About OMICS International Conferences

Size: px
Start display at page:

Download "About OMICS International Conferences"

Transcription

1 About OMICS Group OMICS Group is an amalgamation of Open Access publications and worldwide international science conferences and events. Established in the year 2007 with the sole aim of making the information on Sciences and technology Open Access, OMICS Group publishes 500 online open access scholarly journals in all aspects of Science, Engineering, Management and Technology journals. OMICS Group has been instrumental in taking the knowledge on Science & technology to the doorsteps of ordinary men and women. Research Scholars, Students, Libraries, Educational Institutions, Research centers and the industry are main stakeholders that benefitted greatly from this knowledge dissemination. OMICS Group also organizes 500 International conferences annually across the globe, where knowledge transfer takes place through debates, round table discussions, poster presentations, workshops, symposia and exhibitions.

2 About OMICS International Conferences OMICS International is a pioneer and leading science event organizer, which publishes around 500 open access journals and conducts over 500 Medical, Clinical, Engineering, Life Sciences, Pharma scientific conferences all over the globe annually with the support of more than 1000 scientific associations and 30,000 editorial board members and 3.5 million followers to its credit. OMICS Group has organized 500 conferences, workshops and national symposiums across the major cities including San Francisco, Las Vegas, San Antonio, Omaha, Orlando, Raleigh, Santa Clara, Chicago, Philadelphia, Baltimore, United Kingdom, Valencia, Dubai, Beijing, Hyderabad, Bengaluru and Mumbai.

3 The phospholipid enzyme Pcyt2 is a new target for oxidative stress and heart disease Marica Bakovic Department of Human Health and Nutritional Sciences, University of Guelph, Guelph, ON, Canada August 2015

4 Kennedy Pathway DAG/TAG Pathway Ethanolamine G3P EK ATP FA GPAT P-Eth Pcyt2 CTP CDP-Eth DAG FA PAP LPA PA AGPAT EPT DGAT PE FA TAG Pcyt2 regulates DAG partitioning between PE and TAG

5 A. Pcyt2 Splicing Pcyt2β 74 ATG 1-6 Exon-skipping TGA 1486 Pcyt2α Pcyt2γ 85 ATG 57 ATG B. Pcyt2 Proteins GT TT 1-6 7a 8a Intron-retention N-Domain Linker C-Domain 1297 TGA 960 TGA Pcyt2 α Pcyt2 β HYGH 244 HIGH of Exon HYGH HIGH Pcyt2γ HYGH

6 N αd S282 S205 (223α) S197 (215α) αf αl αa αa αd αl αc αb S191 αe αe αb S145,T146 T147 C J Biol Chem 2014

7 Control 50 um Meclizine Meclizine Story 6h at 37C 80% Methanol extraction Separation and Identification of Metabolites by LC-MS Meclizine (RS)-1-[(4-chlorophenyl)(phenyl) methyl]-4-(3-methylbenzyl)piperazine J Biol Chem 2013

8 Meclizine is a non-competitive inhibitor of Pcyt2 with respect to CTP A B B 14 C-Etn (pmol) 14 C-PE (pm mol) Etn PEtn CDP-Etn Ctrl Mec Ctrl Mec Ctrl_6h Mec_6h Ctrl 24h Mec 24h C 250 D 1/[V] No inhibitor 30 µm Mec µm Mec µm Mec /[S]

9 linker Proteomics Pcyt2 α N-CAT spliced out in β C-CAT J Biol Chem 2014 Pcyt2 β N-CAT 192, 209, 195, 215, PKC 300, 308 C-CAT B. Pcyt2α shared [ P S 223 GKEP 227 ] 145, 157, 146, 162, , , A. Pcyt2α specific [ P S 192 EV P S 195 SQCPG 200 ] P S 223 P S 192 P S 195 (-Serum) (-Serum)

10 F. Pcyt2α phosphorylation with PKCα 207 GVSQFLQT p S 215 QKI 18 P S 215 (b1 11) (b1-8) = p S G. Pcyt2α phosphorylation with PKCα T p S 215 Q P S 215 (b1-4)-(b1-3)= p S A. PMA 0 30 min 1h 2h C. PMA PMA+GO6976 PMA+EGF-R p Ser p Ser Pcyt2 total Pcyt2 total B. Pyct2 enzyme activity (pmol/mg/min) min 1h 2h D. Pcyt2 enzyme activity (pmol/mg/min) PMA PMA+GO6976 PMA+EGF-R J Biol Chem 2014

11 A. Anti- P Ser Anti-V5 C. Pcyt2α S A PMA EGF-R Anti- P Ser Anti-V5 B. D. Endogenous Overexpressed Pcyt2 activity (pmol/mg/min) PMA (nm) J Biol Chem 2014

12 A Pcyt2 α N-Domain Linker C-Domain PKRRGIF of Exon Pcyt2 γ 291 RGD 293 B Pcyt2 α N Pcyt2 γ N C C Gene 2014

13 Pcyt2γ is a dominant negative isoform Pcyt2γ Pcyt2α Pcyt2β Ctrl Pcyt2γ 37kDa β-tubulin IP: Pcyt2γ IP: Pcyt2α Pcyt2α 50kDa Pcyt2γ 37 kda Pcyt2γ 37kDa Pcyt2α 50kDa Dimerization Pcyt2α Dimer (100kDa) Gene 2014

