About OMICS International Conferences
|
|
- Avice Gardner
- 5 years ago
- Views:
Transcription
1 About OMICS Group OMICS Group is an amalgamation of Open Access publications and worldwide international science conferences and events. Established in the year 2007 with the sole aim of making the information on Sciences and technology Open Access, OMICS Group publishes 500 online open access scholarly journals in all aspects of Science, Engineering, Management and Technology journals. OMICS Group has been instrumental in taking the knowledge on Science & technology to the doorsteps of ordinary men and women. Research Scholars, Students, Libraries, Educational Institutions, Research centers and the industry are main stakeholders that benefitted greatly from this knowledge dissemination. OMICS Group also organizes 500 International conferences annually across the globe, where knowledge transfer takes place through debates, round table discussions, poster presentations, workshops, symposia and exhibitions.
2 About OMICS International Conferences OMICS International is a pioneer and leading science event organizer, which publishes around 500 open access journals and conducts over 500 Medical, Clinical, Engineering, Life Sciences, Pharma scientific conferences all over the globe annually with the support of more than 1000 scientific associations and 30,000 editorial board members and 3.5 million followers to its credit. OMICS Group has organized 500 conferences, workshops and national symposiums across the major cities including San Francisco, Las Vegas, San Antonio, Omaha, Orlando, Raleigh, Santa Clara, Chicago, Philadelphia, Baltimore, United Kingdom, Valencia, Dubai, Beijing, Hyderabad, Bengaluru and Mumbai.
3 The phospholipid enzyme Pcyt2 is a new target for oxidative stress and heart disease Marica Bakovic Department of Human Health and Nutritional Sciences, University of Guelph, Guelph, ON, Canada August 2015
4 Kennedy Pathway DAG/TAG Pathway Ethanolamine G3P EK ATP FA GPAT P-Eth Pcyt2 CTP CDP-Eth DAG FA PAP LPA PA AGPAT EPT DGAT PE FA TAG Pcyt2 regulates DAG partitioning between PE and TAG
5 A. Pcyt2 Splicing Pcyt2β 74 ATG 1-6 Exon-skipping TGA 1486 Pcyt2α Pcyt2γ 85 ATG 57 ATG B. Pcyt2 Proteins GT TT 1-6 7a 8a Intron-retention N-Domain Linker C-Domain 1297 TGA 960 TGA Pcyt2 α Pcyt2 β HYGH 244 HIGH of Exon HYGH HIGH Pcyt2γ HYGH
6 N αd S282 S205 (223α) S197 (215α) αf αl αa αa αd αl αc αb S191 αe αe αb S145,T146 T147 C J Biol Chem 2014
7 Control 50 um Meclizine Meclizine Story 6h at 37C 80% Methanol extraction Separation and Identification of Metabolites by LC-MS Meclizine (RS)-1-[(4-chlorophenyl)(phenyl) methyl]-4-(3-methylbenzyl)piperazine J Biol Chem 2013
8 Meclizine is a non-competitive inhibitor of Pcyt2 with respect to CTP A B B 14 C-Etn (pmol) 14 C-PE (pm mol) Etn PEtn CDP-Etn Ctrl Mec Ctrl Mec Ctrl_6h Mec_6h Ctrl 24h Mec 24h C 250 D 1/[V] No inhibitor 30 µm Mec µm Mec µm Mec /[S]
9 linker Proteomics Pcyt2 α N-CAT spliced out in β C-CAT J Biol Chem 2014 Pcyt2 β N-CAT 192, 209, 195, 215, PKC 300, 308 C-CAT B. Pcyt2α shared [ P S 223 GKEP 227 ] 145, 157, 146, 162, , , A. Pcyt2α specific [ P S 192 EV P S 195 SQCPG 200 ] P S 223 P S 192 P S 195 (-Serum) (-Serum)
10 F. Pcyt2α phosphorylation with PKCα 207 GVSQFLQT p S 215 QKI 18 P S 215 (b1 11) (b1-8) = p S G. Pcyt2α phosphorylation with PKCα T p S 215 Q P S 215 (b1-4)-(b1-3)= p S A. PMA 0 30 min 1h 2h C. PMA PMA+GO6976 PMA+EGF-R p Ser p Ser Pcyt2 total Pcyt2 total B. Pyct2 enzyme activity (pmol/mg/min) min 1h 2h D. Pcyt2 enzyme activity (pmol/mg/min) PMA PMA+GO6976 PMA+EGF-R J Biol Chem 2014
11 A. Anti- P Ser Anti-V5 C. Pcyt2α S A PMA EGF-R Anti- P Ser Anti-V5 B. D. Endogenous Overexpressed Pcyt2 activity (pmol/mg/min) PMA (nm) J Biol Chem 2014
12 A Pcyt2 α N-Domain Linker C-Domain PKRRGIF of Exon Pcyt2 γ 291 RGD 293 B Pcyt2 α N Pcyt2 γ N C C Gene 2014
13 Pcyt2γ is a dominant negative isoform Pcyt2γ Pcyt2α Pcyt2β Ctrl Pcyt2γ 37kDa β-tubulin IP: Pcyt2γ IP: Pcyt2α Pcyt2α 50kDa Pcyt2γ 37 kda Pcyt2γ 37kDa Pcyt2α 50kDa Dimerization Pcyt2α Dimer (100kDa) Gene 2014
14 Mutants of active isoforms are also inhibitors Activity Pcyt2α Pcyt2α+H244Y Pcyt2α+H35Y 50kDa α-myc β-tubilin Dimerization Pcyt2α Pcyt2α Pcyt2α H244Y H35 Y Pcyt2α Pcyt2α +H244Y Pcyt2α + H35Y Pcyt2α+H244Y Pcyt2α+H244Y Pcyt2α+H35Y Pcyt2α+H35Y 224 bp Pcyt2α mrna 100kDa Gene 2014
15 Pcyt2α homodimers are active α α γ Heterodimers and aggregates are inactive α c γ γ? γ α γ α α γ γ γ Gene 2014
