Blood fatty acids understanding the relevance of different tissue fractions and interpreting circulating concentrations.

Size: px
Start display at page:

Download "Blood fatty acids understanding the relevance of different tissue fractions and interpreting circulating concentrations."

Transcription

1 Blood fatty acids understanding the relevance of different tissue fractions and interpreting circulating concentrations Leanne Hodson

2 Fatty acid composition as a biomarker of intake Complements dietary assessment Not error free but are objective biochemical measure that has the potential to be more precise than dietary assessment alone Assess dietary intake in relation to disease risk Compare dietary intakes within and between populations Monitor change or assess compliance to dietary intake over time

3 Classes of fatty acids Saturated fatty acids 14:0; 15:0; 16:0; 17:0; 18:0 Monounsaturated fatty acids 16:1 n-7; 18:1 n-9 Polyunsaturated fatty acids n-6: 18:2 n-6; 20:4 n-6 n-3: 18:3 n-3; 20:5 n-3; 22:5 n-3; 22:6 n-3

4 What lipid pools have been measured? Whole blood Monocytes Neutrophils Erythrocytes Platelets Plasma Plasma Triglyceride Cholesteryl Ester Non-esterified fatty acids Phospholipids - total phospholipids - sphingomyelin - phosphatidylcholine - phosphatidylserine - phosphatidylinositol - phosphatidylethanolamine Buccal cells Muscle Skin Adipose Tissue Subcutaneous: gluteal, arm, abdominal Intra-abdominal: omental, visceral, perirenal, mesenteric

5 Fatty acid composition: Adipose Tissue (mol%) Food % 16:1 n-7 (g/100g fatty acids) Chocolate 0.6 % Butter / Olive oil 1.4 % Lard 2.5 % Beef (rump steak) 3 % Trout/Tuna 9 %/4.2 % Macadamia nuts 19% Hodson L et al Prog Lipid Res (2008)

6 What does the fatty acid composition of plasma nonesterified fatty acids (NEFA) represent? Plasma NEFA composition (mol%) Adipose tissue has a slightly lower proportion of 16:0 but higher 18:1 n-9 than plasma NEFA. Both fractions have low abundance (<1 mol%) of long chain n-3 and n-6 polyunsaturated fatty acids. Similar abundance of 18:2 n-6. Plasma NEFA has a higher proportion of 18:0. Hodson L et al Prog Lipid Res (2008)

7 Efflux of NEFA from adipose tissue depots Efflux (µmol/min/100g tissue) = veno arterio difference of whole blood NEFA x blood flow Frayn KN et al Clin Sci (1989); McQuaid SE et al Obesity (2010)

8 Fasting efflux of NEFA from adipose tissue depots Efflux (µmol/min/100g tissue) = veno arterio difference of whole blood NEFA x blood flow 1190±196 µmol/min/100g tissue P< ±90 µmol/min/100g tissue 1495±249 µmol/min/100g tissue P= ±120 µmol/min/100g tissue The fatty acid composition of plasma NEFA will potentially be influenced to a greater extent by upper- rather than lower body adipose tissue composition. NEFA, non-esterified fatty acids Hodson L et al; unpublished data

9 Does the fatty acid composition of plasma NEFA reflect adipose tissue fatty acid composition? r s = 0.48 (P<0.05) r s = 0.23 (P=NS) r s = 0.73 (P<0.05) Hodson et al Prog Lipid Res (2008)

10 Fatty acid composition: Plasma Triglycerides Hodson et al Prog Lipid Res (2008)

11 Triglyceride rich lipoproteins (TRL) Fatty acid composition (mol%) Meal 4 h 6 h Chylomicron-TG Fatty acid composition (mol%) Meal 0 h 4 h 6 h VLDL-TG 0 Hodson et al AJP (2010) C14:0 C16:0 C16:1 C18:0 C18:1 C18:2 0 C14:0 C16:0 C16:1 C18:0 C18:1 C18:2

12 Plasma cholesteryl ester fatty acids (mol%) Plasma phospholipid fatty acids (mol%) Proportion (%) of major PL classes in plasma that contribute to total PL Lipoprotein composition Esterified cholesterol (% by wt) VLDL 14 LDL 40 HDL 16 Hodson et al Prog Lipid Res (2008) PL species Sphingomyelin Phosphatidylcholine Phosphatidylethanolamine 2-4 Phosphatidylserine 2 Phosphatidylinositol 0

13 Erythrocyte total phospholipids Platelet total phospholipids Compared to other lipid fractions plasma, erythrocyte and platelet total phospholipids: have similar or higher amounts of 18:0 compared to 18:1 n-9 have higher proportions of fatty acids with 20 carbons or more Proportion (%) of major PL classes in blood lipid fractions compared to other lipid fractions that contribute to total PL Whole blood: the pool is comprised of plasma (54% by volume) PL species Erythrocytes Platelets and various types of circulating cells (46% by volume). The Sphingomyelin contribution by cells other than erythrocytes is very small. Phosphatidylcholine Phosphatidylethanolamine Phosphatidylserine Phosphatidylinositol Hodson et al Prog Lipid Res (2008)

14 Plasma total fatty acids: what are you measuring? % by weight VLDL LDL HDL Triglyceride Phospholipid Cholesterol (free & esterified) Esterified cholesterol Hodson et al Prog Lipid Res (2008)

15 Effect of lipid profiles on plasma total fatty acid composition Group Subjects Age (y) BMI (kg/m 2 ) TG (mmol/l) NEFA (mmol/l) HDL-C (mmol/l) LDL-C (mmol/l) 1 8M 6F M 3F M 7F M Group 1 = young, healthy Group 2 = Familial combined hyperlipidaemia Group 3 = Type 2 diabetes Group 4 = Controls Quebec Cardiovascular Study Hodson et al Prog Lipid Res (2008) Abbreviations: M, males; F, females; BMI, body mass index; TG, triglyceride; NEFA, non-esterified fatty acids; HDL-C, high density lipoprotein cholesterol; LDL-C, low density lipoprotein cholesterol

