. * These authors made equal contributions to this manuscript. Submitted: March 25, Revised: July 26, Accepted: December 01, 2017.
Article Xenograft of Human Umbilical Mesenchymal Stem Cells from Wharton s Jelly Differentiating into Osteocytes and Reducing Osteoclast Activity Reverses Osteoporosis in Ovariectomized Rats Cell Transplantation
More informationKeratinocyte expression of inflammatory mediators plays a crucial role in substance P-induced acute and chronic pain
Wei et al. Journal of Neuroinflammation 2012, 9:181 JOURNAL OF NEUROINFLAMMATION RESEARCH Keratinocyte expression of inflammatory mediators plays a crucial role in substance P-induced acute and chronic
More informationc Ischemia (30 min) Reperfusion (8 w) Supplementary Figure bp 300 bp Ischemia (30 min) Reperfusion (4 h) Dox 20 mg/kg i.p.
a Marker Ripk3 +/ 5 bp 3 bp b Ischemia (3 min) Reperfusion (4 h) d 2 mg/kg i.p. 1 w 5 w Sacrifice for IF size A subset for echocardiography and morphological analysis c Ischemia (3 min) Reperfusion (8
More informationILC1 and ILC3 isolation and culture Following cell sorting, we confirmed that the recovered cells belonged to the ILC1, ILC2 and
Supplementary Methods and isolation and culture Following cell sorting, we confirmed that the recovered cells belonged to the, ILC2 and subsets. For this purpose we performed intracellular flow cytometry
More informationGlucosamine for osteoarthritis: controversy and new research
Glucosamine for osteoarthritis: controversy and new research Tassos Anastassiades MD, PhD, FRCP Professor of Medicine & Biochemistry, Director Arthritis Center, Queen s University, Kingston, ON Two parts
More informationCommensal Bacteria at the Crossroad Between Cholesterol Homeostasis and Chronic Inflammation. in Atherosclerosis
Supplementary Information Commensal Bacteria at the Crossroad Between Cholesterol Homeostasis and Chronic Inflammation in Atherosclerosis Kazuyuki Kasahara 1,, Takeshi Tanoue 3, Tomoya Yamashita 1,*, Keiko
More informationRetinoid X receptors orchestrate osteoclast differentiation and postnatal bone remodeling
Retinoid X receptors orchestrate osteoclast differentiation and postnatal bone remodeling María P. Menéndez-Gutiérrez, 1 Tamás Rőszer, 1,2 Lucía Fuentes, 1 Vanessa Núñez, 1 Amelia Escolano, 3 Juan Miguel
More informationIssue 3, September usio
Issue 3, September 2014 usio 1 Lactobacillus casei strain Shirota Research Update IMPROVEMENT IN INTESTINAL HEALTH 1. A probiotic fermented milk drink containing Lactobacillus casei strain Shirota improves
More information7/5/2016. We need drugs that. Disclosures. New Osteoporosis Treatments. What we have today. Maintain or promote bone formation
New Osteoporosis Treatments Disclosures Mary L. Bouxsein, PhD Department of Orthopedic Surgery Harvard Medical School, Boston, MA Advisory Board: Research funding: Merck, Eli Lilly, Radius Merck, Amgen
More informationSupplementary Material
Supplementary Material Supplementary Figure 1. NOS2 -/- mice develop an analogous Ghon complex after infection in the ear dermis and show dissemination of Mtb to the lung. (A) WT and NOS2 -/- mice were
More informationPro- and prebiotics as modulators of gut microbiome in management of obesity and metabolic diseases. Sampo Lahtinen, DuPont Nutrition & Health
Pro- and prebiotics as modulators of gut microbiome in management of obesity and metabolic diseases Sampo Lahtinen, DuPont Nutrition & Health 25 Jan 2016 Active Nutrition R&D team - Kantvik, Finland Characteristics
More informationIdentification of mirna differentially expressed in macrophages exposed to Porphyromonas gingivalis infection
Boston University OpenBU http://open.bu.edu Graduate Research Symposium Graduate Research Symposium 216 216-4-1 Identification of mirna differentially expressed in macrophages exposed to Porphyromonas
More informationGROUP 5. Jerrold R. Turner Nathalie Delzenne Wenke Feng Reuben Wong Thierry Piche Yehuda Ringel Irina Kirpich Brant Johnson
GROUP 5 Jerrold R. Turner Nathalie Delzenne Wenke Feng Reuben Wong Thierry Piche Yehuda Ringel Irina Kirpich Brant Johnson Todd Klaenhammer Eamonn Quigley A. The Intestinal Epithelial Cell Barrier B. IEC
More informationEstrogen receptor α- (ERα), but not ERβ-signaling, is crucially involved in mechanostimulation of bone fracture healing by whole-body vibration
Estrogen receptor α- (ERα), but not ERβ-signaling, is crucially involved in mechanostimulation of bone fracture healing by whole-body vibration Melanie Haffner-Luntzer et.al. published in BONE 1 Abstract
