Novel Reduction of PCSK9 Expression: Mechanistic Insights into the Anti-Atherosclerotic & Hypolipidemic Effects of Heat Shock Protein 27

From Biology to Therapy The biology of PCSK9 in humans Just LDL-cholesterol or more? May 24th. Dr. Gilles Lambert

Dr. Gilles Lambert Associate Professor in Cell Biology University of Nantes Medical School Group Leader, Laboratory of Nutrition and Metabolism, University Hospital of Nantes From Biology to Therapy The

Metabolism and Atherogenic Properties of LDL

Metabolism and Atherogenic Properties of LDL Manfredi Rizzo, MD, PhD Associate Professor of Internal Medicine Faculty of Medicine, University of Palermo, Italy & Affiliate Associate Professor of Internal

2.5. AMPK activity

Supplement Fig. A 3 B phos-ampk 2.5 * Control AICAR AMPK AMPK activity (Absorbance at 45 nm) 2.5.5 Control AICAR Supplement Fig. Effects of AICAR on AMPK activation in macrophages. J774. macrophages were

High density lipoprotein metabolism

High density lipoprotein metabolism Lipoprotein classes and atherosclerosis Chylomicrons, VLDL, and their catabolic remnants Pro-atherogenic LDL HDL Anti-atherogenic Plasma lipid transport Liver VLDL FC

Pathophysiology of Lipid Disorders

Pathophysiology of Lipid Disorders Henry Ginsberg, M.D. Division of Preventive Medicine and Nutrition CHD in the United States CHD is the single largest killer of men and women 12 million have history

ANSC/NUTR 618 LIPIDS & LIPID METABOLISM The LDL Receptor, LDL Uptake, and the Free Cholesterol Pool

ANSC/NUTR 618 LIPIDS & LIPID METABOLISM The, LDL Uptake, and the Free Cholesterol Pool I. Michael Brown and Joseph Goldstein A. Studied families with familial hypercholesterolemia. B. Defined the relationship

Lipid Metabolism in Familial Hypercholesterolemia

Lipid Metabolism in Familial Hypercholesterolemia Khalid Al-Rasadi, BSc, MD, FRCPC Head of Biochemistry Department, SQU Head of Lipid and LDL-Apheresis Unit, SQUH President of Oman society of Lipid & Atherosclerosis

Lipid metabolism in familial hypercholesterolemia

Lipid metabolism in familial hypercholesterolemia Khalid Al-Rasadi, BSc, MD, FRCPC Head of Biochemistry Department, SQU Head of Lipid and LDL-Apheresis Unit, SQUH President of Oman society of Lipid & Atherosclerosis

Role of apolipoprotein B-containing lipoproteins in the development of atherosclerosis Jan Borén MD, PhD

Role of apolipoprotein B-containing lipoproteins in the development of atherosclerosis Jan Borén MD, PhD Our laboratory focuses on the role of apolipoprotein (apo) B- containing lipoproteins in normal

Acetyl CoA HMG CoA Mevalonate (C6) Dimethylallyl Pyrophosphate isopentenyl Pyrophosphate (C5) Geranyl Pyrophosphate (C10) FarnesylPyrophosphate (C15) Squalene (C30) Lanosterol (C30) 7 Dehydrocholesterol

Reviewers' comments: Reviewer #1 (Remarks to the Author):

Reviewers' comments: Reviewer #1 (Remarks to the Author): Bempedoic acid (ETC-1002) is an ATP-citrate lyase (ACL) inhibitor that in clinical studies has been shown to decrease plasma LDL cholesterol apparently

PCSK9 and its Role in LDL Receptor Regulation Muscat, Oman - 9 February 2019

PCSK9 and its Role in LDL Receptor Regulation Muscat, Oman - 9 February 2019 Professor Gilles Lambert, PhD LaboratoireInserm U1188 Universitéde la Réunion Faculté de Médecine Saint Denis de la Réunion,