16 Effect of lipid profiles on plasma total fatty acid composition Group 16:0 16:1 n-7 18:0 18:1n-9 18:2n-6 20:4n-6 20:5n-3 22:6n The variability in the individual fatty acids is: Long-chain (> 20 carbons) > 18 and 16 carbon unsaturated fatty acids > saturated fatty acids. Group 1 = young, healthy Group Alternative 2 = Familial interpretation: combined variability hyperlipidaemia in fatty acid composition relatively low given Group differences 3 = Type in lipoprotein 2 diabetes concentrations between groups. Group However: 4 = as Controls many studies Quebec report Cardiovascular small differences Study in fatty acid composition across groups, not taking lipoprotein concentrations into account could lead to erroneous differences! Hodson et al Prog Lipid Res (2008)

17 Different lipid fractions reflect dietary fat intakes over different periods Adipose tissue: Considered to be best long-term marker of dietary fatty acid intake due to the long half-life Calculated half-life of fatty acids 1-1.5y (Beyen et al 1980) Stable isotopes half-life of fatty acids 6-9 mth (Strawford et al 2004) Erythrocytes: Considered to be a superior long term marker compared to plasma Suggested to represent previous months of dietary fat intake due to halflife (~90 d) Plasma/Serum: Triglyceride fatty acid composition represents the previous day(s) fatty acid intake Phospholipids and cholesteryl ester fatty acid composition represent previous weeks to months of dietary intake

18 How rapidly do blood fatty acids change? SAFA Grp 1 2 1/2 wk Plasma triglyceride Plasma total phospholipids Plasma cholesteryl esters Platelet phosphatidylcholine Erythrocyte phosphatidylcholine n-6 PUFA /2 wk Skeaff et al J Nutr (2006)

19 15:0 (mol%) 18:2 n-6 (mol%) Temporal change in blood lipid fatty acids Plasma PL * Plasma CE Plasma PL * Erythrocyte PC * Plasma PL * Plasma CE * Skeaff et al J Nutr (2006) * significantly different (P < 0.01) from day 0; Data presented as mean (SD)

20 How rapidly do blood fatty acids change? Grp 1 SAFA 8 wk SAFA wk n-6 PUFA n-6 PUFA Grp 2 Hodson et al J Nutr (2014) 8 wk Plasma triglyceride Plasma phospholipids Plasma cholesteryl esters Plasma non-esterified fatty acids Erythrocyte phospholipids Erythrocyte phosphatidylcholine Buccal cell phospholipids Adipose tissue triglyceride (week 0 and 8) wk

21 Temporal change in blood lipid fatty acids 18:2n-6 18:2n-6 18:2n-6 If you have a (large) change in fatty acid composition of one blood lipid fraction you Adipose tissue Erythrocyte PC also tend to have (large) Buccal Cell Phospholipids 15:0 changes in other 15:0 15:0 fractions. Hodson et al J Nutr (2014)

22 Factors to consider: expression of data Relative: total of all fatty acids are summed to 100% values are individual fatty acids are not independent Reported as: % total fatty acids weight % (g/100g fatty acids) mol %: molecular percentage the number of molecules of the individual fatty acid as a percentage of the total number of fatty acid molecules (mol / 100 mol total fatty acids) Absolute: values of individual fatty acids independent of each other however if individuals have high circulating lipid concentrations this may obscure the fatty acid concentrations Reported as: mg/l or µmol/l

23 Factors to consider: other things Collection fasting, fed, standardisation of biopsy site etc Blood sample processing: plasma can be processed quicker than serum. Storage samples should ideally be stored at -80 C (particularly if being batched up) as changes occur in fatty acid composition when stored -20 C. Analytical reproducibility not often reported! In-house quality controls and quality insurance procedures should be in put in place. If making comparisons between groups other factors that may influence fatty acid composition such as exercise, sex, smoking, age should be considered.

24 What to measure? It depends on the question! Information about long-term intakes adipose tissue Information about recent intakes plasma phospholipids (or plasma CE) No additional information is gained by measuring erythrocytes! (analysis is more labour intensive )

25 The volunteers OxLip Group and CRU Thank you! Murray Skeaff Keith Frayn Fredrik Karpe Sandy Humphreys Camilla Pramfalk Catriona McNeil Charlotte Green Marje Gilbert Camilla Pramfalk Louise Dennis Rachel Craven-Todd Jane Cheeseman Sue Beatty Barbara Fielding

26

27 (mol%) Fatty acid composition: Adipose Tissue Abdominal Gluteal * * * * Pinnick K et al Diabetes (2012)

The art of tracing dietary fat in humans. Leanne Hodson

The art of tracing dietary fat in humans. Leanne Hodson The art of tracing dietary fat in humans Leanne Hodson Dietary fat Other lipoproteins: IDL, LDL, HDL Hodson and Fielding linical Lipidology (2010) Relationship between blood & dietary fatty acids Typically:

More information

Maintain Cholesterol

Maintain Cholesterol Maintain Cholesterol What is Cholesterol? Cholesterol is a Lipid Molecule that has a waxy appearance and is found in every cell of the body and has some important natural functions. It is manufactured

More information

ANSC/NUTR) 618 LIPIDS & LIPID METABOLISM Dietary fat and Cardiovascular Disease

ANSC/NUTR) 618 LIPIDS & LIPID METABOLISM Dietary fat and Cardiovascular Disease ANSC/NUTR) 618 LIPIDS & LIPID METABOLISM Dietary fat and Cardiovascular Disease I. Investigations in humans relating dietary fat intake to serum cholesterol A. Ansel Keys: the Keys Formula Cholesterol

More information

Nutrition & Wellness for Life 2012 Chapter 6: Fats: A Concentrated Energy Source

Nutrition & Wellness for Life 2012 Chapter 6: Fats: A Concentrated Energy Source Tools: Printer 8.5 x 11 paper Scissors Directions: 1. Print 2. Fold paper in half vertically 3. Cut along dashed lines Copyright Goodheart-Willcox Co., Inc. All rights reserved. Tissue in which the body

More information

Replacement Of Partially Hydrogenated Soybean Oil By Palm Oil In Margarine Without Unfavorable Effects On Serum Lipoproteins