14 Mutants of active isoforms are also inhibitors Activity Pcyt2α Pcyt2α+H244Y Pcyt2α+H35Y 50kDa α-myc β-tubilin Dimerization Pcyt2α Pcyt2α Pcyt2α H244Y H35 Y Pcyt2α Pcyt2α +H244Y Pcyt2α + H35Y Pcyt2α+H244Y Pcyt2α+H244Y Pcyt2α+H35Y Pcyt2α+H35Y 224 bp Pcyt2α mrna 100kDa Gene 2014

15 Pcyt2α homodimers are active α α γ Heterodimers and aggregates are inactive α c γ γ? γ α γ α α γ γ γ Gene 2014

16 Pcyt2 deficient mouse ETKO 50 Male +/- Male +/+ We eight (g) P<0.05 Female +/- Female +/+ WT Pcyt2 +/ Time (wks) J Biol. Chem 2009

17 A. Pcyt2 +/+ Pcyt2 +/- B. Pcyt2 +/+ Pcyt2 +/- m rer LD m LD 1µm 1µm Liver fibrosis Electron microscopy of liver reatic islets Liver lipid droplets m m m 200µm 200µm C. Pcyt2 +/+ Pcyt2 +/- D. Pcyt2 +/+ Pcyt2 +/- Pancr E. 200µm 200µm 100µm 100µm Pcyt2 +/+ Pcyt2 +/- Mol Cell Biol 2015 Male hearts

18 p<0.05 p<0.05 mrna (fold change) mrna (fold change) Microarray analysis Mol Cell Biol 2015

19 Gender effect on ETKO heart genes A. Male Pcyt2+/+ Pcyt2+/- Female Pcyt2+/+ Pcyt2+/- B. p<0.05 Mct1 Ace1 Pgc1α Scd1 Arbitrary unit Arbitrary unit Pcyt2 +/+ Pcyt2 +/- Pcyt2 +/+ Pcyt2 +/- Gapdh Male Female C. D. E. p<0.01 Arbitrary unit p<0.05 Arbitrary unit p<0.001 Male Female Male Female Male Female Mol Cell Biol 2015

20 A PC/PE Ratio % Total PE Arbitrary units % Total PI Pcyt2: +/+ +/- +/+ +/- Male Female Pcyt2: +/+ +/- +/+ +/- Male Female Pcyt2: +/+ +/- +/+ +/- Male Female B. F atty acids (% Phospholipids) 16:0 18:0 18:1 18:2 22:6 Pcyt2 +/+ Pcyt2 +/- Pcyt2 +/+ Pcyt2 +/- Female Male C. Fatty acids (% TAG) 16:0 16:1 18:0 18:1 18:2 Pcyt2 +/- Female Pcyt2 +/+ Male Pcyt2 +/- Male Pcyt2 +/+ Female Heart Lipid Dimorphism Mol Cell Biol 2015

21 N-6 PUFA synthesis and oxidative stress % 18:2 n-6 A. Linoleic acid % 20:3 n-6 Dihomo γ linolenic acid B. % 22:3 n-6 Docosatrienoic acid Docosahesaneoic acid % 22:6 n-3 % 20:4 n-6 % 22:4 n-6 % 22:5 n-6 Male Female Male Female TAG mg/g Arachidonic acid Docosatetranoic acid Male Female Docosapentaneoic acid Male Female C. TBARS (µm) Heart Male Female TBARS (µm) Aorta Male Female Pcyt2+/+ Pcyt2+/- Mol Cell Biol 2015

22 Male Pcyt2 +/- Heart Female 20:3 20:4 22:3 22:4 23:4 PC/PE Fatty acids Cd36 Glut4 TAG Ace1 Mct1 Glucose PI3K pakt pampk Fatty acids Glucose Cd36 Glut4 PC/PE TAG PI3K pakt pampk Scd1 Mct1 Enriched in n-6 fatty acids Unmodified n-6 fatty acids Impaired heart function Hypertension, Hypertrophy Normal heart function Male-specific heart disease Mol Cell Biol 2015

23 Pulami Albert Maida Leanne Ratnesh Laila Zvezdan Sugash

24 Let Us Meet Again We welcome you all to our future conferences of OMICS International Please Visit: molecular-biology-conferences.php

About OMICS Group Conferences

About OMICS Group Conferences About OMICS Group OMICS Group International is an amalgamation of Open Access publications and worldwide international science conferences and events. Established in the year 2007 with the sole aim of

More information

About OMICS Group Conferences

About OMICS Group Conferences About OMICS Group OMICS Group International is an amalgamation of Open Access publications and worldwide international science conferences and events. Established in the year 2007 with the sole aim of

More information

About OMICS Group. OMICS Group International is an amalgamation of Open Access acetyl-coa

About OMICS Group. OMICS Group International is an amalgamation of Open Access acetyl-coa About OMICS Group OMICS Group International is an amalgamation of Open Access publications and worldwide international science conferences and events. Established in the year 27 with the sole aim of making

More information

About OMICS International Conferences

About OMICS International Conferences About OMICS Group OMICS Group International is an amalgamation of Open Access publications and worldwide international science conferences and events. Established in the year 2007 with the sole aim of

More information

About OMICS International Conferences

About OMICS International Conferences About OMICS Group OMICS Group is an amalgamation of Open Access publications and worldwide international science conferences and events. Established in the year 2007 with the sole aim of making the information

More information

About OMICS Group OMICS Group International is an amalgamation of Open Access publications and worldwide international science conferences and

About OMICS Group OMICS Group International is an amalgamation of Open Access publications and worldwide international science conferences and About OMICS Group OMICS Group International is an amalgamation of Open Access publications and worldwide international science conferences and events. Established in the year 2007 with the sole aim of