16 Pcyt2 deficient mouse ETKO 50 Male +/- Male +/+ We eight (g) P<0.05 Female +/- Female +/+ WT Pcyt2 +/ Time (wks) J Biol. Chem 2009
17 A. Pcyt2 +/+ Pcyt2 +/- B. Pcyt2 +/+ Pcyt2 +/- m rer LD m LD 1µm 1µm Liver fibrosis Electron microscopy of liver reatic islets Liver lipid droplets m m m 200µm 200µm C. Pcyt2 +/+ Pcyt2 +/- D. Pcyt2 +/+ Pcyt2 +/- Pancr E. 200µm 200µm 100µm 100µm Pcyt2 +/+ Pcyt2 +/- Mol Cell Biol 2015 Male hearts
18 p<0.05 p<0.05 mrna (fold change) mrna (fold change) Microarray analysis Mol Cell Biol 2015
19 Gender effect on ETKO heart genes A. Male Pcyt2+/+ Pcyt2+/- Female Pcyt2+/+ Pcyt2+/- B. p<0.05 Mct1 Ace1 Pgc1α Scd1 Arbitrary unit Arbitrary unit Pcyt2 +/+ Pcyt2 +/- Pcyt2 +/+ Pcyt2 +/- Gapdh Male Female C. D. E. p<0.01 Arbitrary unit p<0.05 Arbitrary unit p<0.001 Male Female Male Female Male Female Mol Cell Biol 2015
20 A PC/PE Ratio % Total PE Arbitrary units % Total PI Pcyt2: +/+ +/- +/+ +/- Male Female Pcyt2: +/+ +/- +/+ +/- Male Female Pcyt2: +/+ +/- +/+ +/- Male Female B. F atty acids (% Phospholipids) 16:0 18:0 18:1 18:2 22:6 Pcyt2 +/+ Pcyt2 +/- Pcyt2 +/+ Pcyt2 +/- Female Male C. Fatty acids (% TAG) 16:0 16:1 18:0 18:1 18:2 Pcyt2 +/- Female Pcyt2 +/+ Male Pcyt2 +/- Male Pcyt2 +/+ Female Heart Lipid Dimorphism Mol Cell Biol 2015
21 N-6 PUFA synthesis and oxidative stress % 18:2 n-6 A. Linoleic acid % 20:3 n-6 Dihomo γ linolenic acid B. % 22:3 n-6 Docosatrienoic acid Docosahesaneoic acid % 22:6 n-3 % 20:4 n-6 % 22:4 n-6 % 22:5 n-6 Male Female Male Female TAG mg/g Arachidonic acid Docosatetranoic acid Male Female Docosapentaneoic acid Male Female C. TBARS (µm) Heart Male Female TBARS (µm) Aorta Male Female Pcyt2+/+ Pcyt2+/- Mol Cell Biol 2015
22 Male Pcyt2 +/- Heart Female 20:3 20:4 22:3 22:4 23:4 PC/PE Fatty acids Cd36 Glut4 TAG Ace1 Mct1 Glucose PI3K pakt pampk Fatty acids Glucose Cd36 Glut4 PC/PE TAG PI3K pakt pampk Scd1 Mct1 Enriched in n-6 fatty acids Unmodified n-6 fatty acids Impaired heart function Hypertension, Hypertrophy Normal heart function Male-specific heart disease Mol Cell Biol 2015
23 Pulami Albert Maida Leanne Ratnesh Laila Zvezdan Sugash
24 Let Us Meet Again We welcome you all to our future conferences of OMICS International Please Visit: molecular-biology-conferences.php
About OMICS Group Conferences
About OMICS Group OMICS Group International is an amalgamation of Open Access publications and worldwide international science conferences and events. Established in the year 2007 with the sole aim of
More informationAbout OMICS Group Conferences
About OMICS Group OMICS Group International is an amalgamation of Open Access publications and worldwide international science conferences and events. Established in the year 2007 with the sole aim of
More informationAbout OMICS Group. OMICS Group International is an amalgamation of Open Access acetyl-coa
About OMICS Group OMICS Group International is an amalgamation of Open Access publications and worldwide international science conferences and events. Established in the year 27 with the sole aim of making
More informationAbout OMICS International Conferences
About OMICS Group OMICS Group International is an amalgamation of Open Access publications and worldwide international science conferences and events. Established in the year 2007 with the sole aim of
More informationAbout OMICS International Conferences
About OMICS Group OMICS Group is an amalgamation of Open Access publications and worldwide international science conferences and events. Established in the year 2007 with the sole aim of making the information
More informationAbout OMICS Group OMICS Group International is an amalgamation of Open Access publications and worldwide international science conferences and
About OMICS Group OMICS Group International is an amalgamation of Open Access publications and worldwide international science conferences and events. Established in the year 2007 with the sole aim of
More informationAbout OMICS Group Conferences
About OMICS Group OMICS Group International is an amalgamation of Open Access publications and worldwide international science conferences and events. Established in the year 2007 with the sole aim of
More informationOMICS International Conferences
About OMICS Group OMICS Group is an amalgamation of Open Access Publications and worldwide international science conferences and events. Established in the year 2007 with the sole aim of making the information
More informationAbout OMICS Group Conferences