Replacement Of Partially Hydrogenated Soybean Oil By Palm Oil In Margarine Without Unfavorable Effects On Serum Lipoproteins Replacement Of Partially Hydrogenated Soybean Oil By Palm Oil In Margarine Without Unfavorable Effects On Serum Lipoproteins Muller H, Jordal O, et al. (998) Replacement of partially hydrogenated soybean

More information

Nutrition, Food, and Fitness. Chapter 6 Fats: A Concentrated Energy Source

Nutrition, Food, and Fitness. Chapter 6 Fats: A Concentrated Energy Source Nutrition, Food, and Fitness Chapter 6 Fats: A Concentrated Energy Source Tools: Printer (color optional) 4 sheets of 8.5 x 11 paper Scissors Directions: 1. Print 2. Fold paper in half vertically 3. Cut

More information

Lipid/Lipoprotein Structure and Metabolism (Overview)

Lipid/Lipoprotein Structure and Metabolism (Overview) Lipid/Lipoprotein Structure and Metabolism (Overview) Philip Barter President, International Atherosclerosis Society Centre for Vascular Research University of New South Wales Sydney, Australia Disclosures

More information

Suppl. Table 1: CV of pooled lipoprotein fractions analysed by ESI-MS/MS

Suppl. Table 1: CV of pooled lipoprotein fractions analysed by ESI-MS/MS Supplement VLDL LDL HDL PC 3.3 1.77 1.3 LPC 4.82 2.5.35 SM 3.1 4.6 1.92 CER 2.17 6.3 4.15 PE 3.18 1.93 2.79 PE-pl 13.18 1.9 2.32 CE 2.9.65.4 FC.36 3.5 2.54 Suppl. Table 1: CV of pooled lipoprotein fractions

More information

1Why lipids cannot be transported in blood alone? 2How we transport Fatty acids and steroid hormones?

1Why lipids cannot be transported in blood alone? 2How we transport Fatty acids and steroid hormones? 1Why lipids cannot be transported in blood alone? 2How we transport Fatty acids and steroid hormones? 3How are dietary lipids transported? 4How lipids synthesized in the liver are transported? 5 Lipoprotien

More information

Pattern of lipid biomarkers and risk of cardiovascular disease

Pattern of lipid biomarkers and risk of cardiovascular disease Pattern of lipid biomarkers and risk of cardiovascular disease Robert Clarke Clinical Trial Service Unit University of Oxford 9 January 2017 Biomarkers for dietary fats Blood lipids (LDL, HDL, triglycerides,

More information

Lipids Types, Food Sources, Functions

Lipids Types, Food Sources, Functions Lipids Types, Food Sources, Functions What Are Lipids? Lipids Diverse group of molecules that are insoluble in water Fats The lipid content of diets and foods 1 Lipids in Body Cells and Tissues Types of

More information

13/09/2012. Dietary fatty acids. Triglyceride. Phospholipids:

13/09/2012. Dietary fatty acids. Triglyceride. Phospholipids: CARDIOVASCULAR DISEASES (CVD) and NUTRITION Major cause of morbidity & mortality in Canada & other developed countries e.g., majority of approved health claims on food labels relate to lowering CVD Relation

More information

BIOB111_CHBIO - Tutorial activity for Session 12

BIOB111_CHBIO - Tutorial activity for Session 12 BIOB111_CHBIO - Tutorial activity for Session 12 General topic for week 6 Session 12 Lipids Useful Links: 1. Animations on Cholesterol (its synthesis, lifestyle factors, LDL) http://www.wiley.com/college/boyer/0470003790/animations/cholesterol/cholesterol.htm

More information

Fats & Fatty Acids. Answer part 2: 810 Cal 9 Cal/g = 90 g of fat (see above: each gram of fat provies 9 Cal)

Fats & Fatty Acids. Answer part 2: 810 Cal 9 Cal/g = 90 g of fat (see above: each gram of fat provies 9 Cal) Fats & Fatty Acids Function of Fats Store energy (typically stored in the form of triglyceride fat molecules, shown on next page) Burn for energy (energy content is 9 Cal/g) Fatty acids are components

More information

Bringing metabolic profiling into clinical practice. Linda Mustelin, MD, PhD, MPH Senior Medical Scientist Nightingale Health

Bringing metabolic profiling into clinical practice. Linda Mustelin, MD, PhD, MPH Senior Medical Scientist Nightingale Health Bringing metabolic profiling into clinical practice Linda Mustelin, MD, PhD, MPH Senior Medical Scientist Nightingale Health Nightingale Health Ltd. Finnish biotech company specialized in comprehensive

More information

Skeletal muscle metabolism was studied by measuring arterio-venous concentration differences

Skeletal muscle metabolism was studied by measuring arterio-venous concentration differences Supplemental Data Dual stable-isotope experiment Skeletal muscle metabolism was studied by measuring arterio-venous concentration differences across the forearm, adjusted for forearm blood flow (FBF) (1).

More information

FAT. Dr. Shamsul Azahari Zainal Badari Department of Resource Management and Consumer Studies Faculty of Human Ecology

FAT. Dr. Shamsul Azahari Zainal Badari Department of Resource Management and Consumer Studies Faculty of Human Ecology FAT Dr. Shamsul Azahari Zainal Badari Department of Resource Management and Consumer Studies Faculty of Human Ecology OBJECTIVES LECTURE By the end of this lecture, student can: Define what is lipid/fat

More information

By: Dr Hadi Mozafari 1

By: Dr Hadi Mozafari 1 Biological lipids are a chemically diverse group of compounds, the common and defining feature of which is their insolubility in water. By: Dr Hadi Mozafari 1 Fats and oils are the principal stored forms

More information

Facts on Fats. Ronald P. Mensink

Facts on Fats. Ronald P. Mensink Facts on Fats Ronald P. Mensink Department of Human Biology NUTRIM, School for Nutrition, Toxicology and Metabolism Maastricht University Maastricht The Netherlands Outline of the Presentation Saturated

More information

OUTLINE. The need for fat. What is fat? Types of fats. Dietary sources of the different types of fat