More information

About OMICS Group Conferences

About OMICS Group Conferences About OMICS Group OMICS Group International is an amalgamation of Open Access publications and worldwide international science conferences and events. Established in the year 2007 with the sole aim of

More information

OMICS International Conferences

OMICS International Conferences About OMICS Group OMICS Group is an amalgamation of Open Access Publications and worldwide international science conferences and events. Established in the year 2007 with the sole aim of making the information

More information

About OMICS Group Conferences

About OMICS Group Conferences About OMICS Group OMICS Group International is an amalgamation of Open Access publications and worldwide international science conferences and events. Established in the year 2007 with the sole aim of

More information

About OMICS Group Conferences

About OMICS Group Conferences About OMICS Group OMICS Group International is an amalgamation of Open Access publications and worldwide international science conferences and events. Established in the year 2007 with the sole aim of

More information

About OMICS Group Conferences

About OMICS Group Conferences About OMICS Group OMICS Group International is an amalgamation of Open Access publications and worldwide international science conferences and events. Established in the year 2007 with the sole aim of

More information

About OMICS International Conferences

About OMICS International Conferences About OMICS Group OMICS Group is an amalgamation of Open Access publications and worldwide international science conferences and events. Established in the year 2007 with the sole aim of making the information

More information

OMICS Group is an amalgamation of Open Access Publications and worldwide international science conferences and events. Established in the year 2007

OMICS Group is an amalgamation of Open Access Publications and worldwide international science conferences and events. Established in the year 2007 * OMICS Group is an amalgamation of Open Access Publications and worldwide international science conferences and events. Established in the year 2007 with the sole aim of making the information on Sciences

More information

About OMICS Group Conferences

About OMICS Group Conferences About OMICS Group OMICS Group International is an amalgamation of Open Access publications and worldwide international science conferences and events. Established in the year 27 with the sole aim of making

More information

About OMICS Group Conferences

About OMICS Group Conferences About OMICS Group OMICS Group International is an amalgamation of Open Access publications and worldwide international science conferences and events. Established in the year 2007 with the sole aim of

More information

OMICS International Conferences

OMICS International Conferences About OMICS Group OMICS Group is an amalgamation of Open Access Publications and worldwide international science conferences and events. Established in the year 2007 with the sole aim of making the information

More information

About OMICS International Conferences

About OMICS International Conferences About OMICS Group OMICS Group is an amalgamation of Open Access publications and worldwide international science conferences and events. Established in the year 2007 with the sole aim of making the information

More information

About OMICS Group Conferences

About OMICS Group Conferences About OMICS Group OMICS Group International is an amalgamation ofopen Access publicationsand worldwide international science conferences and events. Established in the year 2007 with the sole aim of making

More information

About OMICS Group Conferences

About OMICS Group Conferences About OMICS Group OMICS Group International is an amalgamation of Open Access publications and worldwide international science conferences and events. Established in the year 2007 with the sole aim of

More information

OMICS Group International is an amalgamation of Open Access publications

OMICS Group International is an amalgamation of Open Access publications About OMICS Group OMICS Group International is an amalgamation of Open Access publications and worldwide international science conferences and events. Established in the year 2007 with the sole aim of

More information

About OMICS Group Conferences

About OMICS Group Conferences About OMICS Group OMICS Group International is an amalgamation of Open Access publications and worldwide international science conferences and events. Established in the year 2007 with the sole aim of

More information

About OMICS Group Conferences

About OMICS Group Conferences About OMICS Group OMICS Group International is an amalgamation of Open Access publications and worldwide international science conferences and events. Established in the year 2007 with the sole aim of

More information

About OMICS International Conferences

About OMICS International Conferences About OMICS Group OMICS Group is an amalgamation of Open Access publications and worldwide international science conferences and events. Established in the year 2007 with the sole aim of making the information

More information

OMICS International Conferences

OMICS International Conferences About OMICS Group OMICS Group is an amalgamation of Open Access Publications and worldwide international science conferences and events. Established in the year 2007 with the sole aim of making the information

More information

About OMICS Group Conferences

About OMICS Group Conferences About OMICS Group OMICS Group International is an amalgamation of Open Access publications and worldwide international science conferences and events. Established in the year 2007 with the sole aim of

More information

About OMICS Group Conferences

About OMICS Group Conferences About OMICS Group OMICS Group International is an amalgamation of Open Access publications and worldwide international science conferences and events. Established in the year 2007 with the sole aim of

More information

About OMICS Group. Prof Dr. Abdalla Omar

About OMICS Group. Prof Dr. Abdalla Omar About OMICS Group OMICS Group is an amalgamation of Open Access Publications and worldwide international science conferences and events. Established in the year 2007 with the sole aim of making the information

More information

About OMICS International Conferences

About OMICS International Conferences About OMICS Group OMICS Group International is an amalgamation of Open Access publications and worldwide international science conferences and events. Established in the year 2007 with the sole aim of

More information

OMICS INTERNATIONAL CONFERENCES

OMICS INTERNATIONAL CONFERENCES 1 ABOUT OMICS GROUP OMICS Group is an amalgamation of Open Access Publications and worldwide international science conferences and events. Established in the year 2007 with the sole aim of making the information

More information

About OMICS Group Conferences

About OMICS Group Conferences About OMICS Group OMICS Group International is an amalgamation of Open Access publications and worldwide international science conferences and events. Established in the year 2007 with the sole aim of

More information

About OMICS International Conferences

About OMICS International Conferences About OMICS Group OMICS Group is an amalgamation of Open Access publications and worldwide international science conferences and events. Established in the year 2007 with the sole aim of making the information