About OMICS Group OMICS Group International is an amalgamation of Open Access publications and worldwide international science conferences and events. Established in the year 2007 with the sole aim of
More informationAbout OMICS Group Conferences
About OMICS Group OMICS Group International is an amalgamation of Open Access publications and worldwide international science conferences and events. Established in the year 2007 with the sole aim of
More informationAbout OMICS Group Conferences
About OMICS Group OMICS Group International is an amalgamation of Open Access publications and worldwide international science conferences and events. Established in the year 2007 with the sole aim of
More informationAbout OMICS International Conferences
About OMICS Group OMICS Group is an amalgamation of Open Access publications and worldwide international science conferences and events. Established in the year 2007 with the sole aim of making the information
More informationOMICS Group is an amalgamation of Open Access Publications and worldwide international science conferences and events. Established in the year 2007
* OMICS Group is an amalgamation of Open Access Publications and worldwide international science conferences and events. Established in the year 2007 with the sole aim of making the information on Sciences
More informationAbout OMICS Group Conferences
About OMICS Group OMICS Group International is an amalgamation of Open Access publications and worldwide international science conferences and events. Established in the year 27 with the sole aim of making
More informationAbout OMICS Group Conferences
About OMICS Group OMICS Group International is an amalgamation of Open Access publications and worldwide international science conferences and events. Established in the year 2007 with the sole aim of
More informationOMICS International Conferences
About OMICS Group OMICS Group is an amalgamation of Open Access Publications and worldwide international science conferences and events. Established in the year 2007 with the sole aim of making the information
More informationAbout OMICS International Conferences
About OMICS Group OMICS Group is an amalgamation of Open Access publications and worldwide international science conferences and events. Established in the year 2007 with the sole aim of making the information
More informationAbout OMICS Group Conferences
About OMICS Group OMICS Group International is an amalgamation ofopen Access publicationsand worldwide international science conferences and events. Established in the year 2007 with the sole aim of making
More informationAbout OMICS Group Conferences
About OMICS Group OMICS Group International is an amalgamation of Open Access publications and worldwide international science conferences and events. Established in the year 2007 with the sole aim of
More informationOMICS Group International is an amalgamation of Open Access publications
About OMICS Group OMICS Group International is an amalgamation of Open Access publications and worldwide international science conferences and events. Established in the year 2007 with the sole aim of
More informationAbout OMICS Group Conferences
About OMICS Group OMICS Group International is an amalgamation of Open Access publications and worldwide international science conferences and events. Established in the year 2007 with the sole aim of
More informationAbout OMICS Group Conferences
About OMICS Group OMICS Group International is an amalgamation of Open Access publications and worldwide international science conferences and events. Established in the year 2007 with the sole aim of
More informationAbout OMICS International Conferences
About OMICS Group OMICS Group is an amalgamation of Open Access publications and worldwide international science conferences and events. Established in the year 2007 with the sole aim of making the information
More informationOMICS International Conferences
About OMICS Group OMICS Group is an amalgamation of Open Access Publications and worldwide international science conferences and events. Established in the year 2007 with the sole aim of making the information
More informationAbout OMICS Group Conferences
About OMICS Group OMICS Group International is an amalgamation of Open Access publications and worldwide international science conferences and events. Established in the year 2007 with the sole aim of
More informationAbout OMICS Group Conferences
