Supporting Information. Supporting Tables. S-Table 1 Primer pairs for RT-PCR. Product size. Gene Primer pairs

Size: px
Start display at page:

Download "Supporting Information. Supporting Tables. S-Table 1 Primer pairs for RT-PCR. Product size. Gene Primer pairs"

Transcription

1 Supporting Information Supporting Tables S-Table 1 Primer pairs for RT-PCR. Gene Primer pairs Product size (bp) FAS F: 5 TCTTGGAAGCGATGGGTA R: 5 GGGATGTATCATTCTTGGAC 3 SREBP-1c F: 5 CGCTACCGTTCCTCTATCA R: 5 CACTTCGCAGGGTCAGG 3 ACCα F: 5 AAGGGCTACCTCTAATG R: 5 CACAAACCAGCGTCTCA 3 PPARα F: 5 AGGCTATCCCAGGCTTTGC R: 5 CGTCTGACTCGGTCTTCTTG 3 ACO1 F: 5 TCAAGCAAAGCGAACCAG R: 5 ACCATACCACCCACCAAC 3 MACD F: 5 CTGCGTGACAGAACCCTC R: 5 CAACTTTCATCGCCATTT 3 VLACD F: 5 AGGCTTTGGCGGCTTTCTG R: 5 CTCTGCTGGCACCTTGACT 3 UCP-2 F: 5 TGGGCACCATCCTAACC R: 5 TGGCATTTCGGGCAACA 3 TNFα F: 5 ACATCTCCCTCCGGAAAGGA R: 5 CGCCACGAGCAGGAATGAGA 3 IL-6 F: 5 GGATACCACCCACAACAG R: 5 TGCCGAGTAGACCTCATAG 3 ERα F: 5 GGTCCAATTCTGACAATCGAC R: 5 TTTCGTATCCCGCCTTTCATC 3 ERβ F: 5 GCACCTTGAGTCCAGAG R: 5 TCAGTCCCACCATTAGC 3 AR F: 5 GCTCTGGCAGCAGTGAAGCA R: 5 AGTCCCCATAGCGGCATTGC 3 CPT-1 F: 5 CTCAGCCTCTACGGCAAATC R: 5 CTTCTTGATCAGGCCTTTGC 3 PPARγ F: 5 ATTCTGGCCCACCAACTTCGG R: 5 TGGAAGCCTGATGCTTTATCCCCA 3 LXRα F: 5 TACAACCCTGGGAGTGAGA R: 5 TTAGCATCCGTGGGAACAT 3 DGAT1 F: 5 GGATGGTCCCTACTATCCAG R: 5 CCACCAGTCCCTGTAGAACT 3 DGAT2 F: 5 GGAGGCCACCGAAGTTAGCA R: 5 CACCTCCCACCACGATGACAA 3 1

2 S-Table 2 Antibodies and dilutions Antibody Mol. Wt. Dilution Cat. nr. Source Company ERα 66KD 1:100 sc-542 rabbit polyclonal IgG Santa Cruz TNFα 17KD 1:200 sc-1350 goat polyclonal IgG Santa Cruz AR 87KD 1:200 sc-816 rabbit polyclonal IgG Santa Cruz UCP2 32KD 1:200 sc-6526 goat polyclonal IgG Santa Cruz FAS 207KD 1:200 sc rabbit polyclonal IgG Santa Cruz CPT1 86KD 1:200 sc goat polyclonal IgG Santa Cruz HMGCR 43KD 1:200 sc goat polyclonal IgG Santa Cruz β-actin 42KD 1:500 sc mouse monoclonal IgG Santa Cruz IL-6 26KD 1:1000 ab-6672 rabbit polyclonal IgG Abcam P-ACC 280KD 1:1000 #3661 rabbit polyclonal IgG Cell Signaling ACC 280KD 1:1000 #3676 rabbit monoclonal IgG Cell Signaling P-HMGCR 98KD 1:1000 # rabbit polyclonal IgG Millipore S-Table 3 Total cholesterol and cholesterol ester formation from the rat hepatocytes in vitro with different treatments (concentration expressed in nm/well). Medium with Palmitic acid : Oleic acid (1:2) Vehicle E2 E2+ICI DHT DHT+Flu E2+DHT Total cholesterol 46.67± ±3.32* 40± ±4.22* 42.52± ±7.38* Cholesterol 16.33± ±3.22* 18.46± ± ± ±4.81 ester * p< 0.05 treatments (E2, DHT and/or E2+DHT) vs. vehicle 2

3 Supplemental Figures S-Fig. 1 Accumulation of lipids in hepatocytes by ORO staining (A) Liver from ORX normal diet control group. (B) Liver cells with marked lipid accumulation in all 1, 2, and 3 zones in ORX HFD control group. (C) Liver from E2-treated group; zones 2 and 3 of liver lobules contain normal appearing liver cells rimmed with marked lipid changes in zone 1. (D) Liver from DHT-treated group; zone 2 and 1 of liver lobules contain normal appearing liver cells rimmed with marked lipid changes in zone 3. (E) Liver from E2+DHT-treated group; zone 2 and 3 of liver lobules contain normal appearing liver cells rimmed with also less lipid changes in zone 1. (F) Quantification of ORO staining shown as Mean±SEM, ***, P<0.001 versus HFD-C, high fat diet control. 3

4 S-Fig. 2 Histopathology of the liver tissues by hematoxylin and eosin (H/E) staining from WT gonad intact (non-orx) SD male rats (n=6/group) (A) Liver from the WT normal diet (ND) control group. Zonation is identical as in Fig. 1 (B) Liver cells with lipid accumulation in the HFD control. The inflammation and fatty liver cell presence is significantly less abundant than in HFD ORX liver (Fig. 1); HFD liver from the E2-treated group (C); zones 2 and 3 of liver lobules contain normal appearing liver cells rimmed with fatty changes in zone 3. HFD liver from the DHT-treated group (D) ; zones 1 and 2 of liver lobules contain normal appearing liver cells rimmed with fatty changes in zone 1. (E1-2) HFD liver from the E2+DHT-treated group, normalized liver cells in zones 1, 2 and 3 of liver lobules and scattered with some lipid accumulated liver cells. 4