OUTLINE. The need for fat. What is fat? Types of fats. Dietary sources of the different types of fat DIETARY FATS OUTLINE The need for fat What is fat? Types of fats Dietary sources of the different types of fat Evidence for cardiovascular health benefit of fish omega-3 and omega-6 fatty acids Possible

More information

Composition and Structure of Oil and Fats and its Relationship to Health and Nutrition

Composition and Structure of Oil and Fats and its Relationship to Health and Nutrition Composition and Structure of Oil and Fats and its Relationship to Health and Nutrition SB Neoh* & K. Sundram** * Managing Director, Soon Soon Oilmills Sdn Bhd, Malaysia **Deputy CEO and Director, Science

More information

Address for correspondence: Barbara Fielding Oxford Centre for Diabetes, Endocrinology and Metabolism Churchill Hospital Oxford OX3 7LJ

Address for correspondence: Barbara Fielding Oxford Centre for Diabetes, Endocrinology and Metabolism Churchill Hospital Oxford OX3 7LJ Tracing the fate of dietary fatty acids: metabolic studies of postprandial lipaemia in humans Barbara Fielding, Oxford Centre for Diabetes, Endocrinology and Metabolism, Churchill Hospital, Oxford, UK

More information

Future directions for nutritional and therapeutic research in omega-3 3 lipids

Future directions for nutritional and therapeutic research in omega-3 3 lipids Future directions for nutritional and therapeutic research in omega-3 3 lipids Philip Calder Professor of Nutritional Immunology University of Southampton Aim To review dietary sources and intakes of long

More information

Males- Western Diet WT KO Age (wks) Females- Western Diet WT KO Age (wks)

Males- Western Diet WT KO Age (wks) Females- Western Diet WT KO Age (wks) Relative Arv1 mrna Adrenal 33.48 +/- 6.2 Skeletal Muscle 22.4 +/- 4.93 Liver 6.41 +/- 1.48 Heart 5.1 +/- 2.3 Brain 4.98 +/- 2.11 Ovary 4.68 +/- 2.21 Kidney 3.98 +/-.39 Lung 2.15 +/-.6 Inguinal Subcutaneous

More information

Chapter (5) Etiology of Low HDL- Cholesterol

Chapter (5) Etiology of Low HDL- Cholesterol Chapter (5) Etiology of Low HDL- Cholesterol The aim of this chapter is to summarize the different etiological factors mainly the role of life-style and different disease conditions contributing to the

More information

High density lipoprotein metabolism

High density lipoprotein metabolism High density lipoprotein metabolism Lipoprotein classes and atherosclerosis Chylomicrons, VLDL, and their catabolic remnants Pro-atherogenic LDL HDL Anti-atherogenic Plasma lipid transport Liver VLDL FC

More information

Lipid Profiles. Important: Read over the section on correlation coefficients in the Guidelines for Statistics and Graphs in General Education Biology.

Lipid Profiles. Important: Read over the section on correlation coefficients in the Guidelines for Statistics and Graphs in General Education Biology. Biology 104 Lipid Profiles Important: Read over the section on correlation coefficients in the Guidelines for Statistics and Graphs in General Education Biology. Objectives: 1. Learn about the different

More information

Lipids are used to store and excess energy from extra carbohydrates in animals

Lipids are used to store and excess energy from extra carbohydrates in animals Lipids Lipids are a major source of energy used by cells, however lipids are more difficult for your body to break down. They produce nearly twice the amount of energy than proteins or carbohydrates. Lipids

More information

Assignment Lesson Plan: Healthy and Unhealthy Fats

Assignment Lesson Plan: Healthy and Unhealthy Fats Assignment Lesson Plan: Healthy and Unhealthy Fats Duration: 35 minutes Target Group: College students around the ages of 18 to 22 years old. Overall Goal: To increase knowledge of what healthy fats and

More information

Weight Loss NOTES. [Diploma in Weight Loss]

Weight Loss NOTES. [Diploma in Weight Loss] Weight Loss NOTES [Diploma in Weight Loss] Fat s: The good, the bad and the ugly Fat s function in your body 1. Energy stores 2. Muscle fuel 3. Transportation 4. Cell membrane 5. Padding 6. Muscle fuel

More information

PALM OLEIN BLENDING FOR TEMPERATE MARKET L/O/G/O

PALM OLEIN BLENDING FOR TEMPERATE MARKET L/O/G/O PALM OLEIN BLENDING FOR TEMPERATE MARKET L/O/G/O Basic Facts on Oil Palm Originated from West Africa, palm oil is the rich source of edible oil and has become important resource of vegetable oil in the

More information

Lipids, pt. 1. Feb. 3, Bio 28: Nutrition Instructor: Paul Nagami Laney College

Lipids, pt. 1. Feb. 3, Bio 28: Nutrition Instructor: Paul Nagami Laney College Lipids, pt. 1 Feb. 3, 2014 Bio 28: Nutrition Instructor: Paul Nagami Laney College Today s Agenda Reminders + Administrative Details What Are Lipids? Chemistry and Types of Lipids Fatty Acids Saturated

More information

CHAPTER FORTY FIVE ENDOGENOUS LIPID TRANSPORT PATHWAY: VLDL AND IDL

CHAPTER FORTY FIVE ENDOGENOUS LIPID TRANSPORT PATHWAY: VLDL AND IDL CHAPTER FORTY FIVE ENDOGENOUS LIPID TRANSPORT PATHWAY: VLDL AND IDL You will notice that the endogenous pathway is very similar to the exogenous pathway What is the average daily amount of triacylglycerol

More information

Lipids. PBHL 211 Darine Hachem, MS, LD

Lipids. PBHL 211 Darine Hachem, MS, LD Lipids PBHL 211 Darine Hachem, MS, LD Outline Functions of lipids in our body Types of lipids Sources of lipids Recommendation of fat intake Fat association with heart diseases Provide energy (9Kcal/g

More information

OPTION GROUP: BIOLOGICAL MOLECULES 2 LIPIDS & PHOSPHOLIPIDS WORKBOOK

OPTION GROUP: BIOLOGICAL MOLECULES 2 LIPIDS & PHOSPHOLIPIDS WORKBOOK NAME: OPTION GROUP: BIOLOGICAL MOLECULES 2 LIPIDS & PHOSPHOLIPIDS WORKBOOK Instructions REVISION CHECKLIST AND ASSESSMENT OBJECTIVES Regular revision throughout the year is essential. It s vital you keep

More information

Lipid & Fat: Overview

Lipid & Fat: Overview Lipid & Fat: Overview What is a lipid? Triglycerides, Phospholipids and Sterols Triglycerides = Fat Saturated & unsaturated Essential fatty acids ü Omega 3 & Omega 6 Trans fat Why do you need fat? How

More information

Dietary fat supplies essential body tissue needs, both as an energy fuel and a structural material.