Topic 11. Coronary Artery Disease

Topic 11 Coronary Artery Disease Lipid metabolism http://news.bbc.co.uk/2/hi/health/7372495.stm Sterol Metabolism and Coronary Artery Disease Big Picture: Exogenous Cholesterol and Fat Metabolism Fats-Triglycerides

Zuhier Awan, MD, PhD, FRCPC

Metabolism, Atherogenic Properties and Agents to Reduce Triglyceride-Rich Lipoproteins (TRL) The Fifth IAS-OSLA Course on Lipid Metabolism and Cardiovascular Risk Muscat, Oman, February 8-11, 2019 Zuhier

Supplementary Table 2. Plasma lipid profiles in wild type and mutant female mice submitted to a HFD for 12 weeks wt ERα -/- AF-1 0 AF-2 0

Supplementary Table 1. List of specific primers used for gene expression analysis. Genes Primer forward Primer reverse Hprt GCAGTACAGCCCCAAAATGG AACAAAGTCTGGCCTGTATCCA Srebp-1c GGAAGCTGTCGGGGTAGCGTC CATGTCTTCAAATGTGCAATCCAT

Behind LDL: The Metabolism of ApoB, the Essential Apolipoprotein in LDL and VLDL

Behind LDL: The Metabolism of ApoB, the Essential Apolipoprotein in LDL and VLDL Sung-Joon Lee, PhD Division of Food Science Institute of Biomedical Science and Safety Korea University Composition of Lipoproteins:

Hmgcoar AGCTTGCCCGAATTGTATGTG TCTGTTGTAACCATGTGACTTC. Cyp7α GGGATTGCTGTGGTAGTGAGC GGTATGGAATCAACCCGTTGTC

Supplement Table I: primers for Real Time RT-PCR Gene Foward Reverse Hmgcoar AGCTTGCCCGAATTGTATGTG TCTGTTGTAACCATGTGACTTC Cyp7α GGGATTGCTGTGGTAGTGAGC GGTATGGAATCAACCCGTTGTC Cyp27a1 GTGGTCTTATTGGGTACTTGC

The inhibition of CETP: From simply raising HDL-c to promoting cholesterol efflux and lowering of atherogenic lipoproteins Prof Dr J Wouter Jukema

The inhibition of CETP: From simply raising HDL-c to promoting cholesterol efflux and lowering of atherogenic lipoproteins Prof Dr J Wouter Jukema Dept Cardiology, Leiden University Medical Center, Leiden,

Supplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice.

Supplementary Figures: Supplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice. Male apoe -/- mice were fed a high-fat diet for 8 weeks, and given PBS (model group) or

Martin/Hopkins Estimation, Friedewald and Beta- Quantification of LDL-C in Patients in FOURIER

TAP TO GO BACK TO KIOSK MENU Seth S. Martin, M.D., M.H.S., Robert P. Giugliano, M.D., S.M., 2 Sabina A. Murphy, M.P.H., 2 Scott M. Wasserman, M.D., 3 Peter S. Background Evolocumab, a fully human monoclonal

PCSK9 Inhibition: From Genetics to Patients

PCSK9 Inhibition: From Genetics to Patients John Chapman BSc, Ph.D., D.Sc., FESC Research Professor, University of Pierre and Marie Curie Director Emeritus, INSERM Dyslipidemia and Atherosclerosis Research

Is it really that simple? Alyssa Hasty, PhD Associate Professor Molecular Physiology and Biophysics

Alyssa Hasty, PhD Associate Professor Molecular Physiology and Biophysics Why we care about hepatic lipogenesis Control of lipid synthesis What can go wrong in humans Animal models dlto study lipoprotein

Learning Objectives. Cholesterol and Lipids in Kids: It s a Matter of the Heart. Is Atherosclerosis a Pediatric Disease?