More information

About OMICS Group Conferences

About OMICS Group Conferences About OMICS Group OMICS Group International is an amalgamation of Open Access publications and worldwide international science conferences and events. Established in the year 2007 with the sole aim of

More information

About OMICS Group. events. Established in the year 2007 with the sole aim of making the information on Sciences and technology Open Access, OMICS

About OMICS Group. events. Established in the year 2007 with the sole aim of making the information on Sciences and technology Open Access, OMICS About OMICS Group OMICS Group International is an amalgamation of Open Access publications and worldwide international science conferences and events. Established in the year 2007 with the sole aim of

More information

About OMICS Group Conferences

About OMICS Group Conferences About OMICS Group OMICS Group International is an amalgamation of Open Access publications and worldwide international science conferences and events. Established in the year 2007 with the sole aim of

More information

About OMICS Group Conferences

About OMICS Group Conferences About OMICS Group OMICS Group International is an amalgamation of Open Access publications and worldwide international science conferences and events. Established in the year 2007 with the sole aim of

More information

About OMICS Group Conferences

About OMICS Group Conferences About MICS Group MICS Group International is an amalgamation of pen Access publications and worldwide international science conferences and events. Established in the year 2007 with the sole aim of making

More information

About OMICS International Conferences

About OMICS International Conferences About OMICS Group OMICS Group is an amalgamation of Open Access publications and worldwide international science conferences and events. Established in the year 2007 with the sole aim of making the information

More information

Regulation of Lipid Homeostasis: Lipid Droplets

Regulation of Lipid Homeostasis: Lipid Droplets Regulation of Lipid Homeostasis: Lipid Droplets Bernd Helms Article Brand Recter Hendrik Mertens 1 The Basics I: FAs The Basics II: FA Activation 2 Basics III: TG-FA Interplay. Why? Adipocytes 3 Foam cells

More information

About OMICS Group Conferences

About OMICS Group Conferences About OMICS Group OMICS Group International is an amalgamation of Open Access publications and worldwide international science conferences and events. Established in the year 2007 with the sole aim of

More information

Master class Biomolecular Sciences Molecular Cell Biology.

Master class Biomolecular Sciences Molecular Cell Biology. Master class Biomolecular Sciences Molecular Cell Biology. 04-09-08: Paul van Bergen en Henegouwen. Clathrin-indep Endocytosis 11-09-08: Willem Stoorvogel. Endocytosis and MHC classii 18-09-08: X-track

More information

ABOUT OMICS INTERNATIONAL CONFERENCES

ABOUT OMICS INTERNATIONAL CONFERENCES ABOUT OMICS GROUP OMICS Group is an amalgamation of Open Access publications and worldwide international science conferences and events. Established in the year 2007 with the sole aim of making the information

More information

E3 ligase TRIM72 negatively regulates myogenesis by IRS-1 ubiquitination

E3 ligase TRIM72 negatively regulates myogenesis by IRS-1 ubiquitination E3 ligase negatively regulates myogenesis by IRS-1 ubiquitination Young-Gyu Ko College of Life Science and Biotechnology Korea University MyHC immunofluorescence Lipid rafts are plasma membrane compartments

More information

Synthesis and elongation of fatty acids

Synthesis and elongation of fatty acids Synthesis and elongation of fatty acids A molecular caliper mechanism for determining very long-chain fatty acid length Vladimir Denic and Jonathan S. Weissman (2007) Cell 130, 663-677 February 28, 2008

More information

Supplementary Figure 1

Supplementary Figure 1 A B D Relative TAp73 mrna p73 Supplementary Figure 1 25 2 15 1 5 p63 _-tub. MDA-468 HCC1143 HCC38 SUM149 MDA-468 HCC1143 HCC38 SUM149 HCC-1937 MDA-MB-468 ΔNp63_ TAp73_ TAp73β E C Relative ΔNp63 mrna TAp73

More information

ZL ZDF ZDF + E2 *** Visceral (g) ZDF

ZL ZDF ZDF + E2 *** Visceral (g) ZDF Body Weight (g) 4 3 2 1 ** * ZL ZDF 6 8 1 12 14 16 Age (weeks) B * Sub-cutaneous (g) 16 12 8 4 ZL ZDF Visceral (g) 25 2 15 1 5 ZL ZDF Total fat pad weight (g) 4 3 2 1 ZDF ZL Supplemental Figure 1: Effect

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 A B mir-141, human cell lines mir-2c, human cell lines mir-141, hepatocytes mir-2c, hepatocytes Relative RNA.1.8.6.4.2 Relative RNA.3.2.1 Relative RNA 1.5 1..5 Relative RNA 2. 1.5

More information

Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells

Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells (b). TRIM33 was immunoprecipitated, and the amount of

More information

Supplemental Table 1 Primer sequences (mouse) used for real-time qrt-pcr studies

Supplemental Table 1 Primer sequences (mouse) used for real-time qrt-pcr studies Supplemental Table 1 Primer sequences (mouse) used for real-time qrt-pcr studies Gene symbol Forward primer Reverse primer ACC1 5'-TGAGGAGGACCGCATTTATC 5'-GCATGGAATGGCAGTAAGGT ACLY 5'-GACACCATCTGTGATCTTG

More information

Genetic modification of microalgae for the sustainable production of high value products

Genetic modification of microalgae for the sustainable production of high value products Rothamsted Research where knowledge grows Genetic modification of microalgae for the sustainable production of high value products Olga Sayanova 9 May 2016 Cambridge Metabolic Engineering of Microalgae

