Master class Biomolecular Sciences Molecular Cell Biology.
|
|
|
- Virginia Oliver
- 5 years ago
- Views:
Transcription
1 Master class Biomolecular Sciences Molecular Cell Biology : Paul van Bergen en Henegouwen. Clathrin-indep Endocytosis : Willem Stoorvogel. Endocytosis and MHC classii : X-track symposium : Ger Strous. Ubiquitination and endocytosis : Catherine Rabouille. Secretion and unconventional secretion : Madelon Maurice. Wnt pathway and membrane traffic : ABC-seminar I&I : Fulvio Reggiori. Autophagy : Bernd Helms. Lipid droplet biogenesis and function : Exam
2
3 Lipid Droplets: Storage of Lipids Bernd Helms
4 Article Robert van de Ven Joep Schothorst Dibbolt Westphaal
5 The Basics I: FAs
6 The Basics II: FA Activation
7 Basics III: TG-FA Interplay. Why?
8 Adipocytes
9 Foam cells
10 Pathologies associated with lipid droplets Obesity - mice with k.o. of structural protein, perilipin, or signaling molecule caveolin-1, are resistant to high fat induced obesitas Atherosclerosis accumulation of cholesterol loaded droplets in foam cells. Cells transform from lipid-storing into synthetic form during liver injury and repair Hepatitis/Fatty liver - hepatitis c virus core protein is associated with lipid droplets Mutation in lipid droplet-associated protein CGI-58 causes lipid storage disease Dorfman-Chanarin syndrome
11 What are Lipid Droplets?
12 Lipid droplets, general principles Excess of lipids uptake, synthesis, breakdown membranes Lipid modifying enzymes Phospholipid monolayer Free fatty acid Free cholesterol Retinol TAG Cholesterol-ester Retinyl-ester Decreased usage or export
13 Lipid droplets, general principles Structural proteins Phospholipid monolayer Free fatty acid Free cholesterol Retinoic acid TAG Cholesterol-ester Retinyl-ester Lipid modifying enzymes
14 Structural lipid droplet proteins: PAT domain proteins in mammalian cells: -Perilipin (adipocytes) -Adipophilin / ADRP -TIP47 -S3-12 -Oleosins(plant) - Hepatitis C core protein (oleosin-like domain)
15 Structural lipid droplet proteins adipocyt
16 Wolins et al (2006) FEBS Lett
17 Lipid Droplets and Lipid Metabolism D.A. Brown, Current Biol Structural lipid droplet proteins are also involved in the degradation of lipid droplets.
18 αar(1) βar(3) TNFα αar(2) TNFα α i β γ α q β γ α i β γ AC PLCβ IP3 ERK 1,2 βar(1,2) DAG α s β γ PKC TNFα ER Ca ++ TNFα Ca ++ camp 5 AMP TNFα PDE3b mrna Nucleus ERK 1,2 PKA PDE-3B Ca 2+ HSL 5 AMPK ALBP PKB PI3K HSL ATGL Perilipins P PDK1,2 p110 p85 IRS1 β β α α Insulin NEFA + Glycerol FABP + NEFA Perilipins TAG ERK 1,2 TNFα
19 Release of Free Fatty Acids (FFA) from adipocyte lipid droplets Perilipin KO mice show 10x elevated lipolysis reaction and are resistant to high fat diet Londos et al, 2005 Biochemie
20 Many cells have lipid droplets Lipid droplets as dynamic organelles?
21 Proteomics Analysis of Lipid Droplets
22 LDs: more than just storage organelles Liu et al (2004) JBC
23 Lipid droplets, more than just fat storage organelles. Structural proteins Phospholipid monolayer Free fatty acid Free cholesterol Retinoic acid Lipid modifying enzymes TAG Cholesterol-ester Retinyl-ester Signaling molecules Trafficking - distribution or uptake of lipids Regulation of lipid modifying enzymes/ structural proteins Formation/budding lipid droplets