Scott J. Soifer, MD Professor and Vice Chair Department of Pediatrics University of California, San Francisco UCSF Benioff Children s Hospital Cholesterol and Lipids in Kids: It s a Matter of the Heart

Current Cholesterol Guidelines and Treatment of Residual Risk COPYRIGHT. J. Peter Oettgen, MD

Current Cholesterol Guidelines and Treatment of Residual Risk J. Peter Oettgen, MD Associate Professor of Medicine Harvard Medical School Director, Preventive Cardiology Beth Israel Deaconess Medical Center

UNIVERSITA DI PISA CHIMICA E TECNOLOGIE FARMACEUTICHE FAMILIAL HYPERCHOLESTEROLEMIA DIPARTIMENTO DI FARMACIA GENETIC CAUSES AND THERAPY

UNIVERSITA DI PISA DIPARTIMENTO DI FARMACIA CHIMICA E TECNOLOGIE FARMACEUTICHE CORSO DI BASI BIOCHIMICHE DELL AZIONE DEI FARMACI FAMILIAL HYPERCHOLESTEROLEMIA GENETIC CAUSES AND THERAPY ERIKA ROSARIA PACCIOLLA

Summary and concluding remarks

Summary and concluding remarks This thesis is focused on the role and interaction of different cholesterol and phospholipid transporters. Cholesterol homeostasis is accomplished via a tightly regulated

INTERNAL MEDICINE - PEDIATRICS

Rev. Med. Chir. Soc. Med. Nat., Iaşi 2016 vol. 120, no. 2 INTERNAL MEDICINE - PEDIATRICS UPDATES NEW CLASS OF DRUGS: THERAPEUTIC RNAi INHIBITION OF PCSK9 AS A SPECIFIC LDL-C LOWERING THERAPY A.L. Strat

Joslin Diabetes Center Advances in Diabetes and Thyroid Disease 2013 Consensus and Controversy in Diabetic Dyslipidemia

Consensus and Controversy in Diabetes and Dyslipidemia Om P. Ganda MD Director, Lipid Clinic Joslin diabetes Center Boston, MA, USA CVD Outcomes in DM vs non- DM 102 Prospective studies; 698, 782 people,

Cholesterol metabolism. Function Biosynthesis Transport in the organism Hypercholesterolemia

Cholesterol metabolism Function Biosynthesis Transport in the organism Hypercholesterolemia - component of all cell membranes - precursor of bile acids steroid hormones vitamin D Cholesterol Sources: dietary

1Why lipids cannot be transported in blood alone? 2How we transport Fatty acids and steroid hormones?

1Why lipids cannot be transported in blood alone? 2How we transport Fatty acids and steroid hormones? 3How are dietary lipids transported? 4How lipids synthesized in the liver are transported? 5 Lipoprotien

ZL ZDF ZDF + E2 *** Visceral (g) ZDF

Body Weight (g) 4 3 2 1 ** * ZL ZDF 6 8 1 12 14 16 Age (weeks) B * Sub-cutaneous (g) 16 12 8 4 ZL ZDF Visceral (g) 25 2 15 1 5 ZL ZDF Total fat pad weight (g) 4 3 2 1 ZDF ZL Supplemental Figure 1: Effect

Leptin deficiency suppresses progression of atherosclerosis in apoe-deficient mice

Leptin deficiency suppresses progression of atherosclerosis in apoe-deficient mice Atherosclerosis, 2007 Chiba T, Shinozaki S, Nakazawa T, et al. Present by Sudaporn Pummoung Apolipoprotein E (apoe( apoe)

Juxtapid. Juxtapid (lomitapide) Description

Federal Employee Program 1310 G Street, N.W. Washington, D.C. 20005 202.942.1000 Fax 202.942.1125 Subject: Juxtapid Page: 1 of 6 Last Review Date: September 20, 2018 Juxtapid Description Juxtapid (lomitapide)

Arteriosclerosis & Atherosclerosis

Arteriosclerosis & Atherosclerosis Arteriosclerosis = hardening of arteries = arterial wall thickening + loss of elasticity 3 types: -Arteriolosclerosis -Monckeberg medial sclerosis -Atherosclerosis Arteriosclerosis,

Basic Mechanisms of Atherosclerosis and Plaque Rupture: Clinical Implications

12 th Annual Cardiovascular Disease Prevention Symposium February 8, 2013 KEYNOTE ADDRESS Basic Mechanisms of Atherosclerosis and Plaque Rupture: Clinical Implications Ira Tabas, M.D., Ph.D. Richard J.