5 S-Fig. 3 Genes for triglyceride synthesis in SD rat liver tissues No significant changes could be observed in any of the genes involved in TG synthesis among the treatment groups. None of these above shown treated groups versus HFD-C (high fat diet control) were statistically significant. S-Fig. 4 Relative densitometry analysis of the alterations of phosphorylation related to protein levels for P-ACC/total ACC and P-HMGCR/total HMGCR levels after different treatments (calculated from Fig. 3A). The densitometric values were pooled from three animals in each group and repeated three times by Western blot, and are shown as Mean±SEM. *, p<0.05, ***, p<0.001 versus HFD-C, high fat diet control. 5

6 5A) 5B) S-Fig. 5 Expression levels for genes involves in Fatty acid synthesis (A) and β-oxidation (B) in hepatocytes with different treatments. None of these above shown treated groups versus HFD-C (high fat diet control) were statistically significant. 6

7 S-Fig. 6 Human data for serum lipid profile parameters from milder/subnormal (regarded as control) (n=5) and severe (n=5) steatotic liver samples. None of the above values are statistically significant. 7

Supplementary Table 2. Plasma lipid profiles in wild type and mutant female mice submitted to a HFD for 12 weeks wt ERα -/- AF-1 0 AF-2 0

Supplementary Table 2. Plasma lipid profiles in wild type and mutant female mice submitted to a HFD for 12 weeks wt ERα -/- AF-1 0 AF-2 0 Supplementary Table 1. List of specific primers used for gene expression analysis. Genes Primer forward Primer reverse Hprt GCAGTACAGCCCCAAAATGG AACAAAGTCTGGCCTGTATCCA Srebp-1c GGAAGCTGTCGGGGTAGCGTC CATGTCTTCAAATGTGCAATCCAT

More information

AAV-TBGp-Cre treatment resulted in hepatocyte-specific GH receptor gene recombination

AAV-TBGp-Cre treatment resulted in hepatocyte-specific GH receptor gene recombination AAV-TBGp-Cre treatment resulted in hepatocyte-specific GH receptor gene recombination Supplementary Figure 1. Generation of the adult-onset, liver-specific GH receptor knock-down (alivghrkd, Kd) mouse

More information

ZL ZDF ZDF + E2 *** Visceral (g) ZDF

ZL ZDF ZDF + E2 *** Visceral (g) ZDF Body Weight (g) 4 3 2 1 ** * ZL ZDF 6 8 1 12 14 16 Age (weeks) B * Sub-cutaneous (g) 16 12 8 4 ZL ZDF Visceral (g) 25 2 15 1 5 ZL ZDF Total fat pad weight (g) 4 3 2 1 ZDF ZL Supplemental Figure 1: Effect

More information

Fig. S1. Dose-response effects of acute administration of the β3 adrenoceptor agonists CL316243, BRL37344, ICI215,001, ZD7114, ZD2079 and CGP12177 at

Fig. S1. Dose-response effects of acute administration of the β3 adrenoceptor agonists CL316243, BRL37344, ICI215,001, ZD7114, ZD2079 and CGP12177 at Fig. S1. Dose-response effects of acute administration of the β3 adrenoceptor agonists CL316243, BRL37344, ICI215,001, ZD7114, ZD2079 and CGP12177 at doses of 0.1, 0.5 and 1 mg/kg on cumulative food intake

More information

SUPPLEMENTARY DATA. Supplementary Table 1. Primer sequences for qrt-pcr

SUPPLEMENTARY DATA. Supplementary Table 1. Primer sequences for qrt-pcr Supplementary Table 1. Primer sequences for qrt-pcr Gene PRDM16 UCP1 PGC1α Dio2 Elovl3 Cidea Cox8b PPARγ AP2 mttfam CyCs Nampt NRF1 16s-rRNA Hexokinase 2, intron 9 β-actin Primer Sequences 5'-CCA CCA GCG

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION FOR Liver X Receptor α mediates hepatic triglyceride accumulation through upregulation of G0/G1 Switch Gene 2 (G0S2) expression I: SUPPLEMENTARY METHODS II: SUPPLEMENTARY FIGURES

More information

Males- Western Diet WT KO Age (wks) Females- Western Diet WT KO Age (wks)

Males- Western Diet WT KO Age (wks) Females- Western Diet WT KO Age (wks) Relative Arv1 mrna Adrenal 33.48 +/- 6.2 Skeletal Muscle 22.4 +/- 4.93 Liver 6.41 +/- 1.48 Heart 5.1 +/- 2.3 Brain 4.98 +/- 2.11 Ovary 4.68 +/- 2.21 Kidney 3.98 +/-.39 Lung 2.15 +/-.6 Inguinal Subcutaneous

More information

Figure 1. Effects of FGF21 on adipose tissue. (A) Representative histological. findings of epididymal adipose tissue (B) mrna expression of

Figure 1. Effects of FGF21 on adipose tissue. (A) Representative histological. findings of epididymal adipose tissue (B) mrna expression of SUPPLEMENTAL MATERIAL EN-12-2276 Figure 1. Effects of FGF21 on adipose tissue. (A) Representative histological findings of epididymal adipose tissue (B) mrna expression of adipocytokines in adipose tissue.

More information

Male 30. Female. Body weight (g) Age (weeks) Age (weeks) Atg7 f/f Atg7 ΔCD11c

Male 30. Female. Body weight (g) Age (weeks) Age (weeks) Atg7 f/f Atg7 ΔCD11c ody weight (g) ody weight (g) 34 3 Male 3 27 Female 26 24 22 18 7 9 11 13 15 17 19 21 23 21 18 15 7 9 11 13 15 17 19 21 23 Age (weeks) Age (weeks) Supplementary Figure 1. Lean phenotypes in mice regardless

More information

Hmgcoar AGCTTGCCCGAATTGTATGTG TCTGTTGTAACCATGTGACTTC. Cyp7α GGGATTGCTGTGGTAGTGAGC GGTATGGAATCAACCCGTTGTC

Hmgcoar AGCTTGCCCGAATTGTATGTG TCTGTTGTAACCATGTGACTTC. Cyp7α GGGATTGCTGTGGTAGTGAGC GGTATGGAATCAACCCGTTGTC Supplement Table I: primers for Real Time RT-PCR Gene Foward Reverse Hmgcoar AGCTTGCCCGAATTGTATGTG TCTGTTGTAACCATGTGACTTC Cyp7α GGGATTGCTGTGGTAGTGAGC GGTATGGAATCAACCCGTTGTC Cyp27a1 GTGGTCTTATTGGGTACTTGC

