Hypothalamic Autophagy and Regulation of Energy Balance
|
|
|
- Caren Atkins
- 5 years ago
- Views:
Transcription
1 Hypothalamic Autophagy and Regulation of Energy Balance Rajat Singh, MD Albert Einstein College of Medicine New York NuGOweek 211 Sept 6-9, 211
2 Autophagy Evolutionarily conserved cellular recycling program Cellular homeostasis Degrades aged organelles, proteins, & cytosol Alternate energy source Cell shape/tissue differentiation Cellular injury & death Metabolic alterations Microbial pathogenesis Cancers Affect Health
3 What is health? Autophagy/stress response pathway Physical Physical Physical Obesity Obesity Mental the Health ability is a state to of adapt complete to physical, mental, and social-well challenges being, and or not environmental merely the stressors absence of disease or infirmity Mental Mental Social Social Social
4 Types of Autophagy Macroautophagy ( in-bulk degradation) Mitochondria (mitophagy) ER (reticulophagy) Peroxisomes (pexophagy) Chaperone-mediated autophagy Microautophagy
5 Macroautophagy Starvation/Stress Bcl2 Beclin-1 Nutrients/ P-mTOR Atg14 Beclin-1 vps15 Class III vps34 PI3K Atg14 Atg7 vps15 LC3-I Atg5/12 vps34 LC3-II Amino/fatty acids Nucleation complex Limiting membrane Autophagosome Lysosome
6 Autophagy (lipophagy) regulates lipid metabolism Limiting membrane fatty acids Energy Limiting membrane Singh, Kaushik et al. Nature (29)
7 Autophagy (lipophagy) mobilizes lipid stores None Oleic Bodipy 493/53 Control siatg5 LD number/cell Control siatg5 None # # OL 14 C-oleic acid/β-oxidation Relative β-oxidation Control siatg5 OL MCD Control siatg5 Control Atg7 F/F -Alb-Cre 2µm 2µm Electron Microscopy 1 µm 5µm Oil Red O 5µm Singh, Kaushik et al. Nature (29)
8 Why Autophagy (lipophagy) in the hypothalamus? Active lipid metabolism within hypothalamic neurons Hypothalamic neuron-intrinsic free fatty acid availability feeding Autophagy is induced by starvation Autophagy mobilizes lipid stores to increase free fatty acid availability Hypothalamic mtor (autophagy inhibitor) regulates energy balance
9 Questions? Nutrients Does starvation induce autophagy in the hypothalamus? Does lipophagy exist in hypothalamic neurons? Autophagy FFA Does autophagy regulate neuronal free fatty acid levels? Function of autophagy in neurons? GT1-7 hypothalamic cells Primary hypothalamic cultures Food intake in vivo
10 Question Does starvation induce autophagy in the hypothalamus?
11 GT1-7 cells Fed Starved Starved Starvation induces autophagy in the hypothalamus Refed LC3 Beclin-1 Actin Fed Starved Refed.5h Fed Starved Refed 2h Fed Starved Refed 4h II Autophagosome content (relative) Fed Starved Refed.5h # 2h ### 4h RFOL Indirect Immunofluorescence LC3 1 μm Fed Starve d Refed LC3 puncta /cell area 5 ### MBH LC3 Actin Autophagosome content (relative) Fed Stv 6h Refed # Fed Stv 6h Refed II Kaushik et al. Cell Metabolism (August, 211)
12 Increased Hypothalamic autophagy by functional flux assays Basal LC3 flux assay LC3- II/p62 LC3- II/p62 Inh Control or starved +/- Lysosomal Inhibitor (Inh) LC3-II blot Limiting membrane Autophagic flux Active Inh Net amount of LC3-II or p62 accumulated in lysosomes in presence of inhibitors (Inh)
13 Starvation induces autophagy in the hypothalamus LC3- II/p62 Inh LC3 flux assay Control or starved LC3-II blot GT1-7 cells MBH +/- Lysosomal Inhibitor (Inh) Inh LC3 Actin Net LC3 flux (relative) II Inh + + p62 Actin Net p62 flux (relative)
14 Question What are the physiological effects of loss of autophagy in hypothalamic neurons?
15 Generation of neuron autophagy-deficient mice x = Atg7 F/F -Cre Atg7 F/F- -Cre Atg7/Cre Atg7 Cre 5 μm POMC/Cre POMC Cre 5 μm
16 Loss of autophagy in neurons reduces adiposity and food intake Body weight (g) Control KO 2mo 6-8mo Total fat mass (g) Control KO ewat wt (g) Control KO Autophagy Food intake Food intake (g) Control KO Food intake (g) 6h fast Control KO 1h 2h Kaushik et al. Cell Metabolism (August, 211)
17 Loss of autophagy in neurons reduces levels MBH GT1-7 cells Autophagy Con KO Stv - 6h - 6h Actin Actin Fed Con siatg5 Fed.5h 2h 4h.5h 2h 4h (ng/μg protein) Con siatg5 ELISA Culture medium
18 Loss of autophagy in neurons reduces inhibitory inputs on POMC neurons Nutrients Autophagy POMC POMC Actin Fed Stv 6h α-msh Control KO 1 μm α-msh fluorescence Control KO Locomotor activity (events/min) Control KO ATGL Actin Fed Stv 6h Con KO Con KO Loss of Autophagy in neurons increases energy expenditure Kaushik et al. Cell Metabolism (August, 211)
19 Question What activates hypothalamic autophagy during starvation?
20 Question Autophagy? Circulating free fatty acids Starvation Circulating free fatty acids Autophagy
21 Questions Whether starvation increases hypothalamic lipid accumulation? Whether increased hypothalamic lipids activate autophagy?