Cellular control of cholesterol. Peter Takizawa Department of Cell Biology

Cellular control of cholesterol Peter Takizawa Department of Cell Biology Brief overview of cholesterol s biological role Regulation of cholesterol synthesis Dietary and cellular uptake of cholesterol

Can We Cure Atherosclerosis?

Can We Cure Atherosclerosis? Jennifer G Robinson MD MPH Professor, Departments of Epidemiology & Medicine Director, Prevention Intervention Center University of Iowa What if you had a guide To guarantee

Clinical Policy: Mipomersen (Kynamro) Reference Number: ERX.SPMN.186 Effective Date: 01/2017

Clinical Policy: (Kynamro) Reference Number: ERX.SPMN.186 Effective Date: 01/2017 Last Review Date: Revision Log See Important Reminder at the end of this policy for important regulatory and legal information.

Request for Prior Authorization for PCSK9 inhibitor therapy Website Form Submit request via: Fax

Request for Prior Authorization for PCSK9 inhibitor therapy Website Form www.highmarkhealthoptions.com Submit request via: Fax - 1-855-476-4158 PCSK9 is a protein that reduces the hepatic removal of low-density

Cholesterol Metabolism

Cholesterol Metabolism Lippincott s Illustrated Review Chapter 18 Steroid Nucleus 1 2 Cholesterol was isolated from gall bladder stones in 1774 3 Sources and Elimination of Cholesterol Synthesis: 1000

Conceptual Approach to CAD Risk. Disclosures. Integrating Imaging and Biomarkers for Optimal CVD Risk Assessment and Management 2/10/2014.

Integrating Imaging and Biomarkers for Optimal CVD Risk Assessment and Management None Disclosures Arthur Agatston Conceptual Approach to CAD Risk Devereux Circulation, 1993 1 Age Obesity Family Hx Diabetes

CETP inhibition: pros and cons. Philip Barter The Heart Research Institute Sydney, Australia

CETP inhibition: pros and cons Philip Barter The Heart Research Institute Sydney, Australia Philip Barter Disclosures Received honorariums for lectures, consultancies or membership of advisory boards from:

Copyright 2017 by Sea Courses Inc.

Diabetes and Lipids Copyright 2017 by Sea Courses Inc. All rights reserved. No part of this document may be reproduced, copied, stored, or transmitted in any form or by any means graphic, electronic, or

See Important Reminder at the end of this policy for important regulatory and legal information.

Clinical Policy: (Repatha) Reference Number: HIM.PA.SP46 Effective Date: 01.01.18 Last Review Date: Line of Business: Health Insurance Marketplace Revision Log See Important Reminder at the end of this

Cholesterol Medicines New & Old: What to Use When

Cholesterol Medicines New & Old: What to Use When Patrick E. McBride, M.D., M.P.H. Division of Cardiovascular Medicine Preventive Cardiology Program Disclosures McBride no conflicts of interest Outline

Potential Atheroprotective Effects of Ixmyelocel-T Cellular Therapy. Kelly J. Ledford, Nikki Murphy, Frank Zeigler, Ronnda L.

Potential Atheroprotective Effects of Ixmyelocel-T Cellular Therapy Kelly J. Ledford, Nikki Murphy, Frank Zeigler, Ronnda L. Bartel 1 Ixmyelocel-T, an expanded, autologous multicellular therapy cultured

Treatment of Atherosclerosis in 2007

Treatment of Atherosclerosis in 2007 Szilard Voros, M.D. Medical Director Cardiovascular MR and CT Piedmont Hospital, Piedmont Hospital Our Paradigm Genotype Phenotype Environment Atherosclerotic Disease

The Addition of Ezetimibe to Statin therapy in. Patients with Homozygous Familial. Hypercholesterolaemia

The Addition of Ezetimibe to Statin therapy in Patients with Homozygous Familial Hypercholesterolaemia Submitted in fulfilment with the requirements for the degree Master in Medicine (MMed) Dr Adriano

Pharmacy Policy Bulletin

Pharmacy Policy Bulletin Title: Policy #: PCSK9 inhibitors Rx.01.170 Application of pharmacy policy is determined by benefits and contracts. Benefits may vary based on product line, group, or contract.