24 How do Lipid Droplets form?
25 Overexpression of Rab18 induces lipid droplet- ER contact sites Control Rab18 S. Ozeki et al (2005) JCS
26 "Classical" model Martin & PArton (2006) Nat. Rev Mol Cell Biol
27 Brown (2001)Cur biol
28 Lipid Droplet Formation: 'Budding model' Wolins et al (2006) FEBS Lett
29 Alternative model: Adipophilin-enriched ER domains
30 Alternative model: Adipophilin-enriched ER domains
31 Methods to study lipid droplets in vitro
32 A B CHO-wt CHO-mutant Staining with Nile Red Bodipy
33 Induction of LD formation Oleic Acid (18:1) CHO-K1 Bodipy α-adrp CHO-K1 24 hr oleate Bodipy α-adrp
34
35 Lipidomics Facility 4000QTRAP API QTRAP
36 Lipidomics Facility: Analyses (Phospho-)lipid classes PC, PE, PG, PI, PS, PI, PA, CL, Lyso-PLs, SM Molecular species Phospholipids (PC, PE, PS, PI ) Sphingolipids (SM) Neutral lipids (TG, DG, FA, Cer) Sterols and derivatives Biosynthetic Intermediates Oxysterols Other Prostaglandins, Quinones, Detergents Vitamines, Tocopheroles, etc
37 Single Stage Mass Spectrometry 100 cells Bruegger et al (1997) PNAS
38 Lipid Profiling by Tandem MS
39 Extracted 339 = MAG-18:1 TAG-18:1,18:1,18:1 WT CHO-K1 + Oleate DAG-18:1,18:1 TAG-16:1,18:1,18:1 TAG-18:0,18:1,22:5 TAG-18:1,18:1,18:2 TAG-16:0,18:1,18:1 TAG- 18:1,18:1,20:1 TAG-18:1,18:1,22:5 TAG-18:1,18:1,22:6 TAG- 18:0,18:1,18:1 TAG 16:0, 18:0,18:1
40 WT CHO-K1 + Oleate contains 18-1 Cholesterol -esters
41 Lipid Droplets 3? 1 2 Cholesterol Homeostasis Caveolins
42 Lipid Droplets? 1 Cholesterol Homeostasis Caveolins
43 Lipid composition of LDs DiAugustine et al (1973) Biochem J.
44 Cellular cholesterol metabolism
45 Cellular cholesterol homeostasis
46 Lipid Droplets? 2 Cholesterol Homeostasis Caveolins
47
48 Caveolin and cholesterol Caveolin binds cholesterol and FA: a cholesterol sensor? Cholesterol promotes dimerization/oligomerization A cytosolic complex containing Caveolin may be involved in cholesterol transport Cholesterol oxidation induces Caveolin redistribution (PM to ER/Golgi) Caveolin expression is regulated by cholesterol levels Caveolin and caveolae: rafts and cholesterol transport across the plasma membrane
49 Lipid Droplets 3? Cholesterol Homeostasis Caveolins
50 JCB Caveolin-2β Caveolin-1 Fujimoto et al. JCB (2001)
51 Caveolin - lipid droplets Pathologies associated with lipid droplets Hepatic stellate cells transform from lipid-storing into synthetic form during liver injury and repair Obesity - mice with k.o. of structural protein, perilipin, or signaling molecule caveolin-1, are resistant to high fat induced obesitas Hepatitis/Fatty liver - hepatitis c virus core protein is associated with lipid droplets Mutation in lipid droplet-associated protein CGI-58 causes lipid storage disease Dorfman-Chanarin syndrome Atherosclerosis accumulation of cholesterol loaded droplets in foam cells.
52 Caveolin k.o cells have defect in lipid droplet formation and structure + Oleic acid
53 Caveolin-1 K.O. mice are resistant to diet-induced obesity
54 Lipid droplets: more than just fat storage organelles?
Regulation of Lipid Homeostasis: Lipid Droplets
Regulation of Lipid Homeostasis: Lipid Droplets Bernd Helms Article Brand Recter Hendrik Mertens 1 The Basics I: FAs The Basics II: FA Activation 2 Basics III: TG-FA Interplay. Why? Adipocytes 3 Foam cells
Chapter 1 The Lipid Droplet: a Dynamic Organelle, not only Involved in the Storage and Turnover of Lipids
Chapter 1 The Lipid Droplet: a Dynamic Organelle, not only Involved in the Storage and Turnover of Lipids Sven-Olof Olofsson, Pontus Boström, Jens Lagerstedt, Linda Andersson, Martin Adiels, Jeanna Perman,
In The Name Of God. In The Name Of. EMRI Modeling Group
In The Name Of God In The Name Of God EMRI Modeling Group Cells work together in functionally related groups called tissues Types of tissues: Epithelial lining and covering Connective support Muscle movement
Lipid Metabolism Prof. Dr. rer physiol. Dr.h.c. Ulrike Beisiegel
Lipid Metabolism Department of Biochemistry and Molecular Biology II Medical Center Hamburg-ppendorf 1 Lipids. visceral fat. nutritional lipids 0 1.5 3 4.5 9 h. serum lipids. lipid accumulation in the
Lipidne mikrodomene. funkcija
Lipidne mikrodomene funkcija 1 Cellular processes involving lipid rafts - Signal transduction - Protein and lipid trafficking and sorting - Endosome(clathrin)-independent endocytosis: - potocytosis and
1Why lipids cannot be transported in blood alone? 2How we transport Fatty acids and steroid hormones?