More information

HIV VPR alters fat metabolism. Dorothy E Lewis PhD/Ashok Balasubramanyam MD

HIV VPR alters fat metabolism. Dorothy E Lewis PhD/Ashok Balasubramanyam MD HIV VPR alters fat metabolism Dorothy E Lewis PhD/Ashok Balasubramanyam MD Old Dogma for HIV associated lipodystrophy Differentiation Block (PI) Lipoatrophy Apoptosis (NRTI) Stem cell Preadipocyte Adipocyte

More information

Supplementary Figure 1. AdipoR1 silencing and overexpression controls. (a) Representative blots (upper and lower panels) showing the AdipoR1 protein

Supplementary Figure 1. AdipoR1 silencing and overexpression controls. (a) Representative blots (upper and lower panels) showing the AdipoR1 protein Supplementary Figure 1. AdipoR1 silencing and overexpression controls. (a) Representative blots (upper and lower panels) showing the AdipoR1 protein content relative to GAPDH in two independent experiments.

More information

GPR120 *** * * Liver BAT iwat ewat mwat Ileum Colon. UCP1 mrna ***

GPR120 *** * * Liver BAT iwat ewat mwat Ileum Colon. UCP1 mrna *** a GPR120 GPR120 mrna/ppia mrna Arbitrary Units 150 100 50 Liver BAT iwat ewat mwat Ileum Colon b UCP1 mrna Fold induction 20 15 10 5 - camp camp SB202190 - - - H89 - - - - - GW7647 Supplementary Figure

More information

ANSC/NUTR 618 LIPIDS & LIPID METABOLISM. Triacylglycerol and Fatty Acid Metabolism

ANSC/NUTR 618 LIPIDS & LIPID METABOLISM. Triacylglycerol and Fatty Acid Metabolism ANSC/NUTR 618 LIPIDS & LIPID METABOLISM II. Triacylglycerol synthesis A. Overall pathway Glycerol-3-phosphate + 3 Fatty acyl-coa à Triacylglycerol + 3 CoASH B. Enzymes 1. Acyl-CoA synthase 2. Glycerol-phosphate

More information

Phospho-AKT Sampler Kit

Phospho-AKT Sampler Kit Phospho-AKT Sampler Kit E 0 5 1 0 0 3 Kits Includes Cat. Quantity Application Reactivity Source Akt (Ab-473) Antibody E021054-1 50μg/50μl IHC, WB Human, Mouse, Rat Rabbit Akt (Phospho-Ser473) Antibody

More information

A Central Role of MG53 in Metabolic Syndrome. and Type-2 Diabetes

A Central Role of MG53 in Metabolic Syndrome. and Type-2 Diabetes A Central Role of MG53 in Metabolic Syndrome and Type-2 Diabetes Yan Zhang, Chunmei Cao, Rui-Ping Xiao Institute of Molecular Medicine (IMM) Peking University, Beijing, China Accelerated Aging in China

More information

LIPID METABOLISM

LIPID METABOLISM LIPID METABOLISM LIPOGENESIS LIPOGENESIS LIPOGENESIS FATTY ACID SYNTHESIS DE NOVO FFA in the blood come from :- (a) Dietary fat (b) Dietary carbohydrate/protein in excess of need FA TAG Site of synthesis:-

More information

Targeting MAT2A in MTAP-deleted Cancers

Targeting MAT2A in MTAP-deleted Cancers Targeting MAT2A in MTAP-deleted Cancers Presented at the American Association for Cancer Research (AACR) Annual Meeting, April 14-18, 2018, Chicago, IL, USA 1 Acknowledgements Agios 2017 Founders Day Retreat

More information

ALM301: Allosteric Isoform selective Akt inhibitor

ALM301: Allosteric Isoform selective Akt inhibitor ALM301: Allosteric Isoform selective Akt inhibitor Background Akt1/2 selective inhibitors ALM301 Back-up compounds Akt2 selective inhibitors Approaches to Akt Inhibition Both ATP competitive and allosteric

More information

c Ischemia (30 min) Reperfusion (8 w) Supplementary Figure bp 300 bp Ischemia (30 min) Reperfusion (4 h) Dox 20 mg/kg i.p.

c Ischemia (30 min) Reperfusion (8 w) Supplementary Figure bp 300 bp Ischemia (30 min) Reperfusion (4 h) Dox 20 mg/kg i.p. a Marker Ripk3 +/ 5 bp 3 bp b Ischemia (3 min) Reperfusion (4 h) d 2 mg/kg i.p. 1 w 5 w Sacrifice for IF size A subset for echocardiography and morphological analysis c Ischemia (3 min) Reperfusion (8

More information

Suppl. Figure 1. T 3 induces autophagic flux in hepatic cells. (A) RFP-GFP-LC3 transfected HepG2/TRα cells were visualized and cells were quantified

Suppl. Figure 1. T 3 induces autophagic flux in hepatic cells. (A) RFP-GFP-LC3 transfected HepG2/TRα cells were visualized and cells were quantified Suppl. Figure 1. T 3 induces autophagic flux in hepatic cells. (A) RFP-GFP-LC3 transfected HepG2/TRα cells were visualized and cells were quantified for RFP-LC3 puncta (red dots) representing both autolysosomes

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI:.38/ncb2822 a MTC02 FAO cells EEA1 b +/+ MEFs /DAPI -/- MEFs /DAPI -/- MEFs //DAPI c HEK 293 cells WCE N M C P AKT TBC1D7 Lamin A/C EEA1 VDAC d HeLa cells WCE N M C P AKT Lamin A/C EEA1 VDAC Figure

More information

A Hepatocyte Growth Factor Receptor (Met) Insulin Receptor hybrid governs hepatic glucose metabolism SUPPLEMENTARY FIGURES, LEGENDS AND METHODS