Repatha. Repatha (evolocumab) Description

Federal Employee Program 1310 G Street, N.W. Washington, D.C. 20005 202.942.1000 Fax 202.942.1125 5.16.08 Subject: Repatha Page: 1 of 8 Last Review Date: September 18, 2015 Repatha Description Repatha

Clinical Policy: Evolocumab (Repatha) Reference Number: ERX.SPMN.184 Effective Date: 01/2017

Clinical Policy: (Repatha) Reference Number: ERX.SPMN.184 Effective Date: 01/2017 Last Review Date: Revision Log See Important Reminder at the end of this policy for important regulatory and legal information.

Supplementary Figure S1. Effect of Glucose on Energy Balance in WT and KHK A/C KO

Supplementary Figure S1. Effect of Glucose on Energy Balance in WT and KHK A/C KO Mice. WT mice and KHK-A/C KO mice were provided drinking water containing 10% glucose or tap water with normal chow ad

Disclosures. Background 1 What is Known MENOPAUSE, ESTROGENS, AND LIPOPROTEIN PARTICLES. Background 2 What is Not Known 10/2/2017

Disclosures MENOPAUSE, ESTROGENS, AND LIPOPROTEIN PARTICLES Grants: NIH, Quest Diagnostics Consultant: Quest Diagnostics Merck Global Atherosclerosis Advisory Board Ronald M. Krauss, Children s Hospital

Clinical Policy: Evolocumab (Repatha) Reference Number: ERX.SPA.169 Effective Date:

Clinical Policy: (Repatha) Reference Number: ERX.SPA.169 Effective Date: 01.11.17 Last Review Date: 11.17 Revision Log See Important Reminder at the end of this policy for important regulatory and legal

About OMICS International Conferences

About OMICS Group OMICS Group is an amalgamation of Open Access publications and worldwide international science conferences and events. Established in the year 2007 with the sole aim of making the information

SUPPLEMENTARY INFORMATION

DOI: 10.1038/ncb3461 In the format provided by the authors and unedited. Supplementary Figure 1 (associated to Figure 1). Cpeb4 gene-targeted mice develop liver steatosis. a, Immunoblot displaying CPEB4

Novel HDL Targeted Therapies: The Search Continues Assoc. Prof. K.Kostner,, Univ. of Qld, Brisbane

Novel HDL Targeted Therapies: The Search Continues Assoc. Prof. K.Kostner,, Univ. of Qld, Brisbane Kostner, 2007 2008 LDL Target depends on your level of Risk Acute Plaque Rupture ACS (UA/NSTEMI/STEMI)

Low-density lipoprotein as the key factor in atherogenesis too high, too long, or both

Low-density lipoprotein as the key factor in atherogenesis too high, too long, or both Lluís Masana Vascular Medicine and Metabolism Unit. Sant Joan University Hospital. IISPV. CIBERDEM Rovira i Virgili

MCB130 Midterm. GSI s Name:

1. Peroxisomes are small, membrane-enclosed organelles that function in the degradation of fatty acids and in the degradation of H 2 O 2. Peroxisomes are not part of the secretory pathway and peroxisomal

USING NON -TRADITIONAL RISK MARKERS IN ASSESSING CV RISK

USING NON -TRADITIONAL RISK MARKERS IN ASSESSING CV RISK JAMES M FALKO MD PROFESSOR OF MEDICINE UNIVERSITY OF COLORADO Adapted from: Rader D. N Engl J Med. 2000 hs-crp (mg/l) 6 5 4 3 2 1 *p

Plasma lipoproteins & atherosclerosis by. Prof.Dr. Maha M. Sallam

Biochemistry Department Plasma lipoproteins & atherosclerosis by Prof.Dr. Maha M. Sallam 1 1. Recognize structures,types and role of lipoproteins in blood (Chylomicrons, VLDL, LDL and HDL). 2. Explain