1Why lipids cannot be transported in blood alone? 2How we transport Fatty acids and steroid hormones? 3How are dietary lipids transported? 4How lipids synthesized in the liver are transported? 5 Lipoprotien
ANSC/NUTR 618 LIPIDS & LIPID METABOLISM. Triacylglycerol and Fatty Acid Metabolism
ANSC/NUTR 618 LIPIDS & LIPID METABOLISM II. Triacylglycerol synthesis A. Overall pathway Glycerol-3-phosphate + 3 Fatty acyl-coa à Triacylglycerol + 3 CoASH B. Enzymes 1. Acyl-CoA synthase 2. Glycerol-phosphate
Glucose. Glucose. Insulin Action. Introduction to Hormonal Regulation of Fuel Metabolism
Glucose Introduction to Hormonal Regulation of Fuel Metabolism Fasting level 3.5-5 mmol (1 mmol = 18 mg/dl) Postprandial 6-10 mmol Amount of glucose in circulation is dependent on: Absorption from the
Cholesterol and its transport. Alice Skoumalová
Cholesterol and its transport Alice Skoumalová 27 carbons Cholesterol - structure Cholesterol importance A stabilizing component of cell membranes A precursor of bile salts A precursor of steroid hormones
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION FOR Liver X Receptor α mediates hepatic triglyceride accumulation through upregulation of G0/G1 Switch Gene 2 (G0S2) expression I: SUPPLEMENTARY METHODS II: SUPPLEMENTARY FIGURES
Cellular control of cholesterol. Peter Takizawa Department of Cell Biology
Cellular control of cholesterol Peter Takizawa Department of Cell Biology Brief overview of cholesterol s biological role Regulation of cholesterol synthesis Dietary and cellular uptake of cholesterol
Poly-unsaturated phospholipids WE (FA18:1) A B C D OAHFA 18:1/24:0 OAHFA 18:1/30:2 PS 38:4 C18:1C23:0 OAHFA 18:1/25:0 OAHFA 18:1/30:1
Figure S1, related to Figure 1. Correlation scatter plots illustrating individual lipid species from various classes that exhibited statistically significant correlations to age. (A-B) Various species
LIPID METABOLISM
LIPID METABOLISM LIPOGENESIS LIPOGENESIS LIPOGENESIS FATTY ACID SYNTHESIS DE NOVO FFA in the blood come from :- (a) Dietary fat (b) Dietary carbohydrate/protein in excess of need FA TAG Site of synthesis:-
Principles of Shotgun Lipidomics
Principles of Shotgun Lipidomics Xianlin Han Diabetes and Obesity Research Center Sanford-Burnham Medical Research Institute Lake Nona Orlando, FL 32827 What is shotgun lipidomics? Original definition
CHM333 LECTURE 34: 11/30 12/2/09 FALL 2009 Professor Christine Hrycyna
Lipid Metabolism β-oxidation FA Acetyl-CoA Triacylglycerols (TAGs) and glycogen are the two major forms of stored energy in vertebrates Glycogen can supply ATP for muscle contraction for less than an hour
ANSC/NUTR 618 LIPIDS & LIPID METABOLISM Lipoprotein Metabolism
ANSC/NUTR 618 LIPIDS & LIPID METABOLISM Lipoprotein Metabolism I. Chylomicrons (exogenous pathway) A. 83% triacylglycerol, 2% protein, 8% cholesterol plus cholesterol esters, 7% phospholipid (esp. phosphatidylcholine)
Lipids digestion and absorption, Biochemistry II
Lipids digestion and absorption, blood plasma lipids, lipoproteins Biochemistry II Lecture 1 2008 (J.S.) Triacylglycerols (as well as free fatty acids and both free and esterified cholesterol) are very
Summary and concluding remarks
Summary and concluding remarks This thesis is focused on the role and interaction of different cholesterol and phospholipid transporters. Cholesterol homeostasis is accomplished via a tightly regulated
E3 ligase TRIM72 negatively regulates myogenesis by IRS-1 ubiquitination
E3 ligase negatively regulates myogenesis by IRS-1 ubiquitination Young-Gyu Ko College of Life Science and Biotechnology Korea University MyHC immunofluorescence Lipid rafts are plasma membrane compartments
BCM 221 LECTURES OJEMEKELE O.
BCM 221 LECTURES BY OJEMEKELE O. OUTLINE INTRODUCTION TO LIPID CHEMISTRY STORAGE OF ENERGY IN ADIPOCYTES MOBILIZATION OF ENERGY STORES IN ADIPOCYTES KETONE BODIES AND KETOSIS PYRUVATE DEHYDROGENASE COMPLEX
AMPK. Tomáš Kuc era. Ústav lékar ské chemie a klinické biochemie 2. lékar ská fakulta, Univerzita Karlova v Praze
AMPK (AMP- ACTIVATED PROTEIN KINASE ) Tomáš Kuc era Ústav lékar ské chemie a klinické biochemie 2. lékar ská fakulta, Univerzita Karlova v Praze 2013 AMPK AMP-ACTIVATED PROTEIN KINASE present in all eukaryotic
Steven Michael Dragos. A Thesis. presented to. The University of Guelph. In partial fulfillment of requirements. for the degree of.