A Hepatocyte Growth Factor Receptor (Met) Insulin Receptor hybrid governs hepatic glucose metabolism SUPPLEMENTARY FIGURES, LEGENDS AND METHODS A Hepatocyte Growth Factor Receptor (Met) Insulin Receptor hybrid governs hepatic glucose metabolism Arlee Fafalios, Jihong Ma, Xinping Tan, John Stoops, Jianhua Luo, Marie C. DeFrances and Reza Zarnegar

More information

Modifications of Pyruvate Handling in Health and Disease Prof. Mary Sugden

Modifications of Pyruvate Handling in Health and Disease Prof. Mary Sugden Modifications of Handling Modifications of Handling Centre for Diabetes and Metabolic Medicine Institute of Cell and Molecular Science Barts and the London School of Medicine and Dentistry 1 Potential

More information

Tumor suppressor Spred2 interaction with LC3 promotes autophagosome maturation and induces autophagy-dependent cell death

Tumor suppressor Spred2 interaction with LC3 promotes autophagosome maturation and induces autophagy-dependent cell death www.impactjournals.com/oncotarget/ Oncotarget, Supplementary Materials 2016 Tumor suppressor Spred2 interaction with LC3 promotes autophagosome maturation and induces autophagy-dependent cell death Supplementary

More information

Gene Polymorphisms and Carbohydrate Diets. James M. Ntambi Ph.D

Gene Polymorphisms and Carbohydrate Diets. James M. Ntambi Ph.D Gene Polymorphisms and Carbohydrate Diets James M. Ntambi Ph.D Fatty Acids that Flux into Tissue Lipids are from Dietary Sources or are Made De novo from Glucose or Fructose Glucose Fructose Acetyl-CoA

More information

Regulation of Phosphatidylethanolamine Homeostasis The Critical Role of CTP:Phosphoethanolamine Cytidylyltransferase (Pcyt2)

Regulation of Phosphatidylethanolamine Homeostasis The Critical Role of CTP:Phosphoethanolamine Cytidylyltransferase (Pcyt2) Int. J. Mol. Sci. 2013, 14, 2529-2550; doi:10.3390/ijms14022529 Review OPEN ACCESS International Journal of Molecular Sciences ISSN 1422-0067 www.mdpi.com/journal/ijms Regulation of Phosphatidylethanolamine

More information

Supporting Information. Supporting Tables. S-Table 1 Primer pairs for RT-PCR. Product size. Gene Primer pairs

Supporting Information. Supporting Tables. S-Table 1 Primer pairs for RT-PCR. Product size. Gene Primer pairs Supporting Information Supporting Tables S-Table 1 Primer pairs for RT-PCR. Gene Primer pairs Product size (bp) FAS F: 5 TCTTGGAAGCGATGGGTA 3 429 R: 5 GGGATGTATCATTCTTGGAC 3 SREBP-1c F: 5 CGCTACCGTTCCTCTATCA

More information

18s AAACGGCTACCACATCCAAG CCTCCAATGGATCCTCGTTA. 36b4 GTTCTTGCCCATCAGCACC AGATGCAGCAGATCCGCAT. Acc1 AGCAGATCCGCAGCTTG ACCTCTGCTCGCTGAGTGC

18s AAACGGCTACCACATCCAAG CCTCCAATGGATCCTCGTTA. 36b4 GTTCTTGCCCATCAGCACC AGATGCAGCAGATCCGCAT. Acc1 AGCAGATCCGCAGCTTG ACCTCTGCTCGCTGAGTGC Supplementary Table 1. Quantitative PCR primer sequences Gene symbol Sequences (5 to 3 ) Forward Reverse 18s AAACGGCTACCACATCCAAG CCTCCAATGGATCCTCGTTA 36b4 GTTCTTGCCCATCAGCACC AGATGCAGCAGATCCGCAT Acc1

More information

Supplementary Materials

Supplementary Materials Supplementary Materials 1 Supplementary Table 1. List of primers used for quantitative PCR analysis. Gene name Gene symbol Accession IDs Sequence range Product Primer sequences size (bp) β-actin Actb gi

More information

Anti-Inflammatory Effects of Fish Oils

Anti-Inflammatory Effects of Fish Oils Anti-Inflammatory Effects of Fish Oils A. Macrophage Production of Eicosanoids B. w-3 PUFA Supplementation of Macrophages C. w-3 PUFA in IR & diabetes Oswald Quehenberger Departments of Medicine and Pharmacology

More information

AAV-TBGp-Cre treatment resulted in hepatocyte-specific GH receptor gene recombination

AAV-TBGp-Cre treatment resulted in hepatocyte-specific GH receptor gene recombination AAV-TBGp-Cre treatment resulted in hepatocyte-specific GH receptor gene recombination Supplementary Figure 1. Generation of the adult-onset, liver-specific GH receptor knock-down (alivghrkd, Kd) mouse

More information

Complexity DNA. Genome RNA. Transcriptome. Protein. Proteome. Metabolites. Metabolome

Complexity DNA. Genome RNA. Transcriptome. Protein. Proteome. Metabolites. Metabolome DNA Genome Complexity RNA Transcriptome Systems Biology Linking all the components of a cell in a quantitative and temporal manner Protein Proteome Metabolites Metabolome Where are the functional elements?

More information

What would you observe if you fused a G1 cell with a S cell? A. Mitotic and pulverized chromosomes. B. Mitotic and compact G1 chromosomes.