Lp(a) Ready for prime time? E Stroes AMC

Lp(a) Ready for prime time? E Stroes AMC Case Male, 45 years old Hypertension: DM: Smoking: Dyslipidemia: Fam history: brother MI (55yr) Lipoprotein(a): 1240 mg/l!!! Lipoprotein(a) = LDL + apo(a) tail

Atherogenesis and metabolic dysregulation in LDL receptor knockout rats

Atherogenesis and metabolic dysregulation in LDL receptor knockout rats Srinivas D. Sithu,, Aruni Bhatnagar, Sanjay Srivastava JCI Insight. 2017;2(9):e86442.. Research Article Cardiology Vascular biology

Supporting Information. Supporting Tables. S-Table 1 Primer pairs for RT-PCR. Product size. Gene Primer pairs

Supporting Information Supporting Tables S-Table 1 Primer pairs for RT-PCR. Gene Primer pairs Product size (bp) FAS F: 5 TCTTGGAAGCGATGGGTA 3 429 R: 5 GGGATGTATCATTCTTGGAC 3 SREBP-1c F: 5 CGCTACCGTTCCTCTATCA

Dyslipidemia. (Med-341)

Dyslipidemia (Med-341) Anwar A Jammah, MD, FRCPC, FACP, CCD, ECNU. Associate Professor of Medicine Consultant Medicine, Endocrinology, Thyroid Oncology Department of Medicine, King Saud University The

Clinical Policy: Lomitapide (Juxtapid) Reference Number: ERX.SPA.170 Effective Date:

Clinical Policy: (Juxtapid) Reference Number: ERX.SPA.170 Effective Date: 01.11.17 Last Review Date: 11.17 Revision Log See Important Reminder at the end of this policy for important regulatory and legal

DOI: 10.1038/ncb2210 b. ICAM1 ng ml -1 P = 0.0001 Small RNA (15-30nts) ng ml -1 Cell Lysate Exosome HDL Plasma HDL Normal Human HDL mirnas R = 0.45 P < 0.0001 Normal Human Exosome mirnas Figure S1. Characterization

Supplementary Figure 1

Supplementary Figure 1 A B mir-141, human cell lines mir-2c, human cell lines mir-141, hepatocytes mir-2c, hepatocytes Relative RNA.1.8.6.4.2 Relative RNA.3.2.1 Relative RNA 1.5 1..5 Relative RNA 2. 1.5

UnitedHealthcare Pharmacy Clinical Pharmacy Programs

UnitedHealthcare Pharmacy Clinical Pharmacy Programs Program Number 2017 P 2062-8 Program Prior Authorization/Medical Necessity Medication Praluent (alirocumab) P&T Approval Date 5/2015, 8/2015, 9/2015,

Therapeutic effect of flavonoid rich extract of apricots on high-fat diet induced hyperlipidemia in rabbits

Therapeutic effect of flavonoid rich extract of apricots on high-fat diet induced hyperlipidemia in rabbits in rabbits TOOBA LATEEF Assistant Professor Department of Biochemistry Jinnah University for

Clinical Policy: Mipomersen (Kynamro) Reference Number: ERX.SPA.171 Effective Date:

Clinical Policy: (Kynamro) Reference Number: ERX.SPA.171 Effective Date: 01.11.17 Last Review Date: 08.18 Revision Log See Important Reminder at the end of this policy for important regulatory and legal

and Restenosis Yangsoo Jang, MD, PhD. Yonsei University College of Medicine

PPAR- Agonist and In-Stent Restenosis Yangsoo Jang, MD, PhD. Yonsei University College of Medicine Peroxisome Proliferator- activated Receptors (PPAR) Lipid-activated transcription factors : => regulating

Familial Hypercholesterolemia New treatments

Familial Hypercholesterolemia New treatments Prof. Shlomo Keidar Head Internal Medicine A Rambam Health Care Campus IAS, Haifa May 2013 Effect of treatment on CV survival in Familial Hypercholesterolemia

Disclosure. This study was sponsored by Pfizer, Inc. All authors are employees of Pfizer, Inc. with ownership of stock in Pfizer, Inc.