Reduced SCD1 activity decreases fatty acid re-esterification and alters markers of glyceroneogenesis and lipolysis in murine white adipose tissue and 3T3-L1 adipocytes by Steven Michael Dragos A Thesis
Plasma lipoproteins & atherosclerosis by. Prof.Dr. Maha M. Sallam
Biochemistry Department Plasma lipoproteins & atherosclerosis by Prof.Dr. Maha M. Sallam 1 1. Recognize structures,types and role of lipoproteins in blood (Chylomicrons, VLDL, LDL and HDL). 2. Explain
Lipid droplet biogenesis: a novel process of self-digestion as a strategy of survival to stress
Lipid droplet biogenesis: a novel process of self-digestion as a strategy of survival to stress Memoria del trabajo experimental para optar al grado de doctor, correspondiente al Programa de Doctorado
Lipodystrophy: Metabolic and Clinical Aspects. Resource Room Slide Series
Lipodystrophy: Metabolic and Clinical Aspects Resource Room Slide Series Cellular Pathology of Insulin Resistance in Lipodystrophy Robert R. Henry, MD Professor of Medicine University of California, San
Test Bank for Lehninger Principles of Biochemistry 5th Edition by Nelson
Test Bank for Lehninger Principles of Biochemistry 5th Edition by Nelson Link download full: http://testbankair.com/download/test-bank-forlehninger-principles-of-biochemistry-5th-edition-by-nelson/ Chapter
Dengue Virus Infection Perturbs Lipid Homeostasis in Infected Mosquito Cells
University of Nebraska - Lincoln DigitalCommons@University of Nebraska - Lincoln Biochemistry -- Faculty Publications Biochemistry, Department of 2012 Dengue Virus Infection Perturbs Lipid Homeostasis
SUPPLEMENTARY INFORMATION
doi:10.1038/nature12652 Supplementary Figure 1. PRDM16 interacts with endogenous EHMT1 in brown adipocytes. Immunoprecipitation of PRDM16 complex by flag antibody (M2) followed by Western blot analysis
The role of apolipoprotein D in lipid metabolism and metabolic syndrome
UQÀM: Department of Biological Sciences The role of apolipoprotein D in lipid metabolism and metabolic syndrome Catherine Mounier PhD Apolipoprotein D Apolipoprotéine D (apod) Secreted protein Associated
LIPIDS TAG, PL and SL metabolism. Marek Vecka
LIPIDS TAG, PL and SL metabolism Marek Vecka BIOSYNTHESIS OF TAG TWO BIOSYNTHETIC PATHWAYS IN MAMMALS liver, adipose tissue - use mainly phosphatidate pathway ( Kennedy pathway ) intestine - monoacylglycerol
Metabolic Syndrome. DOPE amines COGS 163
Metabolic Syndrome DOPE amines COGS 163 Overview - M etabolic Syndrome - General definition and criteria - Importance of diagnosis - Glucose Homeostasis - Type 2 Diabetes Mellitus - Insulin Resistance
OVERVIEW M ET AB OL IS M OF FR EE FA TT Y AC ID S
LIPOLYSIS LIPOLYSIS OVERVIEW CATABOLISM OF FREE FATTY ACIDS Nonesterified fatty acids Source:- (a) breakdown of TAG in adipose tissue (b) action of Lipoprotein lipase on plasma TAG Combined with Albumin
Chapt. 10 Cell Biology and Biochemistry. The cell: Student Learning Outcomes: Describe basic features of typical human cell
Chapt. 10 Cell Biology and Biochemistry Cell Chapt. 10 Cell Biology and Biochemistry The cell: Lipid bilayer membrane Student Learning Outcomes: Describe basic features of typical human cell Integral transport
HIV VPR alters fat metabolism. Dorothy E Lewis PhD/Ashok Balasubramanyam MD
HIV VPR alters fat metabolism Dorothy E Lewis PhD/Ashok Balasubramanyam MD Old Dogma for HIV associated lipodystrophy Differentiation Block (PI) Lipoatrophy Apoptosis (NRTI) Stem cell Preadipocyte Adipocyte
Fat in hearts: Uptake, storage, and turnover. Chad M Trent
Fat in hearts: Uptake, storage, and turnover Chad M Trent Submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy under the Executive Committee of the Graduate School
MATERNAL GESTATIONAL DIABETES MELLITUS AND PLACENTAL LIPIDS
Note: for non-commercial purposes only MATERNAL GESTATIONAL DIABETES MELLITUS AND PLACENTAL LIPIDS Olaf Uhl 2 1, 1 0, Log10(p-value) 0-0, -1-1, -2-2, LPC160 PC160-160 PC160-181 PC160-203 PC160-226 PC180-181
Lipoproteins Metabolism
Lipoproteins Metabolism LEARNING OBJECTIVES By the end of this Lecture, the student should be able to describe: What are Lipoproteins? Describe Lipoprotein Particles. Composition of Lipoproteins. The chemical
Practice Exam 2 MCBII
1. Which feature is true for signal sequences and for stop transfer transmembrane domains (4 pts)? A. They are both 20 hydrophobic amino acids long. B. They are both found at the N-terminus of the protein.