What would you observe if you fused a G1 cell with a S cell? A. Mitotic and pulverized chromosomes. B. Mitotic and compact G1 chromosomes. What would you observe if you fused a G1 cell with a S cell? A. Mitotic and pulverized chromosomes. B. Mitotic and compact G1 chromosomes. C. Mostly non-compact G1 chromosomes. D. Compact G1 and G2 chromosomes.

More information

Michigan/Chicago unit

Michigan/Chicago unit Michigan/Chicago unit Modifications in Mouse Models to Enhance Nephropathy/Neuropathy- GLUT1 overexpression Increased oxidative stress Increased glucose metabolic flux or alteration in GLUT expression

More information

Growth and Differentiation Phosphorylation Sampler Kit

Growth and Differentiation Phosphorylation Sampler Kit Growth and Differentiation Phosphorylation Sampler Kit E 0 5 1 0 1 4 Kits Includes Cat. Quantity Application Reactivity Source Akt (Phospho-Ser473) E011054-1 50μg/50μl IHC, WB Human, Mouse, Rat Rabbit

More information

A Normal Exencephaly Craniora- Spina bifida Microcephaly chischisis. Midbrain Forebrain/ Forebrain/ Hindbrain Spinal cord Hindbrain Hindbrain

A Normal Exencephaly Craniora- Spina bifida Microcephaly chischisis. Midbrain Forebrain/ Forebrain/ Hindbrain Spinal cord Hindbrain Hindbrain A Normal Exencephaly Craniora- Spina bifida Microcephaly chischisis NTD Number of embryos % among NTD Embryos Exencephaly 52 74.3% Craniorachischisis 6 8.6% Spina bifida 5 7.1% Microcephaly 7 1% B Normal

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION FOR Liver X Receptor α mediates hepatic triglyceride accumulation through upregulation of G0/G1 Switch Gene 2 (G0S2) expression I: SUPPLEMENTARY METHODS II: SUPPLEMENTARY FIGURES

More information

Supplemental information

Supplemental information Supplemental information PI(3)K p11δ controls the sucellular compartmentalization of TLR4 signaling and protects from endotoxic shock Ezra Aksoy, Salma Taoui, David Torres, Sandrine Delauve, Aderrahman

More information

T H E J O U R N A L O F C E L L B I O L O G Y

T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Jewell et al., http://www.jcb.org/cgi/content/full/jcb.201007176/dc1 T H E J O U R N A L O F C E L L B I O L O G Y Figure S1. IR Munc18c association is independent of IRS-1. (A and

More information

Chapter 26 Biochemistry 5th edition. phospholipids. Sphingolipids. Cholesterol. db=books&itool=toolbar

Chapter 26 Biochemistry 5th edition. phospholipids. Sphingolipids. Cholesterol.   db=books&itool=toolbar http://www.ncbi.nlm.nih.gov/sites/entrez? db=books&itool=toolbar 1 The surface of a soap bubble is a bilayer formed by detergent molecules 2 Chapter 26 Biochemistry 5th edition phospholipids Sphingolipids

More information

1 Corresponding author: Hideo Shindou, Department of Biochemistry and Molecular Biology,

1 Corresponding author: Hideo Shindou, Department of Biochemistry and Molecular Biology, Recent progress on Acyl-CoA:lysophospholipid acyltransferase research* Hideo Shindou 1, Daisuke Hishikawa, Takeshi Harayama, Koichi Yuki, and Takao Shimizu From the Department of Biochemistry and Molecular

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 10.1038/ncb2211 a! mir-143! b! mir-103/107! let-7a! mir-144! mir-122a! mir-126-3p! mir-194! mir-27a! mir-30c! Figure S1 Northern blot analysis of mir-143 expression dependent on feeding conditions.

More information

Insulin Resistance. Biol 405 Molecular Medicine

Insulin Resistance. Biol 405 Molecular Medicine Insulin Resistance Biol 405 Molecular Medicine Insulin resistance: a subnormal biological response to insulin. Defects of either insulin secretion or insulin action can cause diabetes mellitus. Insulin-dependent

More information

Fuel the Failing Heart: glucose or fatty acids? Rong Tian, MD, PhD Mitochondria and Metabolism Center University of Washington, Seattle

Fuel the Failing Heart: glucose or fatty acids? Rong Tian, MD, PhD Mitochondria and Metabolism Center University of Washington, Seattle Fuel the Failing Heart: glucose or fatty acids? Rong Tian, MD, PhD Mitochondria and Metabolism Center University of Washington, Seattle Metabolic Remodeling: Fatty Acids Carbohydrates PCr/ATP Glucose vs.

More information

Dietary α-linolenic acid-rich flaxseed oil prevents against alcoholic hepatic steatosis

Dietary α-linolenic acid-rich flaxseed oil prevents against alcoholic hepatic steatosis Dietary α-linolenic acid-rich flaxseed oil prevents against alcoholic hepatic steatosis via ameliorating lipid homeostasis at adipose tissue-liver axis in mice Meng Wang a, Xiao-Jing Zhang a, Kun Feng

More information

Synthesis and Biological Evaluation of Protein Kinase D Inhibitors

Synthesis and Biological Evaluation of Protein Kinase D Inhibitors Synthesis and Biological Evaluation of Protein Kinase D Inhibitors Celeste Alverez Topic Seminar October 26, 2013 Celeste Alverez @ Wipf Group 10/26/2013 1 Protein Kinase D (PKD) A novel family of serine/threonine