More information

18s AAACGGCTACCACATCCAAG CCTCCAATGGATCCTCGTTA. 36b4 GTTCTTGCCCATCAGCACC AGATGCAGCAGATCCGCAT. Acc1 AGCAGATCCGCAGCTTG ACCTCTGCTCGCTGAGTGC

18s AAACGGCTACCACATCCAAG CCTCCAATGGATCCTCGTTA. 36b4 GTTCTTGCCCATCAGCACC AGATGCAGCAGATCCGCAT. Acc1 AGCAGATCCGCAGCTTG ACCTCTGCTCGCTGAGTGC Supplementary Table 1. Quantitative PCR primer sequences Gene symbol Sequences (5 to 3 ) Forward Reverse 18s AAACGGCTACCACATCCAAG CCTCCAATGGATCCTCGTTA 36b4 GTTCTTGCCCATCAGCACC AGATGCAGCAGATCCGCAT Acc1

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 A B mir-141, human cell lines mir-2c, human cell lines mir-141, hepatocytes mir-2c, hepatocytes Relative RNA.1.8.6.4.2 Relative RNA.3.2.1 Relative RNA 1.5 1..5 Relative RNA 2. 1.5

More information

Differential effects of estrogen/androgen on the prevention of nonalcoholic fatty liver disease in male rat

Differential effects of estrogen/androgen on the prevention of nonalcoholic fatty liver disease in male rat Differential effects of estrogen/androgen on the prevention of nonalcoholic fatty liver disease in male rat Hua Zhang 1, Yuanwu Liu 1, Li Wang 1,2, Zhen Li 3, Hongwen Zhang 4, Jihua Wu 4, Nafis Rahman

More information

Supplemental Information

Supplemental Information Supplemental Information Tobacco-specific Carcinogen Induces DNA Methyltransferases 1 Accumulation through AKT/GSK3β/βTrCP/hnRNP-U in Mice and Lung Cancer patients Ruo-Kai Lin, 1 Yi-Shuan Hsieh, 2 Pinpin

More information

Supplementary Figure S1

Supplementary Figure S1 Lipidomic-based investigation into the regulatory effect of Schisandrin B on palmitic acid level in non-alcoholic steatotic livers Hiu Yee Kwan 1,2, Xuyan Niu 3, Wenlin Dai 4, Tiejun Tong 4, Xiaojuan Chao

More information

General Laboratory methods Plasma analysis: Gene Expression Analysis: Immunoblot analysis: Immunohistochemistry:

General Laboratory methods Plasma analysis: Gene Expression Analysis: Immunoblot analysis: Immunohistochemistry: General Laboratory methods Plasma analysis: Plasma insulin (Mercodia, Sweden), leptin (duoset, R&D Systems Europe, Abingdon, United Kingdom), IL-6, TNFα and adiponectin levels (Quantikine kits, R&D Systems

More information

Supplementary Figure S1. Effect of Glucose on Energy Balance in WT and KHK A/C KO

Supplementary Figure S1. Effect of Glucose on Energy Balance in WT and KHK A/C KO Supplementary Figure S1. Effect of Glucose on Energy Balance in WT and KHK A/C KO Mice. WT mice and KHK-A/C KO mice were provided drinking water containing 10% glucose or tap water with normal chow ad

More information

Suppl. Figure 1. T 3 induces autophagic flux in hepatic cells. (A) RFP-GFP-LC3 transfected HepG2/TRα cells were visualized and cells were quantified

Suppl. Figure 1. T 3 induces autophagic flux in hepatic cells. (A) RFP-GFP-LC3 transfected HepG2/TRα cells were visualized and cells were quantified Suppl. Figure 1. T 3 induces autophagic flux in hepatic cells. (A) RFP-GFP-LC3 transfected HepG2/TRα cells were visualized and cells were quantified for RFP-LC3 puncta (red dots) representing both autolysosomes

More information

Supplementary Figure 1. PAQR3 knockdown inhibits SREBP-2 processing in CHO-7 cells CHO-7 cells were transfected with control sirna or a sirna

Supplementary Figure 1. PAQR3 knockdown inhibits SREBP-2 processing in CHO-7 cells CHO-7 cells were transfected with control sirna or a sirna Supplementary Figure 1. PAQR3 knockdown inhibits SREBP-2 processing in CHO-7 cells CHO-7 cells were transfected with control sirna or a sirna targeted for hamster PAQR3. At 24 h after the transfection,

More information

GPR120 *** * * Liver BAT iwat ewat mwat Ileum Colon. UCP1 mrna ***

GPR120 *** * * Liver BAT iwat ewat mwat Ileum Colon. UCP1 mrna *** a GPR120 GPR120 mrna/ppia mrna Arbitrary Units 150 100 50 Liver BAT iwat ewat mwat Ileum Colon b UCP1 mrna Fold induction 20 15 10 5 - camp camp SB202190 - - - H89 - - - - - GW7647 Supplementary Figure

More information

Supplementary Figure 1

Supplementary Figure 1 VO (ml kg - min - ) VCO (ml kg - min - ) Respiratory exchange ratio Energy expenditure (cal kg - min - ) Locomotor activity (x count) Body temperature ( C) Relative mrna expression TA Sol EDL PT Heart

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 Supplementary Figure 1. Neither the activation nor suppression of the MAPK pathway affects the ASK1/Vif interaction. (a, b) HEK293 cells were cotransfected with plasmids encoding

More information

SUPPLEMENTARY INFORMATION. Supplementary Figures S1-S9. Supplementary Methods

SUPPLEMENTARY INFORMATION. Supplementary Figures S1-S9. Supplementary Methods SUPPLEMENTARY INFORMATION SUMO1 modification of PTEN regulates tumorigenesis by controlling its association with the plasma membrane Jian Huang 1,2#, Jie Yan 1,2#, Jian Zhang 3#, Shiguo Zhu 1, Yanli Wang

More information

2.5. AMPK activity

2.5. AMPK activity Supplement Fig. A 3 B phos-ampk 2.5 * Control AICAR AMPK AMPK activity (Absorbance at 45 nm) 2.5.5 Control AICAR Supplement Fig. Effects of AICAR on AMPK activation in macrophages. J774. macrophages were