Hypothalamic Autophagy and Regulation of Energy Balance
Hypothalamic Autophagy and Regulation of Energy Balance Rajat Singh, MD Albert Einstein College of Medicine New York NuGOweek 211 Sept 6-9, 211 Autophagy Evolutionarily conserved cellular recycling program
GLYCEROLIPID METABOLISM AND SIGNALING IN HEALTH AND DISEASE. Short Title: GL/FFA Cycle and Signaling. Marc Prentki and S.R.
Endocrine Reviews. First published ahead of print July 8, 2008 as doi:10.1210/er.2008-0007 GLYCEROLIPID METABOLISM AND SIGNALING IN HEALTH AND DISEASE Short Title: GL/FFA Cycle and Signaling Marc Prentki
BA, BSc, and MSc Degree Examinations
Examination Candidate Number: Desk Number: BA, BSc, and MSc Degree Examinations 2017-18 Department : BIOLOGY Title of Exam: Metabolism in health and disease - open assessment Marking Scheme: Total marks
AMPK. Tomáš Kučera.
AMPK (AMP- ACTIVATED PROTEIN KINASE ) Tomáš Kučera tomas.kucera@lfmotol.cuni.cz Department of Medical Chemistry and Clinical Biochemistry 2nd Faculty of Medicine, Charles University in Prague and Motol
Final Review Sessions. 3/16 (FRI) 126 Wellman (4-6 6 pm) 3/19 (MON) 1309 Surge 3 (4-6 6 pm) Office Hours
Final Review Sessions 3/16 (FRI) 126 Wellman (4-6 6 pm) 3/19 (MON) 1309 Surge 3 (4-6 6 pm) Office ours 3/14 (WED) 9:30 11:30 am (Rebecca) 3/16 (FRI) 9-11 am (Abel) Final ESSENTIALS Posted Lecture 20 ormonal
NASH Bench to Bedside
NASH Bench to Bedside October 2006 Anna Mae Diehl, M.D. Gastroenterology Division Duke University NonAlcoholic Fatty Liver Disease Common ~1/4-1/3 1/3 US adults Outcome highly variable Course indolent
The Perilipin Family of Structural Lipid Droplet Proteins: Stabilization of Lipid Droplets and Control of Lipolysis. Dawn L.
The Perilipin Family of Structural Lipid Droplet Proteins: Stabilization of Lipid Droplets and Control of Lipolysis Dawn L. Brasaemle Department of Nutritional Sciences and the Rutgers Center for Lipid
3-Thia Fatty Acids A New Generation of Functional Lipids?
Conference on Food Structure and Food Quality 3-Thia Fatty Acids A New Generation of Functional Lipids? Rolf K. Berge rolf.berge@med.uib.no Fatty acids- Essential cellular metabolites Concentrations must
Companion to Biosynthesis of Ketones & Cholesterols, Regulation of Lipid Metabolism Lecture Notes
Companion to Biosynthesis of Ketones & Cholesterols, Regulation of Lipid Metabolism Lecture Notes The major site of acetoacetate and 3-hydorxybutyrate production is in the liver. 3-hydorxybutyrate is the
Cell Signaling part 2
15 Cell Signaling part 2 Functions of Cell Surface Receptors Other cell surface receptors are directly linked to intracellular enzymes. The largest family of these is the receptor protein tyrosine kinases,
Lipoproteins Metabolism Reference: Campbell Biochemistry and Lippincott s Biochemistry
Lipoproteins Metabolism Reference: Campbell Biochemistry and Lippincott s Biochemistry Learning Objectives 1. Define lipoproteins and explain the rationale of their formation in blood. 2. List different
Pathophysiology of Lipid Disorders
Pathophysiology of Lipid Disorders Henry Ginsberg, M.D. Division of Preventive Medicine and Nutrition CHD in the United States CHD is the single largest killer of men and women 12 million have history
Nafith Abu Tarboush DDS, MSc, PhD
Nafith Abu Tarboush DDS, MSc, PhD natarboush@ju.edu.jo www.facebook.com/natarboush Lipids (cholesterol, cholesterol esters, phospholipids & triacylglycerols) combined with proteins (apolipoprotein) in
A Central Role of MG53 in Metabolic Syndrome. and Type-2 Diabetes
A Central Role of MG53 in Metabolic Syndrome and Type-2 Diabetes Yan Zhang, Chunmei Cao, Rui-Ping Xiao Institute of Molecular Medicine (IMM) Peking University, Beijing, China Accelerated Aging in China
Intestinal cytoplasmic lipid droplets, associated proteins, and the regulation of dietary fat absorption