About OMICS Group OMICS Group International is an amalgamation of Open Access publications and worldwide international science conferences and events. Established in the year 2007 with the sole aim of
More informationAbout OMICS Group. Prof Dr. Abdalla Omar
About OMICS Group OMICS Group is an amalgamation of Open Access Publications and worldwide international science conferences and events. Established in the year 2007 with the sole aim of making the information
More informationAbout OMICS International Conferences
About OMICS Group OMICS Group International is an amalgamation of Open Access publications and worldwide international science conferences and events. Established in the year 2007 with the sole aim of
More informationOMICS INTERNATIONAL CONFERENCES
1 ABOUT OMICS GROUP OMICS Group is an amalgamation of Open Access Publications and worldwide international science conferences and events. Established in the year 2007 with the sole aim of making the information
More informationAbout OMICS Group Conferences
About OMICS Group OMICS Group International is an amalgamation of Open Access publications and worldwide international science conferences and events. Established in the year 2007 with the sole aim of
More informationAbout OMICS International Conferences
About OMICS Group OMICS Group is an amalgamation of Open Access publications and worldwide international science conferences and events. Established in the year 2007 with the sole aim of making the information
More informationAbout OMICS Group Conferences
About OMICS Group OMICS Group International is an amalgamation of Open Access publications and worldwide international science conferences and events. Established in the year 2007 with the sole aim of
More informationAbout OMICS Group. events. Established in the year 2007 with the sole aim of making the information on Sciences and technology Open Access, OMICS
About OMICS Group OMICS Group International is an amalgamation of Open Access publications and worldwide international science conferences and events. Established in the year 2007 with the sole aim of
More informationAbout OMICS Group Conferences
About OMICS Group OMICS Group International is an amalgamation of Open Access publications and worldwide international science conferences and events. Established in the year 2007 with the sole aim of
More informationAbout OMICS Group Conferences
About OMICS Group OMICS Group International is an amalgamation of Open Access publications and worldwide international science conferences and events. Established in the year 2007 with the sole aim of
More informationAbout OMICS Group Conferences
About MICS Group MICS Group International is an amalgamation of pen Access publications and worldwide international science conferences and events. Established in the year 2007 with the sole aim of making
More informationAbout OMICS International Conferences
About OMICS Group OMICS Group is an amalgamation of Open Access publications and worldwide international science conferences and events. Established in the year 2007 with the sole aim of making the information
More informationRegulation of Lipid Homeostasis: Lipid Droplets
Regulation of Lipid Homeostasis: Lipid Droplets Bernd Helms Article Brand Recter Hendrik Mertens 1 The Basics I: FAs The Basics II: FA Activation 2 Basics III: TG-FA Interplay. Why? Adipocytes 3 Foam cells
More informationAbout OMICS Group Conferences
About OMICS Group OMICS Group International is an amalgamation of Open Access publications and worldwide international science conferences and events. Established in the year 2007 with the sole aim of
More informationMaster class Biomolecular Sciences Molecular Cell Biology.
Master class Biomolecular Sciences Molecular Cell Biology. 04-09-08: Paul van Bergen en Henegouwen. Clathrin-indep Endocytosis 11-09-08: Willem Stoorvogel. Endocytosis and MHC classii 18-09-08: X-track
More informationABOUT OMICS INTERNATIONAL CONFERENCES
ABOUT OMICS GROUP OMICS Group is an amalgamation of Open Access publications and worldwide international science conferences and events. Established in the year 2007 with the sole aim of making the information
More informationE3 ligase TRIM72 negatively regulates myogenesis by IRS-1 ubiquitination
E3 ligase negatively regulates myogenesis by IRS-1 ubiquitination Young-Gyu Ko College of Life Science and Biotechnology Korea University MyHC immunofluorescence Lipid rafts are plasma membrane compartments
More informationSynthesis and elongation of fatty acids