More information

Supplementary Fig. 1 eif6 +/- mice show a reduction in white adipose tissue, blood lipids and normal glycogen synthesis. The cohort of the original

Supplementary Fig. 1 eif6 +/- mice show a reduction in white adipose tissue, blood lipids and normal glycogen synthesis. The cohort of the original Supplementary Fig. 1 eif6 +/- mice show a reduction in white adipose tissue, blood lipids and normal glycogen synthesis. The cohort of the original phenotypic screening was n=40. For specific tests, the

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 10.1038/ncb3461 In the format provided by the authors and unedited. Supplementary Figure 1 (associated to Figure 1). Cpeb4 gene-targeted mice develop liver steatosis. a, Immunoblot displaying CPEB4

More information

A synergistic anti-obesity effect by a combination of capsinoids and cold temperature through the promotion of beige adipocyte biogenesis

A synergistic anti-obesity effect by a combination of capsinoids and cold temperature through the promotion of beige adipocyte biogenesis A synergistic anti-obesity effect by a combination of capsinoids and cold temperature through the promotion of beige adipocyte biogenesis Kana Ohyama, 1,2 Yoshihito Nogusa, 1 Kosaku Shinoda, 2 Katsuya

More information

(a) Significant biological processes (upper panel) and disease biomarkers (lower panel)

(a) Significant biological processes (upper panel) and disease biomarkers (lower panel) Supplementary Figure 1. Functional enrichment analyses of secretomic proteins. (a) Significant biological processes (upper panel) and disease biomarkers (lower panel) 2 involved by hrab37-mediated secretory

More information

SUPPLEMENTARY DATA. Supplementary Table 1. Primers used in qpcr

SUPPLEMENTARY DATA. Supplementary Table 1. Primers used in qpcr Supplementary Table 1. Primers used in qpcr Gene forward primer (5'-3') reverse primer (5'-3') β-actin AGAGGGAAATCGTGCGTGAC CAATAGTGATGACCTGGCCGT Hif-p4h-2 CTGGGCAACTACAGGATAAAC GCGTCCCAGTCTTTATTTAGATA

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 a Percent of body weight! (%) 4! 3! 1! Epididymal fat Subcutaneous fat Liver SD Percent of body weight! (%) ** 3! 1! SD Percent of body weight! (%) 6! 4! SD ** b Blood glucose (mg/dl)!

More information

Yun-Jung Choi, Jiangao Song, Jeff D. Johnson, Charles McWherter. NASH-TAG Conference Park City, Utah January 4, 2019

Yun-Jung Choi, Jiangao Song, Jeff D. Johnson, Charles McWherter. NASH-TAG Conference Park City, Utah January 4, 2019 Combination Therapy of Seladelpar and Liraglutide Attenuates Obesity, Hepatic Steatosis and Fibrosis in a Diet-induced and Biopsy-confirmed Mouse Model of NASH Yun-Jung Choi, Jiangao Song, Jeff D. Johnson,

More information

BMP6 treatment compensates for the molecular defect and ameliorates hemochromatosis in Hfe knockout mice

BMP6 treatment compensates for the molecular defect and ameliorates hemochromatosis in Hfe knockout mice SUPPLEMENTARY MATERIALS BMP6 treatment compensates for the molecular defect and ameliorates hemochromatosis in Hfe knockout mice Elena Corradini, Paul J. Schmidt, Delphine Meynard, Cinzia Garuti, Giuliana

More information

SUPPLEMENTARY FIGURES

SUPPLEMENTARY FIGURES SUPPLEMENTARY FIGURES Figure S1. Effect of a HFD on the Acox gene expression in the livers of WT and IL-6 -/- mice. Expression of Acox in the livers of WT and IL-6 -/- mice fed STD or HFD determined through

More information

Supplemental Information. Increased 4E-BP1 Expression Protects. against Diet-Induced Obesity and Insulin. Resistance in Male Mice

Supplemental Information. Increased 4E-BP1 Expression Protects. against Diet-Induced Obesity and Insulin. Resistance in Male Mice Cell Reports, Volume 16 Supplemental Information Increased 4E-BP1 Expression Protects against Diet-Induced Obesity and Insulin Resistance in Male Mice Shih-Yin Tsai, Ariana A. Rodriguez, Somasish G. Dastidar,

More information

Supplementary Materials

Supplementary Materials Supplementary Materials 1 Supplementary Table 1. List of primers used for quantitative PCR analysis. Gene name Gene symbol Accession IDs Sequence range Product Primer sequences size (bp) β-actin Actb gi

More information

Supplementary Figure 1: Neuregulin 1 increases the growth of mammary organoids compared to EGF. (a) Mammary epithelial cells were freshly isolated,

Supplementary Figure 1: Neuregulin 1 increases the growth of mammary organoids compared to EGF. (a) Mammary epithelial cells were freshly isolated, 1 2 3 4 5 6 7 8 9 10 Supplementary Figure 1: Neuregulin 1 increases the growth of mammary organoids compared to EGF. (a) Mammary epithelial cells were freshly isolated, embedded in matrigel and exposed

More information

Supplementary Information. MicroRNA-33b knock-in mice for an intron of sterol regulatory

Supplementary Information. MicroRNA-33b knock-in mice for an intron of sterol regulatory Supplementary Information MicroRNA-33b knock-in mice for an intron of sterol regulatory element-binding factor 1 (Srebf1) exhibit reduced HDL-C in vivo Takahiro Horie, Tomohiro Nishino, Osamu Baba, Yasuhide

More information

Supplementary Table 1. Characterization of HNSCC PDX models established at MSKCC

Supplementary Table 1. Characterization of HNSCC PDX models established at MSKCC Supplementary Table 1. Characterization of HNSCC PDX models established at MSKCC Supplementary Table 2. Drug content and loading efficiency estimated with F-NMR and UV- Vis Supplementary Table 3. Complete

More information

3-Thia Fatty Acids A New Generation of Functional Lipids?