Purdue University Purdue e-pubs Open Access Dissertations Theses and Dissertations 8-2016 Intestinal cytoplasmic lipid droplets, associated proteins, and the regulation of dietary fat absorption Theresa
BIOL212 Biochemistry of Disease. Metabolic Disorders - Obesity
BIOL212 Biochemistry of Disease Metabolic Disorders - Obesity Obesity Approx. 23% of adults are obese in the U.K. The number of obese children has tripled in 20 years. 10% of six year olds are obese, rising
Cell Membranes. Dr. Diala Abu-Hassan School of Medicine Cell and Molecular Biology
Cell Membranes Dr. Diala Abu-Hassan School of Medicine Dr.abuhassand@gmail.com Cell and Molecular Biology Organelles 2Dr. Diala Abu-Hassan Membrane proteins Major components of cells Nucleic acids DNA
Cellular Physiology (PHSI3009) Contents:
Cellular Physiology (PHSI3009) Contents: Cell membranes and communication 2 nd messenger systems G-coupled protein signalling Calcium signalling Small G-protein signalling o RAS o MAPK o PI3K RHO GTPases
Models of the plasma membrane - from the fluid mosaic to the picket fence model. Mario Schelhaas Institute of Cellular Virology
Models of the plasma membrane - from the fluid mosaic to the picket fence model Mario Schelhaas Institute of Cellular Virology Today s lecture Central Question: How does the plasma membrane fulfil its
Nature Immunology: doi: /ni Supplementary Figure 1
Supplementary Figure 1 Fatty acid oxidation is emphasized in 1 macrophages compared with that in macrophages. Gene expression of mitochondrial OXPHOS (Atp5j, Cox4i1, Uqcrc1/2, Ndufs1, Sdhb) and β-oxidation
IL METABOLISMO EPATICO DEI CARBOIDRATI IN FISIOLOGIA E PATOLOGIA
UNIGASTRO Il fegato come centrale metabolica e i fattori di danno oltre ai virus epatitici IL METABOLISMO EPATICO DEI CARBOIDRATI IN FISIOLOGIA E PATOLOGIA Dr Elisabetta Bugianesi Divisione di Gastro-Epatologia
Gene Polymorphisms and Carbohydrate Diets. James M. Ntambi Ph.D
Gene Polymorphisms and Carbohydrate Diets James M. Ntambi Ph.D Fatty Acids that Flux into Tissue Lipids are from Dietary Sources or are Made De novo from Glucose or Fructose Glucose Fructose Acetyl-CoA
About OMICS International Conferences
About OMICS Group OMICS Group is an amalgamation of Open Access publications and worldwide international science conferences and events. Established in the year 2007 with the sole aim of making the information
Pathogenesis of Diabetes Mellitus
Pathogenesis of Diabetes Mellitus Young-Bum Kim, Ph.D. Associate Professor of Medicine Harvard Medical School Definition of Diabetes Mellitus a group of metabolic diseases characterized by hyperglycemia
Introduction to Lipid Chemistry
Introduction to Lipid Chemistry Benjamin Schwartz Ontario SCC Education Day September 18, 2018 Lipid knowledge for the personal care industry What is a Lipid? Lipids are fatty acids and their derivatives,
Hmgcoar AGCTTGCCCGAATTGTATGTG TCTGTTGTAACCATGTGACTTC. Cyp7α GGGATTGCTGTGGTAGTGAGC GGTATGGAATCAACCCGTTGTC
Supplement Table I: primers for Real Time RT-PCR Gene Foward Reverse Hmgcoar AGCTTGCCCGAATTGTATGTG TCTGTTGTAACCATGTGACTTC Cyp7α GGGATTGCTGTGGTAGTGAGC GGTATGGAATCAACCCGTTGTC Cyp27a1 GTGGTCTTATTGGGTACTTGC
Effects of Cholesterol on Membranes: Physical Properties
Effects of Cholesterol on Membranes: Physical Properties Removes gel to liquid crystal phase transition New intermediate phase called liquid ordered - ordering of the membrane lipids due to condensation
What would you observe if you fused a G1 cell with a S cell? A. Mitotic and pulverized chromosomes. B. Mitotic and compact G1 chromosomes.
What would you observe if you fused a G1 cell with a S cell? A. Mitotic and pulverized chromosomes. B. Mitotic and compact G1 chromosomes. C. Mostly non-compact G1 chromosomes. D. Compact G1 and G2 chromosomes.