Synthesis and elongation of fatty acids A molecular caliper mechanism for determining very long-chain fatty acid length Vladimir Denic and Jonathan S. Weissman (2007) Cell 130, 663-677 February 28, 2008
More informationSupplementary Figure 1
A B D Relative TAp73 mrna p73 Supplementary Figure 1 25 2 15 1 5 p63 _-tub. MDA-468 HCC1143 HCC38 SUM149 MDA-468 HCC1143 HCC38 SUM149 HCC-1937 MDA-MB-468 ΔNp63_ TAp73_ TAp73β E C Relative ΔNp63 mrna TAp73
More informationZL ZDF ZDF + E2 *** Visceral (g) ZDF
Body Weight (g) 4 3 2 1 ** * ZL ZDF 6 8 1 12 14 16 Age (weeks) B * Sub-cutaneous (g) 16 12 8 4 ZL ZDF Visceral (g) 25 2 15 1 5 ZL ZDF Total fat pad weight (g) 4 3 2 1 ZDF ZL Supplemental Figure 1: Effect
More informationSupplementary Figure 1
Supplementary Figure 1 A B mir-141, human cell lines mir-2c, human cell lines mir-141, hepatocytes mir-2c, hepatocytes Relative RNA.1.8.6.4.2 Relative RNA.3.2.1 Relative RNA 1.5 1..5 Relative RNA 2. 1.5
More informationSupplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells
Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells (b). TRIM33 was immunoprecipitated, and the amount of
More informationSupplemental Table 1 Primer sequences (mouse) used for real-time qrt-pcr studies
Supplemental Table 1 Primer sequences (mouse) used for real-time qrt-pcr studies Gene symbol Forward primer Reverse primer ACC1 5'-TGAGGAGGACCGCATTTATC 5'-GCATGGAATGGCAGTAAGGT ACLY 5'-GACACCATCTGTGATCTTG
More informationGenetic modification of microalgae for the sustainable production of high value products
Rothamsted Research where knowledge grows Genetic modification of microalgae for the sustainable production of high value products Olga Sayanova 9 May 2016 Cambridge Metabolic Engineering of Microalgae
More informationHIV VPR alters fat metabolism. Dorothy E Lewis PhD/Ashok Balasubramanyam MD
HIV VPR alters fat metabolism Dorothy E Lewis PhD/Ashok Balasubramanyam MD Old Dogma for HIV associated lipodystrophy Differentiation Block (PI) Lipoatrophy Apoptosis (NRTI) Stem cell Preadipocyte Adipocyte
More informationSupplementary Figure 1. AdipoR1 silencing and overexpression controls. (a) Representative blots (upper and lower panels) showing the AdipoR1 protein
Supplementary Figure 1. AdipoR1 silencing and overexpression controls. (a) Representative blots (upper and lower panels) showing the AdipoR1 protein content relative to GAPDH in two independent experiments.
More informationGPR120 *** * * Liver BAT iwat ewat mwat Ileum Colon. UCP1 mrna ***
a GPR120 GPR120 mrna/ppia mrna Arbitrary Units 150 100 50 Liver BAT iwat ewat mwat Ileum Colon b UCP1 mrna Fold induction 20 15 10 5 - camp camp SB202190 - - - H89 - - - - - GW7647 Supplementary Figure
More informationANSC/NUTR 618 LIPIDS & LIPID METABOLISM. Triacylglycerol and Fatty Acid Metabolism
ANSC/NUTR 618 LIPIDS & LIPID METABOLISM II. Triacylglycerol synthesis A. Overall pathway Glycerol-3-phosphate + 3 Fatty acyl-coa à Triacylglycerol + 3 CoASH B. Enzymes 1. Acyl-CoA synthase 2. Glycerol-phosphate
More informationPhospho-AKT Sampler Kit
Phospho-AKT Sampler Kit E 0 5 1 0 0 3 Kits Includes Cat. Quantity Application Reactivity Source Akt (Ab-473) Antibody E021054-1 50μg/50μl IHC, WB Human, Mouse, Rat Rabbit Akt (Phospho-Ser473) Antibody
More informationA Central Role of MG53 in Metabolic Syndrome. and Type-2 Diabetes
A Central Role of MG53 in Metabolic Syndrome and Type-2 Diabetes Yan Zhang, Chunmei Cao, Rui-Ping Xiao Institute of Molecular Medicine (IMM) Peking University, Beijing, China Accelerated Aging in China
More informationLIPID METABOLISM
LIPID METABOLISM LIPOGENESIS LIPOGENESIS LIPOGENESIS FATTY ACID SYNTHESIS DE NOVO FFA in the blood come from :- (a) Dietary fat (b) Dietary carbohydrate/protein in excess of need FA TAG Site of synthesis:-
More informationTargeting MAT2A in MTAP-deleted Cancers
Targeting MAT2A in MTAP-deleted Cancers Presented at the American Association for Cancer Research (AACR) Annual Meeting, April 14-18, 2018, Chicago, IL, USA 1 Acknowledgements Agios 2017 Founders Day Retreat
More informationALM301: Allosteric Isoform selective Akt inhibitor
ALM301: Allosteric Isoform selective Akt inhibitor Background Akt1/2 selective inhibitors ALM301 Back-up compounds Akt2 selective inhibitors Approaches to Akt Inhibition Both ATP competitive and allosteric
More informationc Ischemia (30 min) Reperfusion (8 w) Supplementary Figure bp 300 bp Ischemia (30 min) Reperfusion (4 h) Dox 20 mg/kg i.p.