Dietary fat supplies essential body tissue needs, both as an energy fuel and a structural material. Chapter 3 Fats Chapter 3 Lesson 3.1 Key Concepts Dietary fat supplies essential body tissue needs, both as an energy fuel and a structural material. Foods from animal and plant sources supply distinct

More information

ANSC/NUTR 618 LIPIDS & LIPID METABOLISM Lipoprotein Metabolism

ANSC/NUTR 618 LIPIDS & LIPID METABOLISM Lipoprotein Metabolism ANSC/NUTR 618 LIPIDS & LIPID METABOLISM Lipoprotein Metabolism I. Chylomicrons (exogenous pathway) A. 83% triacylglycerol, 2% protein, 8% cholesterol plus cholesterol esters, 7% phospholipid (esp. phosphatidylcholine)

More information

What Are Lipids? FaWy Acids Are Key Building Blocks. Lipids Include. Chapter 5 Lipids: Not Just Fat 6/17/16

What Are Lipids? FaWy Acids Are Key Building Blocks. Lipids Include. Chapter 5 Lipids: Not Just Fat 6/17/16 What Are Lipids? Chapter 5 Lipids: Not Just Fat BIOL 103 Essen@al nutrients Provide energy Help transport fat- soluble nutrients throughout the body Contribute greatly to the flavor and texture of food

More information

Fats and Other Lipids

Fats and Other Lipids Fats and Other Lipids Chapter 6 Chapter 6: Fats and other Lipids 1 6.1 Understanding Lipids Lipids include: 1. Fatty acids 2. Triglycerides 3. Phospholipids 4. Cholesterol Oil and Water Don t Mix Because

More information

Nafith Abu Tarboush DDS, MSc, PhD

Nafith Abu Tarboush DDS, MSc, PhD Nafith Abu Tarboush DDS, MSc, PhD natarboush@ju.edu.jo www.facebook.com/natarboush Lipids (cholesterol, cholesterol esters, phospholipids & triacylglycerols) combined with proteins (apolipoprotein) in

More information

BIOLOGY 111. CHAPTER 2: The Chemistry of Life Biological Molecules

BIOLOGY 111. CHAPTER 2: The Chemistry of Life Biological Molecules BIOLOGY 111 CHAPTER 2: The Chemistry of Life Biological Molecules The Chemistry of Life : Learning Outcomes 2.4) Describe the significance of carbon in forming the basis of the four classes of biological

More information

Fats = Lipids Organic compounds- mostly carbon Found in animals & plants Don t dissolve well in H20 Dissolve in organic solvents: ether, chloroform,

Fats = Lipids Organic compounds- mostly carbon Found in animals & plants Don t dissolve well in H20 Dissolve in organic solvents: ether, chloroform, FATS Fats = Lipids Organic compounds- mostly carbon Found in animals & plants Don t dissolve well in H20 Dissolve in organic solvents: ether, chloroform, toluene, methanol Assignment Oil and Water Fats

More information

METABOLISM of ADIPOSE TISSUE

METABOLISM of ADIPOSE TISSUE METABOLISM of ADIPOSE TISSUE 2. LF UK Prof. Rudolf Poledne, PhD. TYPES OF ADIPOSE TISSUE brown adipose tissue subcutaneous adipose tissue visceral adipose tissue ADIPOSE TISSUE FUNCTIONS: thermal isolation

More information

2.3 Carbon-Based Molecules. KEY CONCEPT Carbon-based molecules are the foundation of life.

2.3 Carbon-Based Molecules. KEY CONCEPT Carbon-based molecules are the foundation of life. KEY CONCEPT Carbon-based molecules are the foundation of life. Carbon atoms have unique bonding properties. Carbon forms covalent bonds with up to four other atoms, including other carbon atoms. Carbon-based

More information

STUDY OVERVIEW KEY TAKEAWAYS

STUDY OVERVIEW KEY TAKEAWAYS Avocado fruit on postprandial markers of cardio-metabolic risk: A randomized controlled dose response trial in overweight and obese men and women Britt Burton-Freeman, Eunyoung Park, Indika Edirisinghe

More information

Upper-body obesity, especially when associated. Similar VLDL-TG Storage in Visceral and Subcutaneous Fat in Obese and Lean Women

Upper-body obesity, especially when associated. Similar VLDL-TG Storage in Visceral and Subcutaneous Fat in Obese and Lean Women BRIEF REPORT Similar VLDL-TG Storage in Visceral and Subcutaneous Fat in Obese and Lean Women Esben Søndergaard, 1 Birgitte Nellemann, 1 Lars P. Sørensen, 1 Lars C. Gormsen, 2 Jens S. Christiansen, 1 Erik

More information

1. Most of your blood cholesterol is produced by: a. your kidneys b. your liver c. your pancreas d. food consumption (Your liver)

1. Most of your blood cholesterol is produced by: a. your kidneys b. your liver c. your pancreas d. food consumption (Your liver) I. TEST YOUR KNOWLEDGE OF CHOLESTEROL Choose the correct answer. 1. Most of your blood cholesterol is produced by: a. your kidneys b. your liver c. your pancreas d. food consumption (Your liver) 2. Only

More information

Upper-body obesity, especially when associated. Similar VLDL-TG Storage in Visceral and Subcutaneous Fat in Obese and Lean Women

Upper-body obesity, especially when associated. Similar VLDL-TG Storage in Visceral and Subcutaneous Fat in Obese and Lean Women BRIEF REPORT Similar VLDL-TG Storage in Visceral and Subcutaneous Fat in Obese and Lean Women Esben Søndergaard, 1 Birgitte Nellemann, 1 Lars P. Sørensen, 1 Lars C. Gormsen, 2 Jens S. Christiansen, 1 Erik

More information

Chapter 11 Nutrition: Food for Thought

Chapter 11 Nutrition: Food for Thought Chapter 11 Nutrition: Food for Thought Do you think about the food that goes into your body and how it affects you? How can you interpret the various nutrition information found in the press? What are

More information

Are you eating a balanced diet?