Vesicle Transport. Vesicle pathway: many compartments, interconnected by trafficking routes 3/17/14
Vesicle Transport Vesicle Formation Curvature (Self Assembly of Coat complex) Sorting (Sorting Complex formation) Regulation (Sar1/Arf1 GTPases) Fission () Membrane Fusion SNARE combinations Tethers Regulation
Sphingolipid de novo synthesis: its relevance to metabolic diseases and cell polarity
Sphingolipid de novo synthesis: its relevance to metabolic diseases and cell polarity Xian-Cheng Jiang (shian-chen chiang) SUNY Downstate Medical Center Cell plasma membrane Lipid rafts Sphingolipid =
PROTEIN-PROTEIN INTERACTIONS AND THE CHARACTERIZATION OF ADIPOCYTE FATTY ACID BINDING PROTEIN
PROTEIN-PROTEIN INTERACTIONS AND THE CHARACTERIZATION OF ADIPOCYTE FATTY ACID BINDING PROTEIN A DISSERTATION SUBMITTED TO THE FACULTY OF THE GRADUATE SCHOOL OF THE UNIVERSITY OF MINNESOTA BY Brian Raymond
Cell Quality Control. Peter Takizawa Department of Cell Biology
Cell Quality Control Peter Takizawa Department of Cell Biology Cellular quality control reduces production of defective proteins. Cells have many quality control systems to ensure that cell does not build
Principles of Genetics and Molecular Biology
Cell signaling Dr. Diala Abu-Hassan, DDS, PhD School of Medicine Dr.abuhassand@gmail.com Principles of Genetics and Molecular Biology www.cs.montana.edu Modes of cell signaling Direct interaction of a
Lipid droplets are functionally connected to the endoplasmic reticulum in Saccharomyces cerevisiae
JCS epress online publication date 21 June 2011 2424 Research Article Lipid droplets are functionally connected to the endoplasmic reticulum in Saccharomyces cerevisiae Nicolas Jacquier 1, *, Vineet Choudhary
Chapter 26 Biochemistry 5th edition. phospholipids. Sphingolipids. Cholesterol. db=books&itool=toolbar
http://www.ncbi.nlm.nih.gov/sites/entrez? db=books&itool=toolbar 1 The surface of a soap bubble is a bilayer formed by detergent molecules 2 Chapter 26 Biochemistry 5th edition phospholipids Sphingolipids
Achieve Broad Lipid Quantitation using a High-Throughput Targeted Lipidomics Method
Achieve Broad Lipid Quantitation using a High-Throughput Targeted Lipidomics Method LC-Based Approach for Lipid Class Separation and Quantitation on QTRAP 6500+ System Mackenzie Pearson, Santosh Kumar
TEST BANK FOR LEHNINGER PRINCIPLES OF BIOCHEMISTRY 6TH EDITION BY NELSON
Link full download: https://testbankservice.com/download/testbank-for-lehninger-principles-of-biochemistry-6th-edition-bynelson TEST BANK FOR LEHNINGER PRINCIPLES OF BIOCHEMISTRY 6TH EDITION BY NELSON
Propagation of the Signal
OpenStax-CNX module: m44452 1 Propagation of the Signal OpenStax College This work is produced by OpenStax-CNX and licensed under the Creative Commons Attribution License 3.0 By the end of this section,
Synthesis and elongation of fatty acids
Synthesis and elongation of fatty acids A molecular caliper mechanism for determining very long-chain fatty acid length Vladimir Denic and Jonathan S. Weissman (2007) Cell 130, 663-677 February 28, 2008
CHAPTER FORTY FIVE ENDOGENOUS LIPID TRANSPORT PATHWAY: VLDL AND IDL
CHAPTER FORTY FIVE ENDOGENOUS LIPID TRANSPORT PATHWAY: VLDL AND IDL You will notice that the endogenous pathway is very similar to the exogenous pathway What is the average daily amount of triacylglycerol
Lipid raft-a gateway for passing through the cell membrane for pathogens
16 3 2004 6 Chinese Bulletin of Life Sciences Vol. 16, No. 3 Jun., 2004 10040374(2004)03014404 200031 / GPI (GPI) Q241 Q257 R37 A Lipid rafta gateway for passing through the cell membrane for pathogens
AN OVERVIEW OF FATTY ACID ETHYL ESTERS
AN OVERVIEW OF FATTY ACID ETHYL ESTERS Michael Laposata, M.D., Ph.D. Director of Clinical Laboratories Massachusetts General Hospital Professor, Harvard Medical School OUTLINE OF PRESENTATION Background
Sphingolipids. Sphingolipids are an additional type of membrane lipids, after glycerophospholipids, galactolipids and sulfolipids
Lipids 2 Steven E. Massey, Ph.D. Assistant Professor of Bioinformatics Department of Biology and Environmental Sciences University of Puerto Rico Río Piedras Office & Lab: Bioinformatics Lab NCN#343B Tel:
Receptors Functions and Signal Transduction- L4- L5
Receptors Functions and Signal Transduction- L4- L5 Faisal I. Mohammed, MD, PhD University of Jordan 1 PKC Phosphorylates many substrates, can activate kinase pathway, gene regulation PLC- signaling pathway
Niacin Metabolism: Effects on Cholesterol
Niacin Metabolism: Effects on Cholesterol By Julianne R. Edwards For Dr. William R. Proulx, PhD, RD Associate Professor of Nutrition and Dietetics In partial fulfillments for the requirements of NUTR342
By: Dr Hadi Mozafari 1
Biological lipids are a chemically diverse group of compounds, the common and defining feature of which is their insolubility in water. By: Dr Hadi Mozafari 1 Fats and oils are the principal stored forms
Wolff-Parkinson-White Syndrome and PRKAG2
Wolff-Parkinson-White Syndrome and PRKAG2 Maggie Beatka University of Wisconsin-Madison http://www.beatmap.net/portfolio-detail/human-cardiovascular-system-3drenderings/ What causes Wolff-Parkinson-White?