3-Thia Fatty Acids A New Generation of Functional Lipids? Conference on Food Structure and Food Quality 3-Thia Fatty Acids A New Generation of Functional Lipids? Rolf K. Berge rolf.berge@med.uib.no Fatty acids- Essential cellular metabolites Concentrations must

More information

ab Hepatic Lipid Accumulation/ Steatosis Assay Kit

ab Hepatic Lipid Accumulation/ Steatosis Assay Kit ab133131 Hepatic Lipid Accumulation/ Steatosis Assay Kit Instructions for Use For evaluating steatosis risk of drug candidates using Oil Red O to stain neutral lipids in hepatocytes. This product is for

More information

marker. DAPI labels nuclei. Flies were 20 days old. Scale bar is 5 µm. Ctrl is

marker. DAPI labels nuclei. Flies were 20 days old. Scale bar is 5 µm. Ctrl is Supplementary Figure 1. (a) Nos is detected in glial cells in both control and GFAP R79H transgenic flies (arrows), but not in deletion mutant Nos Δ15 animals. Repo is a glial cell marker. DAPI labels

More information

Epithelial interleukin-25 is a key mediator in Th2-high, corticosteroid-responsive

Epithelial interleukin-25 is a key mediator in Th2-high, corticosteroid-responsive Online Data Supplement: Epithelial interleukin-25 is a key mediator in Th2-high, corticosteroid-responsive asthma Dan Cheng, Zheng Xue, Lingling Yi, Huimin Shi, Kan Zhang, Xiaorong Huo, Luke R. Bonser,

More information

Supplemental Table 1. List of primers used for real time PCR.

Supplemental Table 1. List of primers used for real time PCR. Supplemental Table 1. List of primers used for real time PCR. Primer Sequence Primer Sequence Mouse Pcsk9-F TTGCAGCAGCTGGGAACTT Mouse Scd1-F CATCATTCTCATGGTCCTGCT Mouse Pcsk9-R CCGACTGTGATGACCTCTGGA Mouse

More information

ALT (U/L) (Relative expression) HDL (mm) (Relative expression) ALT (U/L) (Relative expression)

ALT (U/L) (Relative expression) HDL (mm) (Relative expression) ALT (U/L) (Relative expression) a DMT mrna () 8 6 r =.96 P =. DMT mrna () 8 6 r =. P =.6 DMT mrna () 8 6 r =.99 P =.6 DMT mrna () 8 6 r =. P =.9 DMT mrna () BMI (kg/m ) 8 6 r =.7 P =.966 DMT mrna () 8 ALT (U/L) 8 6 r = -.66 P =.76 DMT

More information

Dietary α-linolenic acid-rich flaxseed oil prevents against alcoholic hepatic steatosis

Dietary α-linolenic acid-rich flaxseed oil prevents against alcoholic hepatic steatosis Dietary α-linolenic acid-rich flaxseed oil prevents against alcoholic hepatic steatosis via ameliorating lipid homeostasis at adipose tissue-liver axis in mice Meng Wang a, Xiao-Jing Zhang a, Kun Feng

More information

A Hepatocyte Growth Factor Receptor (Met) Insulin Receptor hybrid governs hepatic glucose metabolism SUPPLEMENTARY FIGURES, LEGENDS AND METHODS

A Hepatocyte Growth Factor Receptor (Met) Insulin Receptor hybrid governs hepatic glucose metabolism SUPPLEMENTARY FIGURES, LEGENDS AND METHODS A Hepatocyte Growth Factor Receptor (Met) Insulin Receptor hybrid governs hepatic glucose metabolism Arlee Fafalios, Jihong Ma, Xinping Tan, John Stoops, Jianhua Luo, Marie C. DeFrances and Reza Zarnegar

More information

Supplemental Information. Induction of Expansion and Folding. in Human Cerebral Organoids

Supplemental Information. Induction of Expansion and Folding. in Human Cerebral Organoids Cell Stem Cell, Volume 20 Supplemental Information Induction of Expansion and Folding in Human Cerebral Organoids Yun Li, Julien Muffat, Attya Omer, Irene Bosch, Madeline A. Lancaster, Mriganka Sur, Lee

More information

a. b. c. d. e. f. g. h. i. j. k. l. m. n. o. p.

a. b. c. d. e. f. g. h. i. j. k. l. m. n. o. p. a. b. c. d. e. f. g. h. i. j. k. l. 2.5 2 1.5 1.5 IL-1β 12 8 6 4 2 IL-1β 9 8 7 6 4 3 3 2.9 IL-1β m. n. o. p. 1.8 1.6 1.4 1.2 1.8.6.4.2 6h LPS 2 15 1 5 6h LPS 2 6h LPS 6 4 3 6h LPS Supplementary Figure

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 10.1038/ncb2211 a! mir-143! b! mir-103/107! let-7a! mir-144! mir-122a! mir-126-3p! mir-194! mir-27a! mir-30c! Figure S1 Northern blot analysis of mir-143 expression dependent on feeding conditions.

More information

SUPPLEMENTAL MATERIALS AND METHODS. Puromycin-synchronized metabolic labelling - Transfected HepG2 cells were depleted of

SUPPLEMENTAL MATERIALS AND METHODS. Puromycin-synchronized metabolic labelling - Transfected HepG2 cells were depleted of SUPPLEMENTAL MATERIALS AND METHODS Puromycin-synchronized metabolic labelling - Transfected HepG2 cells were depleted of cysteine and methionine and then treated with 10 μm puromycin in depletion medium

More information

Supplemental Material:

Supplemental Material: Supplemental Material: MATERIALS AND METHODS RNA interference Mouse CHOP sirna (ON-TARGETplus SMARTpool Cat# L-062068-00) and control sirna (ON-TARGETplus Control) were purchased from Dharmacon. Transfection

More information

Gene Polymorphisms and Carbohydrate Diets. James M. Ntambi Ph.D

Gene Polymorphisms and Carbohydrate Diets. James M. Ntambi Ph.D Gene Polymorphisms and Carbohydrate Diets James M. Ntambi Ph.D Fatty Acids that Flux into Tissue Lipids are from Dietary Sources or are Made De novo from Glucose or Fructose Glucose Fructose Acetyl-CoA

More information

Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the

Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the genome-wide methylation microarray data. Mean ± s.d.; Student

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/8/407/ra127/dc1 Supplementary Materials for Loss of FTO in adipose tissue decreases Angptl4 translation and alters triglyceride metabolism Chao-Yung Wang,* Shian-Sen

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi: 1.138/nature7221 Brown fat selective genes 12 1 Control Q-RT-PCR (% of Control) 8 6 4 2 Ntrk3 Cox7a1 Cox8b Cox5b ATPase b2 ATPase f1a1 Sirt3 ERRα Elovl3/Cig3 PPARα Zic1 Supplementary Figure S1. stimulates

More information

Supplementary Figure 1

Supplementary Figure 1 Combination index (CI) Supplementary Figure 1 2. 1.5 1. Ishikawa AN3CA Nou-1 Hec-18.5...2.4.6.8 1. Fraction affected (Fa) Supplementary Figure 1. The synergistic effect of PARP inhibitor and PI3K inhibitor

More information

Supplemental Table 1: Demographics and characteristics of study participants. Male, n (%) 3 (20%) 6 (50%) Age, years [mean ± SD] 33.3 ± ± 9.