a Marker Ripk3 +/ 5 bp 3 bp b Ischemia (3 min) Reperfusion (4 h) d 2 mg/kg i.p. 1 w 5 w Sacrifice for IF size A subset for echocardiography and morphological analysis c Ischemia (3 min) Reperfusion (8
More informationSuppl. Figure 1. T 3 induces autophagic flux in hepatic cells. (A) RFP-GFP-LC3 transfected HepG2/TRα cells were visualized and cells were quantified
Suppl. Figure 1. T 3 induces autophagic flux in hepatic cells. (A) RFP-GFP-LC3 transfected HepG2/TRα cells were visualized and cells were quantified for RFP-LC3 puncta (red dots) representing both autolysosomes
More informationSUPPLEMENTARY INFORMATION
DOI:.38/ncb2822 a MTC02 FAO cells EEA1 b +/+ MEFs /DAPI -/- MEFs /DAPI -/- MEFs //DAPI c HEK 293 cells WCE N M C P AKT TBC1D7 Lamin A/C EEA1 VDAC d HeLa cells WCE N M C P AKT Lamin A/C EEA1 VDAC Figure
More informationA Hepatocyte Growth Factor Receptor (Met) Insulin Receptor hybrid governs hepatic glucose metabolism SUPPLEMENTARY FIGURES, LEGENDS AND METHODS
A Hepatocyte Growth Factor Receptor (Met) Insulin Receptor hybrid governs hepatic glucose metabolism Arlee Fafalios, Jihong Ma, Xinping Tan, John Stoops, Jianhua Luo, Marie C. DeFrances and Reza Zarnegar
More informationModifications of Pyruvate Handling in Health and Disease Prof. Mary Sugden
Modifications of Handling Modifications of Handling Centre for Diabetes and Metabolic Medicine Institute of Cell and Molecular Science Barts and the London School of Medicine and Dentistry 1 Potential
More informationTumor suppressor Spred2 interaction with LC3 promotes autophagosome maturation and induces autophagy-dependent cell death
www.impactjournals.com/oncotarget/ Oncotarget, Supplementary Materials 2016 Tumor suppressor Spred2 interaction with LC3 promotes autophagosome maturation and induces autophagy-dependent cell death Supplementary
More informationGene Polymorphisms and Carbohydrate Diets. James M. Ntambi Ph.D
Gene Polymorphisms and Carbohydrate Diets James M. Ntambi Ph.D Fatty Acids that Flux into Tissue Lipids are from Dietary Sources or are Made De novo from Glucose or Fructose Glucose Fructose Acetyl-CoA
More informationRegulation of Phosphatidylethanolamine Homeostasis The Critical Role of CTP:Phosphoethanolamine Cytidylyltransferase (Pcyt2)
Int. J. Mol. Sci. 2013, 14, 2529-2550; doi:10.3390/ijms14022529 Review OPEN ACCESS International Journal of Molecular Sciences ISSN 1422-0067 www.mdpi.com/journal/ijms Regulation of Phosphatidylethanolamine
More informationSupporting Information. Supporting Tables. S-Table 1 Primer pairs for RT-PCR. Product size. Gene Primer pairs
Supporting Information Supporting Tables S-Table 1 Primer pairs for RT-PCR. Gene Primer pairs Product size (bp) FAS F: 5 TCTTGGAAGCGATGGGTA 3 429 R: 5 GGGATGTATCATTCTTGGAC 3 SREBP-1c F: 5 CGCTACCGTTCCTCTATCA
More information18s AAACGGCTACCACATCCAAG CCTCCAATGGATCCTCGTTA. 36b4 GTTCTTGCCCATCAGCACC AGATGCAGCAGATCCGCAT. Acc1 AGCAGATCCGCAGCTTG ACCTCTGCTCGCTGAGTGC
Supplementary Table 1. Quantitative PCR primer sequences Gene symbol Sequences (5 to 3 ) Forward Reverse 18s AAACGGCTACCACATCCAAG CCTCCAATGGATCCTCGTTA 36b4 GTTCTTGCCCATCAGCACC AGATGCAGCAGATCCGCAT Acc1
More informationSupplementary Materials
Supplementary Materials 1 Supplementary Table 1. List of primers used for quantitative PCR analysis. Gene name Gene symbol Accession IDs Sequence range Product Primer sequences size (bp) β-actin Actb gi
More informationAnti-Inflammatory Effects of Fish Oils
Anti-Inflammatory Effects of Fish Oils A. Macrophage Production of Eicosanoids B. w-3 PUFA Supplementation of Macrophages C. w-3 PUFA in IR & diabetes Oswald Quehenberger Departments of Medicine and Pharmacology
More informationAAV-TBGp-Cre treatment resulted in hepatocyte-specific GH receptor gene recombination
AAV-TBGp-Cre treatment resulted in hepatocyte-specific GH receptor gene recombination Supplementary Figure 1. Generation of the adult-onset, liver-specific GH receptor knock-down (alivghrkd, Kd) mouse
More informationComplexity DNA. Genome RNA. Transcriptome. Protein. Proteome. Metabolites. Metabolome
DNA Genome Complexity RNA Transcriptome Systems Biology Linking all the components of a cell in a quantitative and temporal manner Protein Proteome Metabolites Metabolome Where are the functional elements?