Disclosure This study was sponsored by Pfizer, Inc. All authors are employees of Pfizer, Inc. with ownership of stock in Pfizer, Inc. Effects of 12 Weeks of Treatment with RN316 (PF-04950615), a Humanized

Unit IV Problem 3 Biochemistry: Cholesterol Metabolism and Lipoproteins

Unit IV Problem 3 Biochemistry: Cholesterol Metabolism and Lipoproteins - Cholesterol: It is a sterol which is found in all eukaryotic cells and contains an oxygen (as a hydroxyl group OH) on Carbon number

The New Gold Standard for Lipoprotein Analysis. Advanced Testing for Cardiovascular Risk

The New Gold Standard for Lipoprotein Analysis Advanced Testing for Cardiovascular Risk Evolution of Lipoprotein Testing The Lipid Panel Total Cholesterol = VLDL + LDL + HDL Evolution of Lipoprotein Testing

Sphingolipid de novo synthesis: its relevance to metabolic diseases and cell polarity

Sphingolipid de novo synthesis: its relevance to metabolic diseases and cell polarity Xian-Cheng Jiang (shian-chen chiang) SUNY Downstate Medical Center Cell plasma membrane Lipid rafts Sphingolipid =

Lipid Lowering in Patients at High Risk for Cardiovascular Disease

Lipid Lowering in Patients at High Risk for Cardiovascular Disease Prof. John J.P. Kastelein, MD PhD FESC Dept. of Vascular Medicine Academic Medical Center / University of Amsterdam The Netherlands Novel

HYPERCHOLESTEROLEMIA

UPDATES ON HYPERCHOLESTEROLEMIA WITH EMPHASIS ON PCSK9 INHIBITORS July, 2018 Chicago by Ernesto L. Chua, MD, FACC, FACP, FPCP Board Certified in Internal Medicine Board Certified in Cardiology COL, USAF,

Kynamro. Kynamro (mipomersen) Description

Federal Employee Program 1310 G Street, N.W. Washington, D.C. 20005 202.942.1000 Fax 202.942.1125 5.40.02 Subject: Kynamro Page: 1 of 5 Last Review Date: September 15, 2017 Kynamro Description Kynamro

Repatha. Repatha (evolocumab) Description

Federal Employee Program 1310 G Street, N.W. Washington, D.C. 20005 202.942.1000 Fax 202.942.1125 5.40.08 Subject: Repatha Page: 1 of 8 Last Review Date: December 2, 2016 Repatha Description Repatha (evolocumab)

Lipid/Lipoprotein Structure and Metabolism (Overview)

Lipid/Lipoprotein Structure and Metabolism (Overview) Philip Barter President, International Atherosclerosis Society Centre for Vascular Research University of New South Wales Sydney, Australia Disclosures

Drug Class Review Proprotein Convertase Subtilisin Kexin type 9 (PCSK9) Inhibitors

Drug Class Review Proprotein Convertase Subtilisin Kexin type 9 (PCSK9) Inhibitors Final Original Report July 2015 The purpose of reports is to make available information regarding the comparative clinical

Cardiovascular Division, Brigham and Women s Hospital, Harvard Medical School

Low Endothelial Shear Stress Upregulates Atherogenic and Inflammatory Genes Extremely Early in the Natural History of Coronary Artery Disease in Diabetic Hyperlipidemic Juvenile Swine Michail I. Papafaklis,

Plasma cholesterol has been established as a predictor of

Dietary Fat Induced Alterations in Atherosclerosis Are Abolished by ACAT2-Deficiency in ApoB100 Only, LDLr / Mice Thomas A. Bell III, Kathryn Kelley, Martha D. Wilson, Janet K. Sawyer, Lawrence L. Rudel

Health Benefits of Turmeric/Curcumin

Health Benefits of Turmeric/Curcumin Shobha Ghosh, PhD, FAHA Professor of Medicine and Physiology Department of Internal Medicine Target Disease Clinical Trials with Curcumin # Dose of Curcumin Findings