22 1. Whether starvation increases hypothalamic lipid accumulation? Lipids? GT1-7 cells 14 C-Triglycerides Triglyceride Synthesis assay TLC 14 C-oleic acid 14 C-TG FFA Circulating free fatty acids Starvation 14 C-TG 14 C-Fatty acid Triacsin C Treatment Triacsin C Fatty acid TG Fed serum Starved serum 1 μm MBH 14 C-TG BODIPY TG
23 2. Whether increased hypothalamic lipids activate autophagy? Autophagy? GT1-7 cells Oleic Palmitate FFA Circulating free fatty acids Starvation Net LC3 flux Control.6.25 Net LC3 flux Control.6.25 % of Total Proteolysis none Oleic Lysosomal.25mM P-AMPK P-ULK1 Actin - OL Pal P-AMPK P-ULK1 Actin
24 Question? Whether induction of hypothalamic autophagy mobilizes neuron-intrinsic lipids?
25 Dynamic interactions between autophagic components and Whether autophagic components hypothalamic interact lipids? with hypothalamic lipids? GT1-7 cells BODIPY BODIPY LAMP1 Limiting membrane BODIPY/LAMP1 Control Oleic Palmitate BODIPY/LAMP1 FS SS % colocalization BODIPY/LAMP Control Oleic Palmitate % colocalization BODIPY/LAMP Fed serum Starved serum
26 Autophagic components interact with hypothalamic lipids Oleic Primary hypothalamic cultures BODIPY LAMP1 BODIPY/LAMP1 Control Oleic Number of colocalized puncta BODIPY/LAMP Control Kaushik et al. Cell Metabolism (August, 211)
27 Autophagic components interact with hypothalamic lipids GT1-7 cells BODIPY/LAMP1 BODIPY +Serum +Serum Inh -Serum -Serum Inh Refed Refed Inh LD number/area LD number/area S -S RF # # +S -S RF Kaushik et al. Cell Metabolism (August, 211)
28 Autophagic components interact with hypothalamic lipids in vivo MBH PLIN2/LAMP1 PLIN2 LAMP1 1μm PLIN2/LAMP-2A PLIN2 LAMP-2A 1μm Kaushik et al. Cell Metabolism (August, 211)
29 Question? Hypothalamus Lysosome Lipids Free Fatty acids (?) FFA~CoA FFA Circulating free fatty acids Does hypothalamic autophagy serve to increase neuronal free fatty acids? Starvation
30 Autophagy generates hypothalamic free fatty acids during starvation TLC 14 C-TG 14 C-FA None TrC +S -S +S -S TrC 14 C-TG 14 C-FA Triglyceride Decay assay 14 C-oleic acid Pulse 14 C-TG TrC TLC -serum Chase +S -S RF TrC C-TG 14 C-FA 14 C-FA (Relative units/µg) # +S -S RF TLC 14 C-FA (Relative units/µg) None +Inh 14 C-FA (Relative units/µg) Con siatg5
31 Inhibiting Autophagy leads to neuronal lipid accumulation GT1-7 cells Control Inh BODIPY Primary hypothalamic cultures Control 1 μm Inh BODIPY
32 Question? Hypothalamus Lysosome Lipids Free Fatty acids FFA Circulating free fatty acids Starvation FFA~CoA Whether autophagy-derived neuronal free fatty acids modulate levels?
33 Free fatty acids upregulate levels GT1-7 cells +S -S OL (mm) Actin +S -S Pal (mm) Actin Actin Densitometry units none.25mm OL.25mM Pal +S -S Densitometry units none.25mm OL.25mM Pal -S Densitometry units FS SS
34 Question? Hypothalamus Lysosome Lipids Free Fatty acids FFA Circulating free fatty acids Starvation FFA~CoA Whether blocking autophagy impairs fatty acid-induced expression?
35 Blocking Autophagy impairs fatty acid-induced expression GT1-7 cells Oleic - Inh OL (mm) Actin Densitometry units Inh +Inh..25mM Actin Densitometry units Palmitate Inh -Inh +Inh Actin Densitometry units Starved serum CHX OL (mm) Actin - Inh -Inh +Inh Actin Densitometry units Serum removal Pal (.25mM) Actin - CHX - Inh -Inh +Inh Primary hypothalamic cultures /DAPI 1 μm (Arbitrary Fluorescence units) -Inh Inh +Inh Basal +Inh Densitometry units OL (.25mM) -CHX +CHX Densitometry units CHX +CHX
36 Conceptual Framework Lipids Lysosome Starvation induces hypothalamic fatty acid uptake Fatty acid uptake activates hypothalamic autophagy FFA~CoA Circulating free fatty acids FFA Autophagy regulates the controlled availability of neuron-intrinsic free fatty acids Neuronal free fatty acids drive expression Loss of autophagy in neurons reduces expression and constitutively increases POMC levels Starvation POMC Increased energy expenditure Positively affect metabolic health Kaushik et al. Cell Metabolism (August, 211)
37 Future directions 1. Autophagy in POMC neurons Upstream signaling cascades that control neuronal autophagy Fatty acid regulation of neuropeptide expression Hypothalamic autophagy & aging
38 Acknowledgements Lab Nuria Martinez, PhD Susmita Kaushik, PhD Priti Mishall, MD Lisa Sahu Diana Athonvaragkul Collaborators Ana Maria Cuervo, MD PhD Gary Schwartz, PhD Funding NIH NIDDK Einstein-Nathan Shock Pilot award
39
40
41 Does fatty acid link macroautophagy to secretion? FFA +Serum -Serum 3 RF β-oxidation (CPM/h/µg) S -S RF ATP Neuron activation Merge CMXROS Mitotracker 1.6 -S -S + Etmxr (Relative units) ELISA Relative units mrna Relative units S -S 3min N/L Etmxr TrC DEUP. -s -s + etm -s + TrC
42 Decreased hypothalamic autophagy with aging may contribute to anorexia 3mo 12mo 22mo F S6h F S6h F S6h Atg7 Atg5/12 Actin Food (g)/mean body wt (g) mo 12mo 22mo
43 Fatty acids induces autophagy as a feed-forward mechanism -serum -serum + OL -serum + Pal % colocalization (BODIPY/LC3) BODIPY/LC Serum- None OL PAL
44 Body wt (g) neuron specific ablation of autophagy decreases food intake and body weight Atg7F/F x -Cre 3mo Con -Cre 6mo Basal food intake Food intake (g/mouse) h Con -Cre 2h Atg7 and LC3 WB WB in con/ko WAT wt (g) Con -Cre Serum fatty acids (meq/l) F S F S Glucose (mg/dl) F S F S Con -Cre Con -Cre
45 Aging-induced decline in hypothalamic autophagy contributes to anorexia of aging 2. 3mo 12mo 22mo F S6h F S6h F S6h Atg7 Atg5/12 Actin 1.. 3mo 12mo 22mo F S6h F S6h F S6h NL p62 Actin.6 Loading MBH TH 3mo 12mo 22mo 3mo 12mo 22mo F S F S F S F S F S F S Food (g)/mean body wt (g) mo 12mo 22mo