Are you eating a balanced diet? Are you eating a balanced diet? Do you know WHAT A BALANCED DIET IS? Eating a balanced diet means choosing a variety of foods & drinks from all the food groups Health Canada recommends 2-3 Tbsp of oil/day

More information

Effect of olive oil & tomato lycopene combination on some CHD risk factors

Effect of olive oil & tomato lycopene combination on some CHD risk factors Effect of olive oil & tomato lycopene combination on some CHD risk factors Kiran Ahuja Dale Kunde Madeleine Ball School of Human Life Sciences, University of Tasmania, Launceston Funding Clifford Craig

More information

MULTIPLE CHOICE. Choose the one alternative that best completes the statement or answers the question.

MULTIPLE CHOICE. Choose the one alternative that best completes the statement or answers the question. Exam Name MULTIPLE CHOICE. Choose the one alternative that best completes the statement or answers the question. 1) Which of the following is TRUE about essential fatty acids? 1) A) No vegetables contain

More information

A Closer Look at The Components Of a Balanced Diet

A Closer Look at The Components Of a Balanced Diet A Closer Look at The Components Of a Balanced Diet The essential nutrients are carbohydrates, fats, proteins, vitamins, minerals, dietary fibre and water. These nutrients will ensure that the systems and

More information

Cardiovascular risk potential of dietary saturated fats: an update and some implications

Cardiovascular risk potential of dietary saturated fats: an update and some implications Cardiovascular risk potential of dietary saturated fats: an update and some implications Gerard Hornstra, PhD Med" Prof. Em. of Experimental Nutrition" Maastricht University" The Netherlands" Cardiovascular

More information

Chapter Sections: 3.1 Carbon s Place in the Living World 3.2 Functional Groups 3.3 Carbohydrates 3.4 Lipids 3.5 Proteins 3.

Chapter Sections: 3.1 Carbon s Place in the Living World 3.2 Functional Groups 3.3 Carbohydrates 3.4 Lipids 3.5 Proteins 3. Chapter Sections: 3.1 Carbon s Place in the Living World 3.2 Functional Groups 3.3 Carbohydrates 3.4 Lipids 3.5 Proteins 3.6 Nucleic Acids Student Goals: By the end of this lecture series, students should

More information

Managing Cholesterol

Managing Cholesterol Managing Cholesterol Introduction Cholesterol is one of the most familiar medical words today. Cholesterol is a waxy substance that is very important for our body but could also be very dangerous if there

More information

The health benefits of shellfish: What should we be promoting? Professor Bruce Griffin Nutrition Division Faculty of Health & Medical Sciences

The health benefits of shellfish: What should we be promoting? Professor Bruce Griffin Nutrition Division Faculty of Health & Medical Sciences The health benefits of shellfish: What should we be promoting? Professor Bruce Griffin Nutrition Division Faculty of Health & Medical Sciences What should we be promoting? Define health benefits in terms

More information

'Eat Smart' - Nutrition for a Healthy Heart

'Eat Smart' - Nutrition for a Healthy Heart Definitions - Fats & Cholesterol Found in Blood LDL HDL 'low density lipoprotein' also known as 'bad cholesterol' major cholesterol-carrying molecule in blood delivers cholesterol to the arterial walls

More information

(a) Triglycerides contain fatty acids. Fatty acids are classified as saturated or unsaturated. H 2n O 2

(a) Triglycerides contain fatty acids. Fatty acids are classified as saturated or unsaturated. H 2n O 2 1 Triglycerides, amylose and glycogen are used to store energy in many living organisms. (a) Triglycerides contain fatty acids. Fatty acids are classified as saturated or unsaturated. The formula for a

More information

Nature Genetics: doi: /ng.3561

Nature Genetics: doi: /ng.3561 Supplementary Figure 1 Pedigrees of families with APOB p.gln725* mutation and APOB p.gly1829glufs8 mutation (a,b) Pedigrees of families with APOB p.gln725* mutation. (c) Pedigree of family with APOB p.gly1829glufs8

More information

Lipids digestion and absorption, Biochemistry II

Lipids digestion and absorption, Biochemistry II Lipids digestion and absorption, blood plasma lipids, lipoproteins Biochemistry II Lecture 1 2008 (J.S.) Triacylglycerols (as well as free fatty acids and both free and esterified cholesterol) are very

More information

The Effects of Lipids on the Body

The Effects of Lipids on the Body The Effects of Lipids on the Body Review: 3 general types 1. Triglycerides Major type of fat found in food and in bodies 2. Phospholipids In body: Carry food back and forth across cell membranes In food:

More information

The Effect of Replacing Coconut Oil for Shortening in Chocolate Chip Cookies. By Logan Jenney & Lindsey Poynter

The Effect of Replacing Coconut Oil for Shortening in Chocolate Chip Cookies. By Logan Jenney & Lindsey Poynter The Effect of Replacing Coconut Oil for Shortening in Chocolate Chip Cookies By Logan Jenney & Lindsey Poynter Abstract: Chocolate chip cookies are a popular baked good loved by consumers for several years

More information

Metabolism of medium and long chain triglycerides Role on energy balance. Hormone/Food intake pilot data

Metabolism of medium and long chain triglycerides Role on energy balance. Hormone/Food intake pilot data Medium Chain Triglycerides & Energy Balance Marie-Pierre St-Onge, Ph.D, FAHA New York Obesity Nutrition Research Center Columbia University Outline Metabolism of medium and long chain triglycerides Role

More information

Effects of Short-term High-carbohydrate Feeding on. Hypercholesterolaemia*

Effects of Short-term High-carbohydrate Feeding on. Hypercholesterolaemia* Archives of Disease in Childhood, 1970, 45, 393. Effects of Short-term High-carbohydrate Feeding on Serum Triglyceride of Children with Familial Hypercholesterolaemia* M. M. SEGALL, I. TAMIR, AUDREY S.