More informationMind Altering Microbes: Role of Microbiota-Gut-Brain Axis in Stress-Related Disorders
Mind Altering Microbes: Role of Microbiota-Gut-Brain Axis in Stress-Related Disorders John F. Cryan Ph.D. Professor & Chair Department of Anatomy & Neuroscience & Principal Investigator, Alimentary Pharmabiotic
More informationIntegrin CD11b negatively regulates TLR-triggered inflammatory responses by. activating Syk and promoting MyD88 and TRIF degradation via cbl-b
Integrin CD11b negatively regulates TLR-triggered inflammatory responses by activating Syk and promoting MyD88 and TRIF degradation via cbl-b Chaofeng Han, Jing Jin, Sheng Xu, Haibo Liu, Nan Li, and Xuetao
More informationSupplementary Figure 1. Expression of phospho-sik3 in normal and osteoarthritic articular cartilage in the knee. (a) Semiserial histological sections
Supplementary Figure 1. Expression of phospho-sik3 in normal and osteoarthritic articular cartilage in the knee. (a) Semiserial histological sections of normal cartilage were stained with safranin O-fast
More informationSupplemental Fig. 1 A. C57BL/6 (B6) C. Number of colonies in culture media B6. B6 + Abx
A. Day C57BL/6 (B6) n=9 B6 + Abx (12 weeks) n=9 B. Supplemental Fig. 1 day 1 I/R 4min Sacrifice C. Number of colonies in culture media B6 Escherichia coli Lactbacillus spp. Lactobacillus murinus Enterococcus
More informationDisclosures. Beyond BMD: Bone Quality & Bone Strength. Design of a Structure. Fractures = structural failure of the skeleton
Disclosures Beyond BMD: Bone Quality & Bone Strength Mary L. Bouxsein, PhD Center for Advanced Orthopedic Studies, BIDMC Department of Orthopedic Surgery, HMS MIT-Harvard Health Sciences and Technology
More informationSupporting Information
Supporting Information Stegbauer et al. 10.1073/pnas.0903602106 SI Methods Analysis of Plasma Renin Activity (PRA) and ACE Activity. PRA and serum ACE activity levels were determined by RIA (RENCTK, DiaSorin;
More informationAccepted Manuscript. Innate immune cells regulate oncoimmunity and cancer development. Ai-Ping Bai, Yuan Guo
Accepted Manuscript Innate immune cells regulate oncoimmunity and cancer development Ai-Ping Bai, Yuan Guo PII: S0016-5085(18)34974-6 DOI: 10.1053/j.gastro.2018.08.057 Reference: YGAST 62119 To appear
More informationCT Imaging of skeleton in small animals. Massimo Marenzana
CT Imaging of skeleton in small animals Massimo Marenzana Introduction Osteoporosis is a disease in which bones become fragile and more likely to break. It can be defined as a systemic skeletal disease
More information*Department of Animal and Poultry Science and Department of Land Resource Science, University of Guelph, Guelph, Ontario, Canada N1G 2W1
Use of Axial X-Ray Microcomputed Tomography to Assess Three-Dimensional Trabecular Microarchitecture and Bone Mineral Density in Single Comb White Leghorn Hens M. A. Martínez-Cummer,* R. Heck, and S. Leeson*
More informationGut microbiota, metabolic syndrome, obesity and the nutrient sensor pathways
Gut microbiota, metabolic syndrome, obesity and the nutrient sensor pathways Department of Gastroenterology, Endocrinology & Metabolism Medical University Innsbruck Herbert Tilg Nothing to disclose Fig.
More informationMale 30. Female. Body weight (g) Age (weeks) Age (weeks) Atg7 f/f Atg7 ΔCD11c
ody weight (g) ody weight (g) 34 3 Male 3 27 Female 26 24 22 18 7 9 11 13 15 17 19 21 23 21 18 15 7 9 11 13 15 17 19 21 23 Age (weeks) Age (weeks) Supplementary Figure 1. Lean phenotypes in mice regardless
More informationa b c Esophageal eosinophilia
TSLP-elicited basophil responses can mediate the pathogenesis of eosinophilic esophagitis. Mario Noti, Elia D. Tait Wojno, Brian S. Kim, Mark C. Siracusa, Paul R. Giacomin, Meera G. Nair, Alain J. Benitez,
More informationIMMUNE TOLERANCE, ALLERGIES & THE GUT
IMMUNE TOLERANCE, ALLERGIES & THE GUT Foods and Sensitivity The food is not the issue No food is more susceptible to being an allergy or sensitivity than any other food There are three factors: 1.Frequency
More informationSlide 1 IMMUNE TOLERANCE, ALLERGIES & THE GUT. Slide 2 Foods and Sensitivity. Slide 3
Slide 1 IMMUNE TOLERANCE, ALLERGIES & THE GUT Slide 2 Foods and Sensitivity The food is not the issue No food is more susceptible to being an allergy or sensitivity than any other food There are three
More informationPROBIONA. PROBIOTICS with 5 bacterial strains. Suitable during and after the use of antibiotics to restore intestinal microflora.