46 Questions?? Is fatty acid driving gene expression? Yes!! Mechanism? -PPAR-gamma? -FoXo1?
47 Hypothalamic regulation of food intake Nutrients POMC AgR P Hunger POMC Satiety
48 The working model neuron GT1-7 hypothalamic cells serum removal 14 C-fatty acid Mediobasal hypothalami fasted mice serum fatty acids AV Lipid stores Lys FFA Food intake
49 Autophagic components interact with hypothalamic lipids Primary hypothalamic cultures BODIPY/LAMP1 Control 1 μm Inh +Inh/Oleic Colocalized puncta/neuron BODIPY/LAMP Inh +Inh - - Ol Kaushik et al. Cell Metabolism (211)
50
Regulation of Lipid Homeostasis: Lipid Droplets
Regulation of Lipid Homeostasis: Lipid Droplets Bernd Helms Article Brand Recter Hendrik Mertens 1 The Basics I: FAs The Basics II: FA Activation 2 Basics III: TG-FA Interplay. Why? Adipocytes 3 Foam cells
thematic review series
thematic review series Thematic Review Series: Lipotoxicity: Many Roads to Cell Dysfunction and Cell Death Lipids, lysosomes, and autophagy Bharat Jaishy 1 and E. Dale Abel 2 Fraternal Order of Eagles
REVIEWS. Targeting autophagy in obesity: from pathophysiology to management
REVIEWS Targeting autophagy in obesity: from pathophysiology to management Yingmei Zhang 1,2 *, James R. Sowers 3 and Jun Ren 1,2 * Abstract Obesity poses a severe threat to human health, including the
1,8 1,6 1,4 1,2 1. EE/g lean mass 0,8 0,6 0,4 0,2. Ambulatory locomotor activity. (beam brakes/48h) V MCH MCHpf 0,86 0,85 0,84 0,83 0,82 0,81 0,8
Supplementary figure 1 vehicle A -pf Energy expenditure (kcal/kg/48h) 25 2 15 1 5 V pf EE/g lean mass 1,8 1,6 1,4 1,2 1,8,6,4,2 Total locomotor activity (beam brakes/48h) C D E 7 6 5 4 3 2 1 V pf Ambulatory
and Metabolism, Roy J. and Lucille A. Carver College of Medicine, University of Iowa,
1 Lipids, Lysosomes and Autophagy Bharat Jaishy 1 * and E. Dale Abel 1,2 1 Fraternal Order of Eagles Diabetes Research Center and Division of Endocrinology and Metabolism, Roy J. and Lucille A. Carver
NASH Bench to Bedside
NASH Bench to Bedside October 2006 Anna Mae Diehl, M.D. Gastroenterology Division Duke University NonAlcoholic Fatty Liver Disease Common ~1/4-1/3 1/3 US adults Outcome highly variable Course indolent
BIOL212 Biochemistry of Disease. Metabolic Disorders - Obesity
BIOL212 Biochemistry of Disease Metabolic Disorders - Obesity Obesity Approx. 23% of adults are obese in the U.K. The number of obese children has tripled in 20 years. 10% of six year olds are obese, rising
Defective Hepatic Autophagy in Obesity Promotes ER Stress and Causes Insulin Resistance
Cell Metabolism, Volume 11 Supplemental Information Defective Hepatic Autophagy in Obesity Promotes ER Stress and Causes Insulin Resistance Ling Yang, Ping Li, Suneng Fu, Ediz S. Calay, and Gökhan S. Hotamisligil
Autophagy in Insulin Resistance. Abstract. Introduction. Takeshi Yoshizaki. KEY WORDS: Autophagy, insulin resistance, aging, inflammation
Received: Oct. 10, 2012 Accepted: Oct. 17, 2012 Published online: Oct. 31, 2012 Review Article Autophagy in Insulin Resistance Takeshi Yoshizaki Department of Medicine, Shiga University of Medical Science
6. TNF-α regulates oxidative stress, mitochondrial function and autophagy in neuronal cells
6. TNF-α regulates oxidative stress, mitochondrial function and autophagy in neuronal cells 6.1 TNF-α induces mitochondrial oxidative stress in SH-SY5Y cells. The dysregulation of mitochondria and oxidative
Autophagosomes contribute to intracellular lipid distribution in enterocytes
MBoC ARTICLE Autophagosomes contribute to intracellular lipid distribution in enterocytes Salem Ait Khaldoun a, Marc-Alexandre Emond-Boisjoly a, Danielle Chateau a, Véronique Carrière a, Michel Lacasa
Sestrin2 and BNIP3 (Bcl-2/adenovirus E1B 19kDa-interacting. protein3) regulate autophagy and mitophagy in renal tubular cells in. acute kidney injury
Sestrin2 and BNIP3 (Bcl-2/adenovirus E1B 19kDa-interacting protein3) regulate autophagy and mitophagy in renal tubular cells in acute kidney injury by Masayuki Ishihara 1, Madoka Urushido 2, Kazu Hamada
A. Generation and characterization of Ras-expressing autophagycompetent
Supplemental Material Supplemental Figure Legends Fig. S1 A. Generation and characterization of Ras-expressing autophagycompetent and -deficient cell lines. HA-tagged H-ras V12 was stably expressed in
Metabolic Syndrome. DOPE amines COGS 163
Metabolic Syndrome DOPE amines COGS 163 Overview - M etabolic Syndrome - General definition and criteria - Importance of diagnosis - Glucose Homeostasis - Type 2 Diabetes Mellitus - Insulin Resistance
Master class Biomolecular Sciences Molecular Cell Biology.