Ezetimibe: a selective inhibitor of cholesterol absorption

European Heart Journal Supplements (2001) 3 (Supplement E), E6 E10 Ezetimibe: a selective inhibitor of cholesterol absorption Dipartimento di Scienze Farmacologiche, Universita degli Studi di Milano, Milano,

Ezetimibe: a selective inhibitor of cholesterol absorption

European Heart Journal Supplements (2001) 3 (Supplement E), E6 E10 Ezetimibe: a selective inhibitor of cholesterol absorption Dipartimento di Scienze Farmacologiche, Universita degli Studi di Milano, Milano,

There are many ways to lower triglycerides in humans: Which are the most relevant for pancreatitis and for CV risk?

There are many ways to lower triglycerides in humans: Which are the most relevant for pancreatitis and for CV risk? Michael Davidson M.D. FACC, Diplomate of the American Board of Lipidology Professor,

THE LATEST IN CARDIOVASCULAR RISK LIPID MANAGEMENT

THE LATEST IN CARDIOVASCULAR RISK LIPID MANAGEMENT Thomas F. Whayne, Jr, MD, PhD, FACC Professor of Medicine (Cardiology) Gill Heart Institute University of Kentucky April 2016 E-mail: twhayn0@uky.edu

2.5% of all deaths globally each year. 7th leading cause of death by % of people with diabetes live in low and middle income countries

Lipid Disorders in Diabetes (Diabetic Dyslipidemia) Khosrow Adeli PhD, FCACB, DABCC Head and Professor, Clinical Biochemistry, The Hospital for Sick Children, University it of Toronto Diabetes A Global

Familial Hypercholesterolemia

Familial Hypercholesterolemia Dr.Ramzi Al-Mohammadi Assistant Professor of Medicine Interventional Cardiologist, Advanced HF and Transplant Consultant Classification of Hyperlipedemia Primary hyperlipedemia:

VasoRx: Atherosclerotic Plaque Regression

VasoRx: Atherosclerotic Plaque Regression A progressive disease characterized by plaque build-up in large arteries, leading to heart attacks, stroke, and peripheral vascular disease. Induced by a combination

Focus on FH (Familial Hypercholesterolemia) Joshua W. Knowles, MD PhD for PCNA May, 2013

Focus on FH (Familial Hypercholesterolemia) Joshua W. Knowles, MD PhD for PCNA May, 2013 Conflicts CMO for The FH Foundation Pre-talk quiz What is cascade screening? 1. screening all family members 2.

ALN-PCSsc, an RNAi Investigational Agent That Inhibits PCSK9 Synthesis With the Potential for Effective Bi-Annual Dosing: Interim Results

ALN-PCSsc, an RNAi Investigational Agent That Inhibits PCSK9 Synthesis With the Potential for Effective Bi-Annual Dosing: Interim Results Kevin Fitzgerald, PhD Co-authors: Amy Simon 1, Suellen White 1,

Hypertriglyceridemia. Ara Metjian, M.D. Resident s Report 20 December 2002

Hypertriglyceridemia Ara Metjian, M.D. Resident s Report 20 December 2002 Review of Lipids Chylomicrons (CM): Dietary lipids absorbed through the GI tract are assembled intracellularly into CM. Very Low

Fasting or non fasting?

Vascular harmony Robert Chilton Professor of Medicine University of Texas Health Science Center Director of Cardiac Catheterization labs Director of clinical proteomics Which is best to measure Lower continues

Antigen Presenting Cell. T cell proliferation Disclosures

Dynamic T-cell and APC Interaction Perpetuates Vascular Inflammation and Atherosclerosis!"#$%&'()*+*,-.,'/1#.%-13'4-"1-3''5*6'789:' ' ;"

Hypertriglyceridemia, Inflammation, & Pregnancy

Hypertriglyceridemia, Inflammation, & Pregnancy Richard L. Nemiroff, MD, FACOG, NLA Professor, Clinical Gynecology Perelman School of Medicine University of Pennsylvania Philadelphia, PA Disclosure of