More information

1. FAT IS. The most CONCENTRATED source of food energy. There are 9 calories in every gram of fat. EAT SPARINGLY from the Fats & Oils Food Group

1. FAT IS. The most CONCENTRATED source of food energy. There are 9 calories in every gram of fat. EAT SPARINGLY from the Fats & Oils Food Group Fats 1. FAT IS The most CONCENTRATED source of food energy There are 9 calories in every gram of fat EAT SPARINGLY from the Fats & Oils Food Group Fats that are LIQUID at room temperature are called OILS.

More information

STUDY QUESTIONS, Chapter 5: The Lipids: Fats, Oils, Phospholipids and Sterols

STUDY QUESTIONS, Chapter 5: The Lipids: Fats, Oils, Phospholipids and Sterols STUDY QUESTIONS, Chapter 5: The Lipids: Fats, Oils, Phospholipids and Sterols To answer the next questions, read the introductory paragraphs, Introducing the Lipids and A Close Look at Lipids in Ch. 5.

More information

LIPIDS Dr. Latifah Al-Oboudi 2012

LIPIDS Dr. Latifah Al-Oboudi 2012 LIPIDS Dr. Latifah Al-Oboudi 2012 The Lipid Family Triglycerides Phospholipids Sterols All types of lipids are: soluble in organic solvents such as chloroform, benzene, and ether, but not in water. Differ

More information

Chapter 11: Lipids. Voet & Voet: Pages

Chapter 11: Lipids. Voet & Voet: Pages Chapter 11: Lipids Voet & Voet: Pages 380-394 Slide 1 Lipids Lipids are distinguished by their high solubility in non polar solvents and low solubility in H2O Diverse group of compounds including Fats,

More information

Fats: the good, the bad and the ugly. And don't forget cholesterol..

Fats: the good, the bad and the ugly. And don't forget cholesterol.. Page 1 Fats: the good, the bad and the ugly. And don't forget cholesterol.. The good The bad The ugly Of concern Polyunsaturated Monounsaturated Saturated Trans Cholesterol Oils from corn, soy, canola,

More information

Topic 11. Coronary Artery Disease

Topic 11. Coronary Artery Disease Topic 11 Coronary Artery Disease Lipid metabolism http://news.bbc.co.uk/2/hi/health/7372495.stm Sterol Metabolism and Coronary Artery Disease Big Picture: Exogenous Cholesterol and Fat Metabolism Fats-Triglycerides

More information

Lipid & Fat: Overview

Lipid & Fat: Overview Lipid & Fat: Overview What is a lipid? Triglycerides, Phospholipids and Sterols Triglycerides = Fat Saturated & unsaturated Essential fatty acids ü Omega 3 & Omega 6 Trans fat Why do you need fat? How

More information

Chapter VIII: Dr. Sameh Sarray Hlaoui

Chapter VIII: Dr. Sameh Sarray Hlaoui Chapter VIII: Dr. Sameh Sarray Hlaoui Lipoproteins a Lipids are insoluble in plasma. In order to be transported they are combined with specific proteins to form lipoproteins: Clusters of proteins and lipids.

More information

Glossary For TheFatNurse s For All Ages Series Apolipoprotein B (APOB or ApoB) are the primary apolipoproteins of chylomicrons and low-density lipoproteins (LDL - known commonly by the misnomer "bad cholesterol"

More information

Lipids do not like water! (aka: hydrophobic) Generally insoluble

Lipids do not like water! (aka: hydrophobic) Generally insoluble Lipids Lipids Lipids do not like water! (aka: hydrophobic) Generally insoluble Lipids They act like this because of their molecular structure (non-polar) Lipids are made mostly of C and H atoms, with O

More information

Lipoproteins Metabolism Reference: Campbell Biochemistry and Lippincott s Biochemistry

Lipoproteins Metabolism Reference: Campbell Biochemistry and Lippincott s Biochemistry Lipoproteins Metabolism Reference: Campbell Biochemistry and Lippincott s Biochemistry Learning Objectives 1. Define lipoproteins and explain the rationale of their formation in blood. 2. List different

More information

CHAPTER 28 LIPIDS SOLUTIONS TO REVIEW QUESTIONS

CHAPTER 28 LIPIDS SOLUTIONS TO REVIEW QUESTIONS 28 09/16/2013 17:44:40 Page 415 APTER 28 LIPIDS SLUTINS T REVIEW QUESTINS 1. The lipids, which are dissimilar substances, are arbitrarily classified as a group on the basis of their solubility in fat solvents

More information

Refresher: What do we remember about CARBON? What makes it special? Nickname? Where do we find it?

Refresher: What do we remember about CARBON? What makes it special? Nickname? Where do we find it? 2.3: Carbon Based Molecules Situation: You are tasked with making Chicken Parm and ziti for you entire family (aunts, uncles, cousins, etc). There are 92 different ingredients you have access to in the

More information

The WorkCare Group, Inc. Content used with permission. StayWell is a registered trademark of The StayWell Company. All rights reserved.