More informationWhat would you observe if you fused a G1 cell with a S cell? A. Mitotic and pulverized chromosomes. B. Mitotic and compact G1 chromosomes.
What would you observe if you fused a G1 cell with a S cell? A. Mitotic and pulverized chromosomes. B. Mitotic and compact G1 chromosomes. C. Mostly non-compact G1 chromosomes. D. Compact G1 and G2 chromosomes.
More informationMichigan/Chicago unit
Michigan/Chicago unit Modifications in Mouse Models to Enhance Nephropathy/Neuropathy- GLUT1 overexpression Increased oxidative stress Increased glucose metabolic flux or alteration in GLUT expression
More informationGrowth and Differentiation Phosphorylation Sampler Kit
Growth and Differentiation Phosphorylation Sampler Kit E 0 5 1 0 1 4 Kits Includes Cat. Quantity Application Reactivity Source Akt (Phospho-Ser473) E011054-1 50μg/50μl IHC, WB Human, Mouse, Rat Rabbit
More informationA Normal Exencephaly Craniora- Spina bifida Microcephaly chischisis. Midbrain Forebrain/ Forebrain/ Hindbrain Spinal cord Hindbrain Hindbrain
A Normal Exencephaly Craniora- Spina bifida Microcephaly chischisis NTD Number of embryos % among NTD Embryos Exencephaly 52 74.3% Craniorachischisis 6 8.6% Spina bifida 5 7.1% Microcephaly 7 1% B Normal
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION FOR Liver X Receptor α mediates hepatic triglyceride accumulation through upregulation of G0/G1 Switch Gene 2 (G0S2) expression I: SUPPLEMENTARY METHODS II: SUPPLEMENTARY FIGURES
More informationSupplemental information
Supplemental information PI(3)K p11δ controls the sucellular compartmentalization of TLR4 signaling and protects from endotoxic shock Ezra Aksoy, Salma Taoui, David Torres, Sandrine Delauve, Aderrahman
More informationT H E J O U R N A L O F C E L L B I O L O G Y
Supplemental material Jewell et al., http://www.jcb.org/cgi/content/full/jcb.201007176/dc1 T H E J O U R N A L O F C E L L B I O L O G Y Figure S1. IR Munc18c association is independent of IRS-1. (A and
More informationChapter 26 Biochemistry 5th edition. phospholipids. Sphingolipids. Cholesterol. db=books&itool=toolbar
http://www.ncbi.nlm.nih.gov/sites/entrez? db=books&itool=toolbar 1 The surface of a soap bubble is a bilayer formed by detergent molecules 2 Chapter 26 Biochemistry 5th edition phospholipids Sphingolipids
More information1 Corresponding author: Hideo Shindou, Department of Biochemistry and Molecular Biology,
Recent progress on Acyl-CoA:lysophospholipid acyltransferase research* Hideo Shindou 1, Daisuke Hishikawa, Takeshi Harayama, Koichi Yuki, and Takao Shimizu From the Department of Biochemistry and Molecular
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2211 a! mir-143! b! mir-103/107! let-7a! mir-144! mir-122a! mir-126-3p! mir-194! mir-27a! mir-30c! Figure S1 Northern blot analysis of mir-143 expression dependent on feeding conditions.
More informationInsulin Resistance. Biol 405 Molecular Medicine
Insulin Resistance Biol 405 Molecular Medicine Insulin resistance: a subnormal biological response to insulin. Defects of either insulin secretion or insulin action can cause diabetes mellitus. Insulin-dependent
More informationFuel the Failing Heart: glucose or fatty acids? Rong Tian, MD, PhD Mitochondria and Metabolism Center University of Washington, Seattle
Fuel the Failing Heart: glucose or fatty acids? Rong Tian, MD, PhD Mitochondria and Metabolism Center University of Washington, Seattle Metabolic Remodeling: Fatty Acids Carbohydrates PCr/ATP Glucose vs.