Supplemental Table 1: Demographics and characteristics of study participants. Male, n (%) 3 (20%) 6 (50%) Age, years [mean ± SD] 33.3 ± ± 9. SUPPLEMENTAL DATA Supplemental Table 1: Demographics and characteristics of study participants Lean (n=15) Obese (n=12) Male, n (%) 3 (20%) 6 (50%) Age, years [mean ± SD] 33.3 ± 9.5 44.8 ± 9.1 White, n

More information

Supplemental Table 1 Primer sequences (mouse) used for real-time qrt-pcr studies

Supplemental Table 1 Primer sequences (mouse) used for real-time qrt-pcr studies Supplemental Table 1 Primer sequences (mouse) used for real-time qrt-pcr studies Gene symbol Forward primer Reverse primer ACC1 5'-TGAGGAGGACCGCATTTATC 5'-GCATGGAATGGCAGTAAGGT ACLY 5'-GACACCATCTGTGATCTTG

More information

Name Animal source Vendor Cat # Dilutions

Name Animal source Vendor Cat # Dilutions Supplementary data Table S1. Primary and Secondary antibody sources Devi et al, TXNIP in mitophagy A. Primary Antibodies Name Animal source Vendor Cat # Dilutions 1. TXNIP mouse MBL KO205-2 1:2000 (WB)

More information

McAlpine PERK-GSK3 regulates foam cell formation. Supplemental Material. Supplementary Table I. Sequences of real time PCR primers.

McAlpine PERK-GSK3 regulates foam cell formation. Supplemental Material. Supplementary Table I. Sequences of real time PCR primers. Mclpine PERK-GSK3 regulates foam cell formation Supplemental Material Supplementary Table I. Sequences of real time PCR primers. Primer Name Primer Sequences (5-3 ) Product Size (bp) GRP78 (human) Fwd:

More information

Supplementary Figure 1: Hsp60 / IEC mice are embryonically lethal (A) Light microscopic pictures show mouse embryos at developmental stage E12.

Supplementary Figure 1: Hsp60 / IEC mice are embryonically lethal (A) Light microscopic pictures show mouse embryos at developmental stage E12. Supplementary Figure 1: Hsp60 / IEC mice are embryonically lethal (A) Light microscopic pictures show mouse embryos at developmental stage E12.5 and E13.5 prepared from uteri of dams and subsequently genotyped.

More information

Supplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice.

Supplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice. Supplementary Figures: Supplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice. Male apoe -/- mice were fed a high-fat diet for 8 weeks, and given PBS (model group) or

More information

Supplementary Figure S1. Flow cytometric analysis of the expression of Thy1 in NH cells. Flow cytometric analysis of the expression of T1/ST2 and

Supplementary Figure S1. Flow cytometric analysis of the expression of Thy1 in NH cells. Flow cytometric analysis of the expression of T1/ST2 and Supplementary Figure S1. Flow cytometric analysis of the expression of Thy1 in NH cells. Flow cytometric analysis of the expression of T1/ST2 and Thy1 in NH cells derived from the lungs of naïve mice.

More information

control kda ATGL ATGLi HSL 82 GAPDH * ** *** WT/cTg WT/cTg ATGLi AKO/cTg AKO/cTg ATGLi WT/cTg WT/cTg ATGLi AKO/cTg AKO/cTg ATGLi iwat gwat ibat

control kda ATGL ATGLi HSL 82 GAPDH * ** *** WT/cTg WT/cTg ATGLi AKO/cTg AKO/cTg ATGLi WT/cTg WT/cTg ATGLi AKO/cTg AKO/cTg ATGLi iwat gwat ibat body weight (g) tissue weights (mg) ATGL protein expression (relative to GAPDH) HSL protein expression (relative to GAPDH) ### # # kda ATGL 55 HSL 82 GAPDH 37 2.5 2. 1.5 1..5 2. 1.5 1..5.. Supplementary

More information

SUPPLEMENTARY INFORMATION Glucosylceramide synthase (GlcT-1) in the fat body controls energy metabolism in Drosophila

SUPPLEMENTARY INFORMATION Glucosylceramide synthase (GlcT-1) in the fat body controls energy metabolism in Drosophila SUPPLEMENTARY INFORMATION Glucosylceramide synthase (GlcT-1) in the fat body controls energy metabolism in Drosophila Ayako Kohyama-Koganeya, 1,2 Takuji Nabetani, 1 Masayuki Miura, 2,3 Yoshio Hirabayashi

More information

Supplementary Information

Supplementary Information Supplementary Information Notch deficiency decreases hepatic lipid accumulation by induction of fatty acid oxidation No-Joon Song,#, Ui Jeong Yun,#, Sunghee Yang, Chunyan Wu, Cho-Rong Seo, A-Ryeong Gwon,,

More information

The role of apolipoprotein D in lipid metabolism and metabolic syndrome

The role of apolipoprotein D in lipid metabolism and metabolic syndrome UQÀM: Department of Biological Sciences The role of apolipoprotein D in lipid metabolism and metabolic syndrome Catherine Mounier PhD Apolipoprotein D Apolipoprotéine D (apod) Secreted protein Associated

More information

Fig. S4. Current-voltage relations of iglurs. A-C: time courses of currents evoked by 100 ms pulses

Fig. S4. Current-voltage relations of iglurs. A-C: time courses of currents evoked by 100 ms pulses Fig. S1. Immunohistochemical detection of iglur2 protein in single islet cells. A: α cells identified using glucagon-specific antibody express the iglur2 subtype of AMPA receptor. 24 out of 26 identified

More information

Serum Amyloid A3 Gene Expression in Adipocytes is an Indicator. of the Interaction with Macrophages