Master class Biomolecular Sciences Molecular Cell Biology. 04-09-08: Paul van Bergen en Henegouwen. Clathrin-indep Endocytosis 11-09-08: Willem Stoorvogel. Endocytosis and MHC classii 18-09-08: X-track
Autophagy regulates adipose mass and differentiation in mice
Research article Autophagy regulates adipose mass and differentiation in mice Rajat Singh, 1,2 Youqing Xiang, 1,2 Yongjun Wang, 1,2 Kiran Baikati, 1,2 Ana Maria Cuervo, 1,2,3,4,5 Yen K. Luu, 1,4 Yan Tang,
Suppl. Figure 1. T 3 induces autophagic flux in hepatic cells. (A) RFP-GFP-LC3 transfected HepG2/TRα cells were visualized and cells were quantified
Suppl. Figure 1. T 3 induces autophagic flux in hepatic cells. (A) RFP-GFP-LC3 transfected HepG2/TRα cells were visualized and cells were quantified for RFP-LC3 puncta (red dots) representing both autolysosomes
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION FOR Liver X Receptor α mediates hepatic triglyceride accumulation through upregulation of G0/G1 Switch Gene 2 (G0S2) expression I: SUPPLEMENTARY METHODS II: SUPPLEMENTARY FIGURES
The Enhancement of Toxin-Induced Liver Fibrosis in Fatty Liver Disease. Ekihiro Seki, M.D.,Ph.D. University of California San Diego
The Enhancement of Toxin-Induced Liver Fibrosis in Fatty Liver Disease Ekihiro Seki, M.D.,Ph.D. University of California San Diego - A manufactured chemical. - Does not exist naturally. Carbon tetrachloride
Name Animal source Vendor Cat # Dilutions
Supplementary data Table S1. Primary and Secondary antibody sources Devi et al, TXNIP in mitophagy A. Primary Antibodies Name Animal source Vendor Cat # Dilutions 1. TXNIP mouse MBL KO205-2 1:2000 (WB)
Supplementary Fig. 1 V-ATPase depletion induces unique and robust phenotype in Drosophila fat body cells.
Supplementary Fig. 1 V-ATPase depletion induces unique and robust phenotype in Drosophila fat body cells. a. Schematic of the V-ATPase proton pump macro-complex structure. The V1 complex is composed of
THE ROLE OF ALTERED CALCIUM AND mtor SIGNALING IN THE PATHOGENESIS OF CYSTINOSIS
Research Foundation, 18 month progress report THE ROLE OF ALTERED CALCIUM AND mtor SIGNALING IN THE PATHOGENESIS OF CYSTINOSIS Ekaterina Ivanova, doctoral student Elena Levtchenko, MD, PhD, PI Antonella
GFP-LC3 +/+ CLU -/- kda CLU GFP. Actin. GFP-LC3 +/+ CLU -/- kda CLU GFP. Actin
Supplementary Fig. 1 a CQ treatment ScrB OGX11 MG132 I II AZD5363 I II b GFP / / GFP / / GFP / / GFP / / GFP GFP Actin Actin ctrl CQ GFP / / GFP / / GFP / / GFP / / GFP GFP Actin Actin rapamycin rapamycincq
AMPK. Tomáš Kučera.
AMPK (AMP- ACTIVATED PROTEIN KINASE ) Tomáš Kučera tomas.kucera@lfmotol.cuni.cz Department of Medical Chemistry and Clinical Biochemistry 2nd Faculty of Medicine, Charles University in Prague and Motol
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2211 a! mir-143! b! mir-103/107! let-7a! mir-144! mir-122a! mir-126-3p! mir-194! mir-27a! mir-30c! Figure S1 Northern blot analysis of mir-143 expression dependent on feeding conditions.
AMPK. Tomáš Kuc era. Ústav lékar ské chemie a klinické biochemie 2. lékar ská fakulta, Univerzita Karlova v Praze
AMPK (AMP- ACTIVATED PROTEIN KINASE ) Tomáš Kuc era Ústav lékar ské chemie a klinické biochemie 2. lékar ská fakulta, Univerzita Karlova v Praze 2013 AMPK AMP-ACTIVATED PROTEIN KINASE present in all eukaryotic
Hypothalamic inflammation: a double-edged sword to nutritional diseases
Ann. N.Y. Acad. Sci. ISSN 0077-8923 ANNALS OF THE NEW YORK ACADEMY OF SCIENCES Issue: The Year in Diabetes and Obesity Hypothalamic inflammation: a double-edged sword to nutritional diseases Dongsheng
3-Thia Fatty Acids A New Generation of Functional Lipids?
Conference on Food Structure and Food Quality 3-Thia Fatty Acids A New Generation of Functional Lipids? Rolf K. Berge rolf.berge@med.uib.no Fatty acids- Essential cellular metabolites Concentrations must
Fig. S1. REGN1500 reduces plasma levels of cholesterol, TG and NEFA in WT and Ldlr -/- mice. (A) WT
Figure Legends for Supplementary Figures. Fig. S1. REGN15 reduces plasma levels of cholesterol, TG and NEF in WT and Ldlr -/- mice. () WT and Ldlr -/- mice were injected with control IgG or REGN15 (1 mg/kg)
Supplemental data Supplemental Figure Legends Supplemental Figure 1. Supplemental Figure 2.