More informationDietary α-linolenic acid-rich flaxseed oil prevents against alcoholic hepatic steatosis
Dietary α-linolenic acid-rich flaxseed oil prevents against alcoholic hepatic steatosis via ameliorating lipid homeostasis at adipose tissue-liver axis in mice Meng Wang a, Xiao-Jing Zhang a, Kun Feng
More informationSynthesis and Biological Evaluation of Protein Kinase D Inhibitors
Synthesis and Biological Evaluation of Protein Kinase D Inhibitors Celeste Alverez Topic Seminar October 26, 2013 Celeste Alverez @ Wipf Group 10/26/2013 1 Protein Kinase D (PKD) A novel family of serine/threonine
More informationHmgcoar AGCTTGCCCGAATTGTATGTG TCTGTTGTAACCATGTGACTTC. Cyp7α GGGATTGCTGTGGTAGTGAGC GGTATGGAATCAACCCGTTGTC
Supplement Table I: primers for Real Time RT-PCR Gene Foward Reverse Hmgcoar AGCTTGCCCGAATTGTATGTG TCTGTTGTAACCATGTGACTTC Cyp7α GGGATTGCTGTGGTAGTGAGC GGTATGGAATCAACCCGTTGTC Cyp27a1 GTGGTCTTATTGGGTACTTGC
More informationExendin-4-mediated cell proliferation in beta-cells: focusing on the transcription factors
Exendin-4-mediated cell proliferation in beta-cells: focusing on the transcription factors Seo-Yoon Chang, Jae Min Cho, Yang-Hyeok Jo, Myung-Jun Kim Departments of Physiology, College of Medicine, The
More informationTHE HALLMARKS OF CANCER
THE HALLMARKS OF CANCER ONCOGENES - Most of the oncogenes were first identified in retroviruses: EGFR (ErbB), Src, Ras, Myc, PI3K and others (slightly more than 30) - Mutated cellular genes incorporated
More informationBIOL212 Biochemistry of Disease. Metabolic Disorders - Obesity
BIOL212 Biochemistry of Disease Metabolic Disorders - Obesity Obesity Approx. 23% of adults are obese in the U.K. The number of obese children has tripled in 20 years. 10% of six year olds are obese, rising
More informationBoosting lipid productivity of the oleaginous microalga N. gaditana via genome engineering
Boosting lipid productivity of the oleaginous microalga N. gaditana via genome engineering Imad Ajjawi, John Verruto, Moena Aqui, Eric Moellering and Robert Brown October 25th 216 Outline n Brief intro
More informationWolff-Parkinson-White Syndrome and PRKAG2
Wolff-Parkinson-White Syndrome and PRKAG2 Maggie Beatka University of Wisconsin-Madison http://www.beatmap.net/portfolio-detail/human-cardiovascular-system-3drenderings/ What causes Wolff-Parkinson-White?
More informationMouse Meda-4 : chromosome 5G bp. EST (547bp) _at. 5 -Meda4 inner race (~1.8Kb)
Supplemental.Figure1 A: Mouse Meda-4 : chromosome 5G3 19898bp I II III III IV V a b c d 5 RACE outer primer 5 RACE inner primer 5 RACE Adaptor ORF:912bp Meda4 cdna 2846bp Meda4 specific 5 outer primer
More informationA. List of selected proteins with high SILAC (H/L) ratios identified in mass
Supplementary material Figure S1. Interaction between UBL5 and FANCI A. List of selected proteins with high SILAC (H/L) ratios identified in mass spectrometry (MS)-based analysis of UBL5-interacting proteins,
More informationAppendix Table of Contents. 1. Appendix Figure legends S1-S13 and Appendix Table S1 and S2. 2. Appendix Figures S1-S13
Appendix Table of Contents. Appendix Figure legends S-S3 and Appendix Table S and S. Appendix Figures S-S3 . Appendix Figure legends S-S3 and Appendix Table S and S Appendix Figure S. Western blot analysis
More informationSynthesis of Fatty Acids and Triacylglycerol
Synthesis of Fatty Acids and Triacylglycerol Lippincott s Chapter 16 Fatty Acid Synthesis Mainly in the Liver Requires Carbon Source: Acetyl CoA Reducing Power: NADPH 8 CH 3 COO C 15 H 33 COO Energy Input:
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/10/471/eaah5085/dc1 Supplementary Materials for Phosphorylation of the exocyst protein Exo84 by TBK1 promotes insulin-stimulated GLUT4 trafficking Maeran Uhm,
More informationstable I. Diet Ingredients Diet Group (g/100 g Dry Weight) High!-3 Low!-3 High!-6 Variable diet fat Palm oil Olive oil Safflower oil 0
stable I. Diet Ingredients Ingredient Diet Group (g/100 g Dry Weight) High!-3 Low!-3 High!-6 Variable diet fat Palm oil 8 10 6.5 Olive oil 3 0 0 Safflower oil 0 3 6.5 EPA 1 1 0 0 DHA 1 1 0 0 Fixed diet
More informationEXTENDED DATA FORMATTING GUIDE
EXTENDED DATA FORMATTING GUIDE Nature paper but are included online within the full-text HTML and at the end of the online PDF. Nature separate panel (for example, see Extended Data Figure 2, panel d)
More information