Serum Amyloid A3 Gene Expression in Adipocytes is an Indicator. of the Interaction with Macrophages Serum Amyloid A3 Gene Expression in Adipocytes is an Indicator of the Interaction with Macrophages Yohei Sanada, Takafumi Yamamoto, Rika Satake, Akiko Yamashita, Sumire Kanai, Norihisa Kato, Fons AJ van

More information

Supplementary Table 1. Metabolic parameters in GFP and OGT-treated mice

Supplementary Table 1. Metabolic parameters in GFP and OGT-treated mice Supplementary Table 1. Metabolic parameters in GFP and OGT-treated mice Fasted Refed GFP OGT GFP OGT Liver G6P (mmol/g) 0.03±0.01 0.04±0.02 0.60±0.04 0.42±0.10 A TGs (mg/g of liver) 20.08±5.17 16.29±0.8

More information

PKCζ Promotes Breast Cancer Invasion by Regulating Expression of E-cadherin and Zonula Occludens-1 (ZO-1) via NFκB-p65

PKCζ Promotes Breast Cancer Invasion by Regulating Expression of E-cadherin and Zonula Occludens-1 (ZO-1) via NFκB-p65 SUPPLEMENTARY INFORMATION TITLE: PKCζ Promotes Breast Cancer Invasion by Regulating Expression of E-cadherin and Zonula Occludens-1 (ZO-1) via NFκB-p65 RUNNING TITLE: PKCζ-NFκB Signaling in Breast Cancer

More information

Cornstarch

Cornstarch Electronic Supplementary Material (ESI) for Food & Function. This journal is The Royal Society of Chemistry 2018 Supplementary data : Supplementary Table 1: Diet composition (g/kg) on the basis of the

More information

Supplementary Figure 1 a

Supplementary Figure 1 a Supplementary Figure a Normalized expression/tbp (A.U.).6... Trip-br transcripts Trans Trans Trans b..5. Trip-br Ctrl LPS Normalized expression/tbp (A.U.) c Trip-br transcripts. adipocytes.... Trans Trans

More information

Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 )

Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 ) 770 771 Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 ) Human CXCL1 GCGCCCAAACCGAAGTCATA ATGGGGGATGCAGGATTGAG PF4 CCCCACTGCCCAACTGATAG TTCTTGTACAGCGGGGCTTG

More information

Novel Reduction of PCSK9 Expression: Mechanistic Insights into the Anti-Atherosclerotic & Hypolipidemic Effects of Heat Shock Protein 27

Novel Reduction of PCSK9 Expression: Mechanistic Insights into the Anti-Atherosclerotic & Hypolipidemic Effects of Heat Shock Protein 27 Novel Reduction of PCSK9 Expression: Mechanistic Insights into the Anti-Atherosclerotic & Hypolipidemic Effects of Heat Shock Protein 27 Ed O Brien, Jean-Claude Bakala-N Goma, Chunhua Shi Cumming School

More information

Supplementary Materials for

Supplementary Materials for advances.sciencemag.org/cgi/content/full/1/9/e1500781/dc1 Supplementary Materials for pnaktide inhibits Na/K-ATPase reactive oxygen species amplification and attenuates adipogenesis Komal Sodhi, Kyle Maxwell,

More information

Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation.

Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation. Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation. (a) Embryonic fibroblasts isolated from wildtype (WT), BRAF -/-, or CRAF -/- mice were irradiated (6 Gy) and DNA damage

More information

Kaurenoic acid, a Diterpene Derived from Aralia continentalis, Alleviates Lipogenesis in HepG2 Cells.

Kaurenoic acid, a Diterpene Derived from Aralia continentalis, Alleviates Lipogenesis in HepG2 Cells. J Korean Med. 2015;36(4):74-79 pissn 1010-0695 eissn 2288-3339 Original Article Kaurenoic acid, a Diterpene Derived from Aralia continentalis, Alleviates Lipogenesis in HepG2 Cells. Yu Gon Kim 1*, Jae

More information

TBP (H) CACAGTGAATCTTGGTTGTAAACTTGA AAACCGCTTGGGATTATATTCG ANGPTL8 (H) CTGGGCCCTGCCTACCGAGA CCGATGCTGCTGTGCCACCA [1]

TBP (H) CACAGTGAATCTTGGTTGTAAACTTGA AAACCGCTTGGGATTATATTCG ANGPTL8 (H) CTGGGCCCTGCCTACCGAGA CCGATGCTGCTGTGCCACCA [1] ESM Table 1. Immunoblot antibodies. Primary Supplier Dilution Antibody Akt Cell Signaling 1:1000 Technology Phosphorylated Cell Signaling 1:1000 Akt (Ser 473) Technology PKCε Cell Signaling 1:1000 Technology

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature12652 Supplementary Figure 1. PRDM16 interacts with endogenous EHMT1 in brown adipocytes. Immunoprecipitation of PRDM16 complex by flag antibody (M2) followed by Western blot analysis

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature09667 A critical role for IGF-II in memory consolidation and enhancement Dillon Y. Chen, Sarah A. Stern, Ana Garcia-Osta, Bernadette Saunier-Rebori, Gabriella Pollonini, Dhananjay Bambah-Mukku,

More information

Supplementary Figure (OH) 22 nanoparticles did not affect cell viability and apoposis. MDA-MB-231, MCF-7, MCF-10A and BT549 cells were

Supplementary Figure (OH) 22 nanoparticles did not affect cell viability and apoposis. MDA-MB-231, MCF-7, MCF-10A and BT549 cells were Supplementary Figure 1. Gd@C 82 (OH) 22 nanoparticles did not affect cell viability and apoposis. MDA-MB-231, MCF-7, MCF-10A and BT549 cells were treated with PBS, Gd@C 82 (OH) 22, C 60 (OH) 22 or GdCl

More information

Requires Signaling though Akt2 Independent of the. Transcription Factors FoxA2, FoxO1, and SREBP1c

Requires Signaling though Akt2 Independent of the. Transcription Factors FoxA2, FoxO1, and SREBP1c Cell Metabolism, Volume 14 Supplemental Information Postprandial Hepatic Lipid Metabolism Requires Signaling though Akt2 Independent of the Transcription Factors FoxA2, FoxO1, and SREBP1c Min Wan, Karla