Supplemental data Supplemental Figure Legends Supplemental Figure 1. Analysis of deletion of AMPK!2 in POMC and AgRP neurons in control and POMC!2KO and AgRP!2KO mice. (A) mmunofluorescence analysis for
AAV-TBGp-Cre treatment resulted in hepatocyte-specific GH receptor gene recombination
AAV-TBGp-Cre treatment resulted in hepatocyte-specific GH receptor gene recombination Supplementary Figure 1. Generation of the adult-onset, liver-specific GH receptor knock-down (alivghrkd, Kd) mouse
Supplemental Figures:
Supplemental Figures: Figure 1: Intracellular distribution of VWF by electron microscopy in human endothelial cells. a) Immunogold labeling of LC3 demonstrating an LC3-positive autophagosome (white arrow)
Central injection of fibroblast growth factor 1 induces sustained remission of diabetic hyperglycemia in rodents
Central injection of fibroblast growth factor 1 induces sustained remission of diabetic hyperglycemia in rodents Jarrad M Scarlett 1,,1, Jennifer M Rojas 1,1, Miles E Matsen 1, Karl J Kaiyala 3, Darko
Supplementary Table 2. Plasma lipid profiles in wild type and mutant female mice submitted to a HFD for 12 weeks wt ERα -/- AF-1 0 AF-2 0
Supplementary Table 1. List of specific primers used for gene expression analysis. Genes Primer forward Primer reverse Hprt GCAGTACAGCCCCAAAATGG AACAAAGTCTGGCCTGTATCCA Srebp-1c GGAAGCTGTCGGGGTAGCGTC CATGTCTTCAAATGTGCAATCCAT
McWilliams et al., http :// /cgi /content /full /jcb /DC1
Supplemental material JCB McWilliams et al., http ://www.jcb.org /cgi /content /full /jcb.201603039 /DC1 THE JOURNAL OF CELL BIOLOGY Figure S1. In vitro characterization of mito-qc. (A and B) Analysis
Integrative Metabolism: Significance
Integrative Metabolism: Significance Energy Containing Nutrients Carbohydrates Fats Proteins Catabolism Energy Depleted End Products H 2 O NH 3 ADP + Pi NAD + NADP + FAD + Pi NADH+H + NADPH+H + FADH2 Cell
Appendix Table of Contents. 1. Appendix Figure legends S1-S13 and Appendix Table S1 and S2. 2. Appendix Figures S1-S13
Appendix Table of Contents. Appendix Figure legends S-S3 and Appendix Table S and S. Appendix Figures S-S3 . Appendix Figure legends S-S3 and Appendix Table S and S Appendix Figure S. Western blot analysis
A particular set of insults induces apoptosis (part 1), which, if inhibited, can switch to autophagy. At least in some cellular settings, autophagy se
A particular set of insults induces apoptosis (part 1), which, if inhibited, can switch to autophagy. At least in some cellular settings, autophagy serves as a defence mechanism that prevents or retards
A microrna-34a/fgf21 Regulatory Axis and Browning of White Fat
A microrna-34a/fgf21 Regulatory Axis and Browning of White Fat Jongsook Kim Kemper, Ph.D Department of Molecular and Integrative Physiology, University of Illinois at Urbana-Champaign, USA 213 International
perk/erk STAT5B
pakt/akt relative to saline (fold).5.5.5 control perk/erk relative to saline (fold).6.4..8.6.4. p=.6 control db/+ Hsp6 VDAC Hsp6/VDAC (relative to db/+) 8 6 4 db/+ C db/+ Hsp6 Hsp6/actin (relative to db/+)
Mitophagy induction through mito-cyp1b1/mnsod axis facilitates Benzo[a]pyrene-mediated cell death
![Mitophagy induction through mito-cyp1b1/mnsod axis facilitates Benzo[a]pyrene-mediated cell death](/thumbs/89/98946741.jpg "Mitophagy induction through mito-cyp1b1/mnsod axis facilitates Benzo[a]pyrene-mediated cell death")
Mitophagy induction through mito-cyp1b1/mnsod axis facilitates Benzo[a]pyrene-mediated cell death Sujit K Bhutia*, Durgesh Nandini Das, Prashanta Kumar Panda, Prajna Paramita Naik Department of Life Science,
Store-Operated Ca 2+ Entry Controls Induction of Lipolysis and the Transcriptional Reprogramming to Lipid Metabolism
Article Store-Operated Ca 2+ Entry Controls Induction of Lipolysis and the Transcriptional Reprogramming to Lipid Metabolism Graphical Abstract Authors Mate Maus, Mario Cuk, Bindi Patel,..., Kathryn J.