PROBIONA Probiotic supplement for adults PROBIOTICS with 5 bacterial strains Suitable during and after the use of antibiotics to restore intestinal microflora. 2.850 billion cfu per capsule guaranteed
More informationBIOLOGY and BIOMECHANICS OF NORMAL & OSTEOPOROTIC BONE
BIOLOGY and BIOMECHANICS OF NORMAL & OSTEOPOROTIC BONE Andreas Panagopoulos, MD, PhD Assistant Professor in Orthopaedics University Hospital of Patras, Orthopaedic Clinic Objectives Bone structure and
More informationPrediction Of Pathological Fracture In The Proximal Femora With Bone Lesions Using A CT Scan-based Finite Element Method
Prediction Of Pathological Fracture In The Proximal Femora With Bone Lesions Using A CT Scan-based Finite Element Method Yusuke Kawabata 1, Kosuke Matsuo 2, Hiroyuki Ike, MD 2, Tomoyuki Saito, MD, PhD
More informationAdrenomedullin inhibitor to treat/prevent osteoporosis
Adrenomedullin inhibitor to treat/prevent osteoporosis Madrid, 17 de noviembre de 2015 Content 1. The Institution 2. The Product a) Target Indications b) Innovative mechanisms of action c) Differential
More informationBest use of a probiotic supplement (Symprove TM )
UCL School of Pharmacy You ve got to be in it to win it Best use of a probiotic supplement (Symprove TM ) Professor Simon Gaisford s.gaisford@ucl.ac.uk @sgaisforducl Probiotics Probiotic market estimated
More informationPage 39 of 44. 8h LTA & AT h PepG & AT h LTA
Page 39 of 44 Fig. S1 A: B: C: D: 8h LTA 8h LTA & AT7519 E: F: 8h PepG G: 8h PepG & AT7519 Fig. S1. AT7519 overrides the survival effects of lipoteichoic acid (LTA) and peptidoglycan (PepG). (A) Human
More informationSUPPLEMENTARY INFORMATION
Supplementary Figure 1. Behavioural effects of ketamine in non-stressed and stressed mice. Naive C57BL/6 adult male mice (n=10/group) were given a single dose of saline vehicle or ketamine (3.0 mg/kg,
More informationSex Differences in Central Expression and Effects of Brain-Derived Neurotrophic Factor
Sex Differences in Central Expression and Effects of Brain-Derived Neurotrophic Factor Haifei Shi Department of Biology, Miami University International Conference on Endocrinology October 22, 14 Arcuate
More informationBone Health in the Cancer Patient. Stavroula Otis, M.D. Primary Care and Oncology: Practical Lessons Conference Brea Community Center May 10, 2018
Bone Health in the Cancer Patient Stavroula Otis, M.D. Primary Care and Oncology: Practical Lessons Conference Brea Community Center May 10, 2018 Overview Healthy bone is in a constant state of remodelling
More informationNANOINDENTATION STUDY OF NORMAL AND OSTEOPOROTIC BONES
NANOINDENTATION STUDY OF NORMAL AND OSTEOPOROTIC BONES C.T. Lim, B.H.B. Omar and J.C.J. Goh 1 Division of Bioengineering & Department of Mechanical Engineering, 1 Department of Orthopaedic Surgery, National
More informationPDGF-BB secreted by preosteoclasts induces angiogenesis during coupling with osteogenesis
Supplementry Informtion PDGF-BB secreted y preosteoclsts induces ngiogenesis during coupling with osteogenesis Hui Xie, Zhung Cui, Long Wng, Zhuying Xi, Yin Hu, Lingling Xin, Chngjun Li, Ling Xie, Jnet
More informationSupplementary Information
Supplementary Information A novel pyrazole derivative protects from ovariectomy-induced osteoporosis through the inhibition of NADPH oxidase Jung Hee Joo 1*, Jeong-Eun Huh 1*,JeeHyunLee 1,DooRiPark 1,
More informationESPEN Congress Vienna Networking with your microbiota Specific evidence-based indications. H. Lochs (Germany)
ESPEN Congress Vienna 2009 Networking with your microbiota Specific evidence-based indications H. Lochs (Germany) Probiotics Evidence based indications H. Lochs Medizinische Klinik mit Schwerpunkt Gastroenterologie,
More informationResearch Article Psoralen and Isopsoralen Ameliorate Sex Hormone Deficiency-Induced Osteoporosis in Female and Male Mice