Metabolism of acylglycerols and sphingolipids. Martina Srbová
Metabolism of acylglycerols and sphingolipids Martina Srbová Types of glycerolipids and sphingolipids 1. Triacylglycerols function as energy reserves adipose tissue (storage of triacylglycerol), lipoproteins
Human Complex Milk Lipids: Concentrations, benefits and the implications for Paediatric Nutrition
Human Complex Milk Lipids: Concentrations, benefits and the implications for Paediatric Nutrition Alastair MacGibbon, Bertram Fong, Angela Rowan and Paul McJarrow Fonterra Research and Development Centre,
Sponsored document from Progress in Lipid Research. Lipolysis A highly regulated multi-enzyme complex mediates the catabolism of cellular fat stores
Sponsored document from Progress in Lipid Research Lipolysis A highly regulated multi-enzyme complex mediates the catabolism of cellular fat stores Achim Lass, Robert Zimmermann, Monika Oberer, and Rudolf
FSP27 contributes to efficient energy storage in murine white adipocytes by promoting the formation of unilocular lipid droplets
Research article Related Commentary, page 2693 FSP27 contributes to efficient energy storage in murine white adipocytes by promoting the formation of unilocular lipid droplets Naonobu Nishino, 1 Yoshikazu
Biochemistry: A Short Course
Tymoczko Berg Stryer Biochemistry: A Short Course Second Edition CHAPTER 27 Fatty Acid Degradation Dietary Lipid (Triacylglycerol) Metabolism - In the small intestine, fat particles are coated with bile
The use of mass spectrometry in lipidomics. Outlines
The use of mass spectrometry in lipidomics Jeevan Prasain jprasain@uab.edu 6-2612 utlines Brief introduction to lipidomics Analytical methodology: MS/MS structure elucidation of phospholipids Phospholipid
Supplementary Table 2. Plasma lipid profiles in wild type and mutant female mice submitted to a HFD for 12 weeks wt ERα -/- AF-1 0 AF-2 0
Supplementary Table 1. List of specific primers used for gene expression analysis. Genes Primer forward Primer reverse Hprt GCAGTACAGCCCCAAAATGG AACAAAGTCTGGCCTGTATCCA Srebp-1c GGAAGCTGTCGGGGTAGCGTC CATGTCTTCAAATGTGCAATCCAT
General Biochemistry-1 BCH 202
General Biochemistry-1 BCH 202 1 I would like to acknowledge Dr. Farid Ataya for his valuable input & help in this course. 2 Outline Lipids Definition, function, fatty acids, classification: simple lipids:
BIOL 4374/BCHS 4313 Cell Biology Exam #1 February 13, 2001
BIOL 4374/BCHS 4313 Cell Biology Exam #1 February 13, 2001 SS# Name This exam is worth a total of 100 points. The number of points each question is worth is shown in parentheses. Good luck! 1. (2) The
University of Alberta
University of Alberta Role of Triacylglycerol Hydrolase in Hepatic Lipid Droplet Metabolism by Huajin Wang A thesis submitted to the Faculty of Graduate Studies and Research in partial fulfillment of the
Supplementary Figure S1
Lipidomic-based investigation into the regulatory effect of Schisandrin B on palmitic acid level in non-alcoholic steatotic livers Hiu Yee Kwan 1,2, Xuyan Niu 3, Wenlin Dai 4, Tiejun Tong 4, Xiaojuan Chao
BBSG 501 Section 4 Metabolic Fuels, Energy and Order Fall 2003 Semester
BBSG 501 Section 4 Metabolic Fuels, Energy and Order Fall 2003 Semester Section Director: Dave Ford, Ph.D. Office: MS 141: ext. 8129: e-mail: fordda@slu.edu Lecturers: Michael Moxley, Ph.D. Office: MS
Life Sciences METABOLISM. Transform Your Metabolic Research
METABOLISM Transform Your Metabolic Research COMPREHENSIVE TOOLS FOR ADVANCING YOUR METABOLIC RESEARCH Metabolism refers to a set of chemical reactions which are responsible for transforming carbohydrates,