More information

Hmgcoar AGCTTGCCCGAATTGTATGTG TCTGTTGTAACCATGTGACTTC. Cyp7α GGGATTGCTGTGGTAGTGAGC GGTATGGAATCAACCCGTTGTC

Hmgcoar AGCTTGCCCGAATTGTATGTG TCTGTTGTAACCATGTGACTTC. Cyp7α GGGATTGCTGTGGTAGTGAGC GGTATGGAATCAACCCGTTGTC Supplement Table I: primers for Real Time RT-PCR Gene Foward Reverse Hmgcoar AGCTTGCCCGAATTGTATGTG TCTGTTGTAACCATGTGACTTC Cyp7α GGGATTGCTGTGGTAGTGAGC GGTATGGAATCAACCCGTTGTC Cyp27a1 GTGGTCTTATTGGGTACTTGC

More information

Exendin-4-mediated cell proliferation in beta-cells: focusing on the transcription factors

Exendin-4-mediated cell proliferation in beta-cells: focusing on the transcription factors Exendin-4-mediated cell proliferation in beta-cells: focusing on the transcription factors Seo-Yoon Chang, Jae Min Cho, Yang-Hyeok Jo, Myung-Jun Kim Departments of Physiology, College of Medicine, The

More information

THE HALLMARKS OF CANCER

THE HALLMARKS OF CANCER THE HALLMARKS OF CANCER ONCOGENES - Most of the oncogenes were first identified in retroviruses: EGFR (ErbB), Src, Ras, Myc, PI3K and others (slightly more than 30) - Mutated cellular genes incorporated

More information

BIOL212 Biochemistry of Disease. Metabolic Disorders - Obesity

BIOL212 Biochemistry of Disease. Metabolic Disorders - Obesity BIOL212 Biochemistry of Disease Metabolic Disorders - Obesity Obesity Approx. 23% of adults are obese in the U.K. The number of obese children has tripled in 20 years. 10% of six year olds are obese, rising

More information

Boosting lipid productivity of the oleaginous microalga N. gaditana via genome engineering

Boosting lipid productivity of the oleaginous microalga N. gaditana via genome engineering Boosting lipid productivity of the oleaginous microalga N. gaditana via genome engineering Imad Ajjawi, John Verruto, Moena Aqui, Eric Moellering and Robert Brown October 25th 216 Outline n Brief intro

More information

Wolff-Parkinson-White Syndrome and PRKAG2

Wolff-Parkinson-White Syndrome and PRKAG2 Wolff-Parkinson-White Syndrome and PRKAG2 Maggie Beatka University of Wisconsin-Madison http://www.beatmap.net/portfolio-detail/human-cardiovascular-system-3drenderings/ What causes Wolff-Parkinson-White?

More information

Mouse Meda-4 : chromosome 5G bp. EST (547bp) _at. 5 -Meda4 inner race (~1.8Kb)

Mouse Meda-4 : chromosome 5G bp. EST (547bp) _at. 5 -Meda4 inner race (~1.8Kb) Supplemental.Figure1 A: Mouse Meda-4 : chromosome 5G3 19898bp I II III III IV V a b c d 5 RACE outer primer 5 RACE inner primer 5 RACE Adaptor ORF:912bp Meda4 cdna 2846bp Meda4 specific 5 outer primer

More information

A. List of selected proteins with high SILAC (H/L) ratios identified in mass

A. List of selected proteins with high SILAC (H/L) ratios identified in mass Supplementary material Figure S1. Interaction between UBL5 and FANCI A. List of selected proteins with high SILAC (H/L) ratios identified in mass spectrometry (MS)-based analysis of UBL5-interacting proteins,

More information

Appendix Table of Contents. 1. Appendix Figure legends S1-S13 and Appendix Table S1 and S2. 2. Appendix Figures S1-S13

Appendix Table of Contents. 1. Appendix Figure legends S1-S13 and Appendix Table S1 and S2. 2. Appendix Figures S1-S13 Appendix Table of Contents. Appendix Figure legends S-S3 and Appendix Table S and S. Appendix Figures S-S3 . Appendix Figure legends S-S3 and Appendix Table S and S Appendix Figure S. Western blot analysis

More information

Synthesis of Fatty Acids and Triacylglycerol

Synthesis of Fatty Acids and Triacylglycerol Synthesis of Fatty Acids and Triacylglycerol Lippincott s Chapter 16 Fatty Acid Synthesis Mainly in the Liver Requires Carbon Source: Acetyl CoA Reducing Power: NADPH 8 CH 3 COO C 15 H 33 COO Energy Input:

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/10/471/eaah5085/dc1 Supplementary Materials for Phosphorylation of the exocyst protein Exo84 by TBK1 promotes insulin-stimulated GLUT4 trafficking Maeran Uhm,

More information

stable I. Diet Ingredients Diet Group (g/100 g Dry Weight) High!-3 Low!-3 High!-6 Variable diet fat Palm oil Olive oil Safflower oil 0

stable I. Diet Ingredients Diet Group (g/100 g Dry Weight) High!-3 Low!-3 High!-6 Variable diet fat Palm oil Olive oil Safflower oil 0 stable I. Diet Ingredients Ingredient Diet Group (g/100 g Dry Weight) High!-3 Low!-3 High!-6 Variable diet fat Palm oil 8 10 6.5 Olive oil 3 0 0 Safflower oil 0 3 6.5 EPA 1 1 0 0 DHA 1 1 0 0 Fixed diet

More information

EXTENDED DATA FORMATTING GUIDE

EXTENDED DATA FORMATTING GUIDE EXTENDED DATA FORMATTING GUIDE Nature paper but are included online within the full-text HTML and at the end of the online PDF. Nature separate panel (for example, see Extended Data Figure 2, panel d)

More information