TITLE: Novel Role of Merlin Tumor Suppressor in Autophagy and Its Implication in Treating NF2-Associated Tumors
AWARD NUMBER: W81XWH 11 1 0269 TITLE: Novel Role of Merlin Tumor Suppressor in Autophagy and Its Implication in Treating NF2-Associated Tumors PRINCIPAL INVESTIGATOR: Toshifumi Tomoda, M.D., Ph.D CONTRACTING
Gene Polymorphisms and Carbohydrate Diets. James M. Ntambi Ph.D
Gene Polymorphisms and Carbohydrate Diets James M. Ntambi Ph.D Fatty Acids that Flux into Tissue Lipids are from Dietary Sources or are Made De novo from Glucose or Fructose Glucose Fructose Acetyl-CoA
Obesity in aging: Hormonal contribution
Obesity in aging: Hormonal contribution Hormonal issues in obesity and aging Hormonal role in regulation of energy balance Genetic component in hormonal regulation Life style contribution to hormonal changes
Supplementary Figure 1
Supplementary Figure 1 A B mir-141, human cell lines mir-2c, human cell lines mir-141, hepatocytes mir-2c, hepatocytes Relative RNA.1.8.6.4.2 Relative RNA.3.2.1 Relative RNA 1.5 1..5 Relative RNA 2. 1.5
Supplementary Fig. 1 eif6 +/- mice show a reduction in white adipose tissue, blood lipids and normal glycogen synthesis. The cohort of the original
Supplementary Fig. 1 eif6 +/- mice show a reduction in white adipose tissue, blood lipids and normal glycogen synthesis. The cohort of the original phenotypic screening was n=40. For specific tests, the
Lecture 5: Cell Metabolism. Biology 219 Dr. Adam Ross
Lecture 5: Cell Metabolism Biology 219 Dr. Adam Ross Cellular Respiration Set of reactions that take place during the conversion of nutrients into ATP Intricate regulatory relationship between several
a b c Physical appearance of mice Lean mass Adipocyte size d e f
LFD HFD LFD HFD Area under curve (GTT) HFD-VSL#3 LFD HFD Area under curve (ITT) HFD-VSL#3 Liver TG content (% l) HFD-VSL#3 LFD HFD HFD-VSL#3 LFD HFD HFD-VSL#3 LFD HFD HFD + VSL#3 Lean mass (gm) Mean adipocyte
Supplementary Figure 1) GABAergic enhancement by leptin hyperpolarizes POMC neurons A) Representative recording samples showing the membrane
Supplementary Figure 1) GABAergic enhancement by leptin hyperpolarizes POMC neurons A) Representative recording samples showing the membrane potential recorded from POMC neurons following treatment with
Chapter 12. Ingestive Behavior
Chapter 12 Ingestive Behavior Drinking a. fluid compartments b. osmometric thirst c. volumetric thirst Eating a. energy sources b. starting a meal c. stopping a meal d. eating disordersd Drinking a. fluid
Cell Quality Control. Peter Takizawa Department of Cell Biology
Cell Quality Control Peter Takizawa Department of Cell Biology Cellular quality control reduces production of defective proteins. Cells have many quality control systems to ensure that cell does not build
About OMICS Group Conferences
About OMICS Group OMICS Group International is an amalgamation of Open Access publications and worldwide international science conferences and events. Established in the year 2007 with the sole aim of
Leptin Intro/Signaling. ATeamP: Angelo, Anthony, Charlie, Gabby, Joseph
Leptin Intro/Signaling ATeamP: Angelo, Anthony, Charlie, Gabby, Joseph Overview Intro to Leptin Definition & Sources Physiology Bound vs. Free Receptors Signaling JAK/STAT MAPK PI3K ACC Experimental findings
SUPPLEMENTARY DATA. Nature Medicine: doi: /nm.4171
SUPPLEMENTARY DATA Supplementary Figure 1 a b c PF %Change - -4-6 Body weight Lean mass Body fat Tissue weight (g).4.3.2.1. PF GC iwat awat BAT PF d e f g week 2 week 3 NEFA (mmol/l) 1..5. PF phsl (Ser565)
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb3461 In the format provided by the authors and unedited. Supplementary Figure 1 (associated to Figure 1). Cpeb4 gene-targeted mice develop liver steatosis. a, Immunoblot displaying CPEB4
Macroautophagy and Cell Responses Related to Mitochondrial Dysfunction, Lipid Metabolism and Unconventional Secretion of Proteins
Cells 2012, 1, 168-203; doi:10.3390/cells1020168 Review OPEN ACCESS cells ISSN 2073-4409 www.mdpi.com/journal/cells Macroautophagy and Cell Responses Related to Mitochondrial Dysfunction, Lipid Metabolism
Rapid parallel measurements of macroautophagy and mitophagy in
Supplemental Figures Rapid parallel measurements of macroautophagy and mitophagy in mammalian cells using a single fluorescent biosensor Sargsyan A, Cai J, Fandino LB, Labasky ME, Forostyan T, Colosimo
A Central Role of MG53 in Metabolic Syndrome. and Type-2 Diabetes
A Central Role of MG53 in Metabolic Syndrome and Type-2 Diabetes Yan Zhang, Chunmei Cao, Rui-Ping Xiao Institute of Molecular Medicine (IMM) Peking University, Beijing, China Accelerated Aging in China
Males- Western Diet WT KO Age (wks) Females- Western Diet WT KO Age (wks)
Relative Arv1 mrna Adrenal 33.48 +/- 6.2 Skeletal Muscle 22.4 +/- 4.93 Liver 6.41 +/- 1.48 Heart 5.1 +/- 2.3 Brain 4.98 +/- 2.11 Ovary 4.68 +/- 2.21 Kidney 3.98 +/-.39 Lung 2.15 +/-.6 Inguinal Subcutaneous
Expanded View Figures
PEX13 functions in selective autophagy Ming Y Lee et al Expanded View Figures Figure EV1. PEX13 is required for Sindbis virophagy. A, B Quantification of mcherry-capsid puncta per cell (A) and GFP-LC3
Sestrin2-mediated signaling in autophagy induction and oxidative metabolism
Sestrin2-mediated signaling in autophagy induction and oxidative metabolism May 16, 2017 Graduate Course 2214/BioC 998 SEUNG-HYUN RO Redox Biology Center University of Nebraska - Lincoln 1 Part I : ULK1-Sestrin2