More information

Supporting Information

Supporting Information Supporting Information Charalambous et al. 10.1073/pnas.1406119111 SI Experimental Procedures Serum and Tissue Biochemistry. Enzymatic assay kits were used for determination of plasma FFAs (Roche), TAGs

More information

Regulation of Lipid Homeostasis: Lipid Droplets

Regulation of Lipid Homeostasis: Lipid Droplets Regulation of Lipid Homeostasis: Lipid Droplets Bernd Helms Article Brand Recter Hendrik Mertens 1 The Basics I: FAs The Basics II: FA Activation 2 Basics III: TG-FA Interplay. Why? Adipocytes 3 Foam cells

More information

Boucher et al NCOMMS B

Boucher et al NCOMMS B 1 Supplementary Figure 1 (linked to Figure 1). mvegfr1 constitutively internalizes in endothelial cells. (a) Immunoblot of mflt1 from undifferentiated mouse embryonic stem (ES) cells with indicated genotypes;

More information

Supplemental Information

Supplemental Information Electronic Supplementary Material (ESI) for Food & Function. This journal is The Royal Society of Chemistry 2016 Supplemental Information Supplementary Materials and Methods Materials Assay kits of total

More information

Supplementary Figure 1.

Supplementary Figure 1. Supplementary Figure 1. Increased β cell mass and islet diameter in βtsc2 -/- mice up to 35 weeks A: Reconstruction of multiple anti-insulin immunofluorescence images showing differences in β cell mass

More information

Endocannabinoid-activated Nlrp3 inflammasome in infiltrating macrophages mediates β- cell loss in type 2 diabetes

Endocannabinoid-activated Nlrp3 inflammasome in infiltrating macrophages mediates β- cell loss in type 2 diabetes Endocannabinoid-activated Nlrp3 inflammasome in infiltrating macrophages mediates β- cell loss in type 2 diabetes T Jourdan, G Godlewski, R Cinar, A Bertola, G Szanda, J Liu, J Tam, T Han, B Mukhopadhyay,

More information

Defective Hepatic Autophagy in Obesity Promotes ER Stress and Causes Insulin Resistance

Defective Hepatic Autophagy in Obesity Promotes ER Stress and Causes Insulin Resistance Cell Metabolism, Volume 11 Supplemental Information Defective Hepatic Autophagy in Obesity Promotes ER Stress and Causes Insulin Resistance Ling Yang, Ping Li, Suneng Fu, Ediz S. Calay, and Gökhan S. Hotamisligil

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/8/389/ra79/dc1 Supplementary Materials for HDL-bound sphingosine 1-phosphate acts as a biased agonist for the endothelial cell receptor S1P 1 to limit vascular

More information

HIV VPR alters fat metabolism. Dorothy E Lewis PhD/Ashok Balasubramanyam MD

HIV VPR alters fat metabolism. Dorothy E Lewis PhD/Ashok Balasubramanyam MD HIV VPR alters fat metabolism Dorothy E Lewis PhD/Ashok Balasubramanyam MD Old Dogma for HIV associated lipodystrophy Differentiation Block (PI) Lipoatrophy Apoptosis (NRTI) Stem cell Preadipocyte Adipocyte

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/8/366/ra25/dc1 Supplementary Materials for Viral entry route determines how human plasmacytoid dendritic cells produce type I interferons Daniela Bruni, Maxime

More information

ACC ELOVL MCAD. CPT1α 1.5 *** 0.5. Reverbα *** *** 0.5. Fasted. Refed

ACC ELOVL MCAD. CPT1α 1.5 *** 0.5. Reverbα *** *** 0.5. Fasted. Refed Supplementary Figure A 8 SREBPc 6 5 FASN ELOVL6.5.5.5 ACC.5.5 CLOCK.5.5 CRY.5.5 PPARα.5.5 ACSL CPTα.5.5.5.5 MCAD.5.5 PEPCK.5.5 G6Pase 5.5.5.5 BMAL.5.5 Reverbα.5.5 Reverbβ.5.5 PER.5.5 PER B Fasted Refed

More information

T H E J O U R N A L O F C E L L B I O L O G Y

T H E J O U R N A L O F C E L L B I O L O G Y T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Amelio et al., http://www.jcb.org/cgi/content/full/jcb.201203134/dc1 Figure S1. mir-24 regulates proliferation and by itself induces

More information

Quantitative Real-Time PCR was performed as same as Materials and Methods.

Quantitative Real-Time PCR was performed as same as Materials and Methods. Supplemental Material Quantitative Real-Time PCR Quantitative Real-Time PCR was performed as same as Materials and Methods. Expression levels in the aorta were normalized to peptidylprolyl isomerase B

More information

Supplementary Figure 1.

Supplementary Figure 1. Supplementary Figure 1. FGF21 does not exert direct effects on hepatic glucose production. The liver explants from C57BL/6J mice (A, B) or primary rat hepatocytes (C, D) were incubated with rmfgf21 (2

More information

SUPPORTING MATREALS. Methods and Materials

SUPPORTING MATREALS. Methods and Materials SUPPORTING MATREALS Methods and Materials Cell Culture MC3T3-E1 (subclone 4) cells were maintained in -MEM with 10% FBS, 1% Pen/Strep at 37ºC in a humidified incubator with 5% CO2. MC3T3 cell differentiation

More information

Metabolism dysregulation induces a specific lipid signature of nonalcoholic steatohepatitis in patients

Metabolism dysregulation induces a specific lipid signature of nonalcoholic steatohepatitis in patients Metaolism dysregulation induces a specific lipid signature of nonalcoholic steatohepatitis in patients Franck Chiappini, Audrey Coilly, Hanane Kadar, Philippe Gual, Alert Tran, Christophe Desterke, Didier

More information

Cytochrome-C (rat, mouse) forward GGAGGCAAGCATAAGACTGG. mouse hexokinase 2 gene, intron 9 reverse GGGAACACAAAAGACCTCTTCTGG

Cytochrome-C (rat, mouse) forward GGAGGCAAGCATAAGACTGG. mouse hexokinase 2 gene, intron 9 reverse GGGAACACAAAAGACCTCTTCTGG Supplementary Table 1. The sequences of oligonucleotide primers. Genes Sequence rat actin forward CGAGTACAACCTTCTTGCAG rat actin reverse GAGTCCTTCTGACCCATACC tubulin (rat, mouse) forward TAGCAGAGATCACCAATGCC

More information