Hindawi Publishing Corporation BioMed Research International Volume 216, Article ID 6869452, 8 pages http://dx.doi.org/1.1155/216/6869452 Research Article Psoralen and Isopsoralen Ameliorate Sex Hormone
More informationEffects of PTH treatment on tibial bone of ovariectomized rats assessed by in vivo micro-ct
Osteoporos Int (2009) 20:1823 1835 DOI 10.1007/s00198-009-0882-5 ORIGINAL ARTICLE Effects of PTH treatment on tibial bone of ovariectomized rats assessed by in vivo micro-ct J. E. M. Brouwers & B. van
More informationSupplementary Figure 1: Co-localization of reconstituted L-PTC and dendritic cells
a CD11c Na + K + ATPase Na + K + ATPase CD11c x-y CD11c Na + K + ATPase Na + K + ATPase CD11c x-z c b x-y view BoNT NAPs CD11c BoNT CD11c NAPs BoNT NAPs CD11c 90 x-z view Apical Basolateral Supplementary
More informationNon-hematopoietic Nrf2 dominantly impedes adult-progression of sickle cell anemia in mice
Non-hematopoietic Nrf2 dominantly impedes adult-progression of sickle cell anemia in mice Samit Ghosh 1,2, Chibueze A. Ihunnah 2, Rimi Hazra 2, Aisha L. Walker 2, Jason M. Hansen 3, David R. Archer 4,
More informationSupplementary Fig. 1: TBR2+ cells in different brain regions.
Hip SVZ OB Cere Hypo Supplementary Fig. 1: TBR2 + cells in different brain regions. Three weeks after the last tamoxifen injection, TBR2 immunostaining images reveal a large reduction of TBR2 + cells in
More informationGlucocorticoid suppression of osteocyte perilacunar remodeling is associated with subchondral bone degeneration in osteonecrosis
Supplementary Material Glucocorticoid suppression of osteocyte perilacunar remodeling is associated with subchondral bone degeneration in osteonecrosis Tristan W. Fowler 1, Claire Acevedo 1,2, Courtney
More informationBreast Cancer and Bone Health. Robert Coleman, Cancer Research Centre, Weston Park Hospital, Sheffield
Breast Cancer and Bone Health Robert Coleman, Cancer Research Centre, Weston Park Hospital, Sheffield Breast Cancer and Bone Health Normal Bone Health Impact of Cancer Therapies on Bone Health Therapeutic
More informationEstrogen receptor-a signaling in osteoblast progenitors stimulates cortical bone accrual
Estrogen receptor-a signaling in osteoblast progenitors stimulates cortical bone accrual Maria Almeida,, Charles A. O Brien, Stavros C. Manolagas J Clin Invest. 2013;123(1):394-404. https://doi.org/10.1172/jci65910.
More informationPhysiological and pathophysiological bone turnover - role of the immune system
Physiological and pathophysiological bone turnover - role of the immune system M. Neale Weitzmann, Emory University Ighovwerha Ofotokun, Emory University Journal Title: Nature Reviews Endocrinology Volume:
More informationSupplementary figure 1 Supplementary figure 2
Supplementary figure 1 Schematic overview of the Fc-glycan of IgG. The glycan is composed of a constant core domain (highlighted in red) composed of mannose (Man) and N-acetylglucosamine (GlcNAc) residues
More informationSUPPLEMENTARY MATERIAL
SUPPLEMENTARY MATERIAL IL-1 signaling modulates activation of STAT transcription factors to antagonize retinoic acid signaling and control the T H 17 cell it reg cell balance Rajatava Basu 1,5, Sarah K.
More informationSupplemental Figure 1. (A) Western blot for the expression of RIPK1 in HK-2 cells treated with or without LPS (1 µg/ml) for indicated times.
Supplemental Figure 1. (A) Western blot for the expression of RIPK1 in HK-2 cells treated with or without LPS (1 µg/ml) for indicated times. Western blots shown are representative results from 3 independent
More informationImaging to Assess Bone Strength and its Determinants
Imaging to Assess Bone Strength and its Determinants Mary L. Bouxsein, PhD Harvard Medical School, Boston, MA UCSF Osteoporosis Course 26 July 212 Consultant / advisor: Amgen, Eli Lilly, Merck Research
More information