1.5 ASK1KO fed. fasted 16 hrs w/o water. Fed. 4th. 4th WT ASK1KO N=29, 11(WT), ,5(ASK1KO) ASK1KO ASK1KO **** Time [h]
![1.5 ASK1KO fed. fasted 16 hrs w/o water. Fed. 4th. 4th WT ASK1KO N=29, 11(WT), ,5(ASK1KO) ASK1KO ASK1KO **** Time [h]](/thumbs/87/97258189.jpg "1.5 ASK1KO fed. fasted 16 hrs w/o water. Fed. 4th. 4th WT ASK1KO N=29, 11(WT), ,5(ASK1KO) ASK1KO ASK1KO **** Time [h]")
7: 13: 19: 1: 7: 151117 a 151117 4th 4th b c RQ.95 KO.9.85.8.75.7 light dark light dark.65 7: 19: 7: 19: 7: Means ± SEM, N=6 RQ 1..9.8.7.6.6 KO CL (-) CL (+) ibat weight ratio (/body weight) [%].5.4.3.2.1
Insulin-Leptin Interactions
Insulin-Leptin Interactions Ahmed S., Al-Azzam N., Cao B. Karshaleva B., Sriram S., Vu K. If you understand a system, you can predict it. Agenda - Energy homeostasis Overview of leptin and insulin Signaling
Effects of growth hormone secretagogue receptor agonist and antagonist in nonobese type 2 diabetic MKR mice
Effects of growth hormone secretagogue receptor agonist and antagonist in nonobese type 2 diabetic MKR mice Rasha Mosa (MBCHC, M.D, PhD candidate) School of Biomedical Sciences University of Queensland
SUPPLEMENTARY INFORMATION In format provided by JAATTELA (NOVEMBER 2005)
Box S1: Methods for studying lysosomal function and integrity Volume and distribution of the acidic compartment. Acridine orange is a metachromatic fluorochrome and a weak base that accumulates in the
ZL ZDF ZDF + E2 *** Visceral (g) ZDF
Body Weight (g) 4 3 2 1 ** * ZL ZDF 6 8 1 12 14 16 Age (weeks) B * Sub-cutaneous (g) 16 12 8 4 ZL ZDF Visceral (g) 25 2 15 1 5 ZL ZDF Total fat pad weight (g) 4 3 2 1 ZDF ZL Supplemental Figure 1: Effect
DISTINCT FUNCTIONS OF AUTOPHAGY KINASES ULK1 AND ULK2 IN ADIPOGENESIS AND ADIPOCYTE METABOLISM A DISSERTATION
DISTINCT FUNCTIONS OF AUTOPHAGY KINASES ULK1 AND ULK2 IN ADIPOGENESIS AND ADIPOCYTE METABOLISM A DISSERTATION SUBMITTED TO THE FACULTY OF THE GRADUATE SCHOOL OF THE UNIVERSITY OF MINNESOTA BY SEUNG-HYUN
Regulation of Systemic Energy Balance and Glucose Homeostasis by Protein-Tyrosine Phosphatase 1B
Regulation of Systemic Energy Balance and Glucose Homeostasis by Protein-Tyrosine Phosphatase 1B Fawaz G. Haj Associate Professor Diagnosed Obesity and Diabetes for Adults aged 20 years in United States
Supplementary Figure S1. Effect of Glucose on Energy Balance in WT and KHK A/C KO
Supplementary Figure S1. Effect of Glucose on Energy Balance in WT and KHK A/C KO Mice. WT mice and KHK-A/C KO mice were provided drinking water containing 10% glucose or tap water with normal chow ad
Copyright 2017 The Guilford Press
This is a chapter excerpt from Guilford Publications. Eating Disorders and Obesity: A Comprehensive Handbook, Third Edition. Edited by Kelly D. Brownell and B. Timothy Walsh. Copyright 2017. Purchase this
Role of fatty acids in the development of insulin resistance and type 2 diabetes mellitus
Emerging Science Role of fatty acids in the development of insulin resistance and type 2 diabetes mellitus George Wolf Insulin resistance is defined as the reduced responsiveness to normal circulating
Supplementary Materials
Supplementary Materials 1 Supplementary Table 1. List of primers used for quantitative PCR analysis. Gene name Gene symbol Accession IDs Sequence range Product Primer sequences size (bp) β-actin Actb gi
Supporting Information. Epigallocatechin-3-gallate (EGCG) promotes autophagy-dependent survival via
Supporting Information Epigallocatechin-3-gallate (EGCG) promotes autophagy-dependent survival via influencing the balance of mtor-ampk pathways upon endoplasmic reticulum stress Figure S1. EGCG induces
The Role of LCPUFA in Obesity. M.Tom Clandinin. The Alberta Institute for Human Nutrition The University of Alberta Edmonton, Alberta, Canada
The Role of LCPUFA in Obesity by M.Tom Clandinin The Alberta Institute for Human Nutrition The University of Alberta Edmonton, Alberta, Canada How big is the Conceptual Problem? Some assumptions: 150lb
18s AAACGGCTACCACATCCAAG CCTCCAATGGATCCTCGTTA. 36b4 GTTCTTGCCCATCAGCACC AGATGCAGCAGATCCGCAT. Acc1 AGCAGATCCGCAGCTTG ACCTCTGCTCGCTGAGTGC
Supplementary Table 1. Quantitative PCR primer sequences Gene symbol Sequences (5 to 3 ) Forward Reverse 18s AAACGGCTACCACATCCAAG CCTCCAATGGATCCTCGTTA 36b4 GTTCTTGCCCATCAGCACC AGATGCAGCAGATCCGCAT Acc1
SUPPLEMENTARY INFORMATION
doi:10.1038/nature12652 Supplementary Figure 1. PRDM16 interacts with endogenous EHMT1 in brown adipocytes. Immunoprecipitation of PRDM16 complex by flag antibody (M2) followed by Western blot analysis
Deficient Chaperone-Mediated Autophagy in Liver Leads to Metabolic Dysregulation
Article Deficient Chaperone-Mediated Autophagy in Liver Leads to Metabolic Dysregulation Jaime L. Schneider, 1,2 Yousin Suh, 2,3 and Ana Maria Cuervo 1,2, * 1 Department of Developmental and Molecular
Project report October 2012 March 2013 CRF fellow: Principal Investigator: Project title:
Project report October 2012 March 2013 CRF fellow: Gennaro Napolitano Principal Investigator: Sergio Daniel Catz Project title: Small molecule regulators of vesicular trafficking to enhance lysosomal exocytosis
Inhibitory effect of dietary lipids on chaperonemediated
Inhibitory effect of dietary lipids on chaperonemediated autophagy Jose Antonio Rodriguez-Navarro a, Susmita Kaushik a, Hiroshi Koga a, Claudia Dall Armi b, Guanghou Shui c, Markus R. Wenk c, Gilbert Di
IP: anti-gfp VPS29-GFP. IP: anti-vps26. IP: anti-gfp - + +
FAM21 Strump. WASH1 IP: anti- 1 2 3 4 5 6 FAM21 Strump. FKBP IP: anti-gfp VPS29- GFP GFP-FAM21 tail H H/P P H H/P P c FAM21 FKBP Strump. VPS29-GFP IP: anti-gfp 1 2 3 FKBP VPS VPS VPS VPS29 1 = VPS29-GFP
control kda ATGL ATGLi HSL 82 GAPDH * ** *** WT/cTg WT/cTg ATGLi AKO/cTg AKO/cTg ATGLi WT/cTg WT/cTg ATGLi AKO/cTg AKO/cTg ATGLi iwat gwat ibat
body weight (g) tissue weights (mg) ATGL protein expression (relative to GAPDH) HSL protein expression (relative to GAPDH) ### # # kda ATGL 55 HSL 82 GAPDH 37 2.5 2. 1.5 1..5 2. 1.5 1..5.. Supplementary
Hypothalamic TLR2 triggers sickness behavior via a microglia-neuronal axis
Hypothalamic TLR triggers sickness behavior via a microglia-neuronal axis Sungho Jin, *, Jae Geun Kim,, *, Jeong Woo Park, Marco Koch,, Tamas L. Horvath and Byung Ju Lee Department of Biological Sciences,
Pathogenesis of Diabetes Mellitus
Pathogenesis of Diabetes Mellitus Young-Bum Kim, Ph.D. Associate Professor of Medicine Harvard Medical School Definition of Diabetes Mellitus a group of metabolic diseases characterized by hyperglycemia
SUPPLEMENTARY INFORMATION
Figure S1 Induction of non-apoptotic death of SV40-transformed and primary DKO MEFs, and DKO thymocytes. (A-F) STS-induced non-apoptotic death of DKO MEF. (A, B) Reduced viability of DKO MEFs after exposure
Resveratrol activates duodenal Sirt1 to reverse insulin resistance in rats through a neuronal network
Resveratrol activates duodenal Sirt1 to reverse insulin resistance in rats through a neuronal network Clémence D. Côté, Brittany A. Rasmussen, Frank A. Duca, Melika Zadeh-Tahmasebi, Joseph A. Baur, Mira
Effect of BI-1 on insulin resistance through regulation of CYP2E1
Effect of BI-1 on insulin resistance through regulation of CYP2E1 Geum-Hwa Lee 1, Kyoung-Jin Oh 2, 3, Hyung-Ryong Kim 4, Hye-Sook Han 2, Hwa-Young Lee 1, Keun-Gyu Park 5, Ki-Hoan Nam 6, Seung-Hoi Koo 2
SUPPLEMENTARY INFORMATION
DOI:.38/ncb2822 a MTC02 FAO cells EEA1 b +/+ MEFs /DAPI -/- MEFs /DAPI -/- MEFs //DAPI c HEK 293 cells WCE N M C P AKT TBC1D7 Lamin A/C EEA1 VDAC d HeLa cells WCE N M C P AKT Lamin A/C EEA1 VDAC Figure
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/8/407/ra127/dc1 Supplementary Materials for Loss of FTO in adipose tissue decreases Angptl4 translation and alters triglyceride metabolism Chao-Yung Wang,* Shian-Sen
TITLE: The Importance of Autophagy in Breast Cancer Development and Treatment
AD Award Number: W81XWH-06-1-0557 TITLE: The Importance of Autophagy in Breast Cancer Development and Treatment PRINCIPAL INVESTIGATOR: Jin-Ming Yang, Ph.D. CONTRACTING ORGANIZATION: University of Medicine
GPR120 *** * * Liver BAT iwat ewat mwat Ileum Colon. UCP1 mrna ***
a GPR120 GPR120 mrna/ppia mrna Arbitrary Units 150 100 50 Liver BAT iwat ewat mwat Ileum Colon b UCP1 mrna Fold induction 20 15 10 5 - camp camp SB202190 - - - H89 - - - - - GW7647 Supplementary Figure
University of Groningen. Non-alcoholic fatty liver disease Sheedfar, Fareeba
University of Groningen Non-alcoholic fatty liver disease Sheedfar, Fareeba IMPORTANT NOTE: You are advised to consult the publisher's version (publisher's PDF) if you wish to cite from it. Please check
FSP27 contributes to efficient energy storage in murine white adipocytes by promoting the formation of unilocular lipid droplets
Research article Related Commentary, page 2693 FSP27 contributes to efficient energy storage in murine white adipocytes by promoting the formation of unilocular lipid droplets Naonobu Nishino, 1 Yoshikazu
Nutrients, insulin and muscle wasting during critical illness
32 nd annual meeting of the Belgian Society of Intensive Care Medicine June 15, 212 Nutrients, insulin and muscle wasting during critical illness Sarah Derde Introduction Critical illness: feeding-resistant
Modifications of Pyruvate Handling in Health and Disease Prof. Mary Sugden
Modifications of Handling Modifications of Handling Centre for Diabetes and Metabolic Medicine Institute of Cell and Molecular Science Barts and the London School of Medicine and Dentistry 1 Potential
In The Name Of God. In The Name Of. EMRI Modeling Group
In The Name Of God In The Name Of God EMRI Modeling Group Cells work together in functionally related groups called tissues Types of tissues: Epithelial lining and covering Connective support Muscle movement
CNS Control of Food Intake. Adena Zadourian & Andrea Shelton
CNS Control of Food Intake Adena Zadourian & Andrea Shelton Controlling Food Intake Energy Homeostasis (Change in body adiposity + compensatory changes in food intake) Background Information/Review Insulin
Chikungunya virus-induced autophagy delays caspase-dependent cell death
Washington University School of Medicine Digital Commons@Becker Open Access Publications 2012 Chikungunya virus-induced autophagy delays caspase-dependent cell death Pierre-Emmanuel Joubert Institut Pasteur
WT MSD MPS-IIIA. Lysosomal ph
7 6 Lysosomal ph 5 4 3 2 1 Supplementary figure S1. Lysosomal ph was measure in, and MPSIIIA MEFs using a Lysosensor yellow/blue-dextran (Molecular Probes) as a lysosomal ph indicator (see methods). P
LESSON 3.3 WORKBOOK. How do we decide when and how much to eat?
Appetite The psychological desire to eat, driven by feelings of pleasure from the brain. Hunger The biological or physiological need to eat, caused by a release of hormones from the digestive tract. LESSON