The WorkCare Group, Inc. Content used with permission. StayWell is a registered trademark of The StayWell Company. All rights reserved. Know Your Cholesterol Numbers Checklist for Lowering Your Cholesterol Cholesterol Questions to Ask Your Doctor Misconceptions about Cholesterol LDL and HDL Lowering Your Cholesterol CHECKLIST Cut down

More information

Walter B. Bayubay CLS (ASCP), AMT, MA Ed, CPI

Walter B. Bayubay CLS (ASCP), AMT, MA Ed, CPI Walter B. Bayubay CLS (ASCP), AMT, MA Ed, CPI Biochemical Analysis (Lipid Panel) Analyte Total Cholesterol Reference Range Patient A < 200 241 LDL-C /= 40 38 Triglycerides

More information

MCQS ON LIPIDS. Dr. RUCHIKA YADU

MCQS ON LIPIDS. Dr. RUCHIKA YADU MCQS ON LIPIDS Dr. RUCHIKA YADU Q1. THE FATS AND OILS ARE RESPECTIVELY RICH IN a) Unsaturated fatty acids b) Saturated fatty acids c) Saturated and unsaturated fatty acids d) None of these Q2. ESSENTIAL

More information

The Role of Monounsaturated Fatty Acids in Cardiovascular Disease. and Diabetes Mellitus Type 2. By Jovan Duvall. May 21 st 2012 NUTR 420

The Role of Monounsaturated Fatty Acids in Cardiovascular Disease. and Diabetes Mellitus Type 2. By Jovan Duvall. May 21 st 2012 NUTR 420 Duvall 1 The Role of Monounsaturated Fatty Acids in Cardiovascular Disease and Diabetes Mellitus Type 2 By Jovan Duvall May 21 st 2012 NUTR 420 Duvall 2 Introduction American s waistbands are not the only

More information

Widespread concern about the role of SFA in heart disease: Is it justified?

Widespread concern about the role of SFA in heart disease: Is it justified? Widespread concern about the role of SFA in heart disease: Is it justified? 1. What is the association of SFA intake and LDL-C? 2. Is LDL-C the best biomarker? 3. If SFA is reduced, does it matter what

More information

Unit IV Problem 3 Biochemistry: Cholesterol Metabolism and Lipoproteins

Unit IV Problem 3 Biochemistry: Cholesterol Metabolism and Lipoproteins Unit IV Problem 3 Biochemistry: Cholesterol Metabolism and Lipoproteins - Cholesterol: It is a sterol which is found in all eukaryotic cells and contains an oxygen (as a hydroxyl group OH) on Carbon number

More information

Gene Polymorphisms and Carbohydrate Diets. James M. Ntambi Ph.D

Gene Polymorphisms and Carbohydrate Diets. James M. Ntambi Ph.D Gene Polymorphisms and Carbohydrate Diets James M. Ntambi Ph.D Fatty Acids that Flux into Tissue Lipids are from Dietary Sources or are Made De novo from Glucose or Fructose Glucose Fructose Acetyl-CoA

More information

A COMPARATIVE STUDY ON THE EFFECTS OF VCO AND OTHER UNSATURATED OIL SOURCES ON THE LIPID PROFILE OF SPRAGUE DAWLEY RATS

A COMPARATIVE STUDY ON THE EFFECTS OF VCO AND OTHER UNSATURATED OIL SOURCES ON THE LIPID PROFILE OF SPRAGUE DAWLEY RATS A COMPARATIVE STUDY ON THE EFFECTS OF VCO AND OTHER UNSATURATED OIL SOURCES ON THE LIPID PROFILE OF SPRAGUE DAWLEY RATS Rosario S. Sagum, Ph.D., Mildred A. Udarbe, MSc., Trinidad P. Trinidad, Ph.D. And

More information

General Biochemistry-1 BCH 202

General Biochemistry-1 BCH 202 General Biochemistry-1 BCH 202 1 I would like to acknowledge Dr. Farid Ataya for his valuable input & help in this course. 2 Outline Lipids Definition, function, fatty acids, classification: simple lipids:

More information

Modifying effects of dietary polyunsaturated fatty acid (PUFA) on levels of cholesterol and their implications for heart health

Modifying effects of dietary polyunsaturated fatty acid (PUFA) on levels of cholesterol and their implications for heart health Modifying effects of dietary polyunsaturated fatty acid (PUFA) on levels of cholesterol and their implications for heart health Robert Clarke Clinical Trial Service Unit University of Oxford 28 th May

More information

Hmgcoar AGCTTGCCCGAATTGTATGTG TCTGTTGTAACCATGTGACTTC. Cyp7α GGGATTGCTGTGGTAGTGAGC GGTATGGAATCAACCCGTTGTC

Hmgcoar AGCTTGCCCGAATTGTATGTG TCTGTTGTAACCATGTGACTTC. Cyp7α GGGATTGCTGTGGTAGTGAGC GGTATGGAATCAACCCGTTGTC Supplement Table I: primers for Real Time RT-PCR Gene Foward Reverse Hmgcoar AGCTTGCCCGAATTGTATGTG TCTGTTGTAACCATGTGACTTC Cyp7α GGGATTGCTGTGGTAGTGAGC GGTATGGAATCAACCCGTTGTC Cyp27a1 GTGGTCTTATTGGGTACTTGC

More information

CHAPTER 28 LIPIDS SOLUTIONS TO REVIEW QUESTIONS

CHAPTER 28 LIPIDS SOLUTIONS TO REVIEW QUESTIONS HAPTER 28 LIPIDS SLUTINS T REVIEW QUESTINS 1. The lipids, which are dissimilar substances, are arbitrarily classified as a group on the basis of their solubility in fat solvents and their insolubility

More information

Dietary Reference Values: a Tool for Public Health

Dietary Reference Values: a Tool for Public Health HOGE GEZONDHEISRAAD Dietary Reference Values: a Tool for Public Health CONSEIL SUPERIEUR DE LA SANTE Belgian Dietary Reference Values for Energy and Macronutrients: FATS G. De Backer Brussels, February

More information

LIPIDS OF PHYSIOLOGICAL SIGNIFICANCE

LIPIDS OF PHYSIOLOGICAL SIGNIFICANCE LIPIDS OF PHYSIOLOGICAL SIGNIFICANCE Original slides. Important. 436 Notes 438 notes Extra information رابط التعديل: https://docs.google.com/document/d/1wvdec1atp7j- ZKWOUSukSLsEcosjZ0AqV4z2VcH2TA0/edit?usp=sharing

More information

THE EFFECT OF FATS IN HEALTH CARE

THE EFFECT OF FATS IN HEALTH CARE THE EFFECT OF FATS IN HEALTH CARE The Effect of Fats in Health Care Oroles FLORESCU 1 Abstract Health condition can be defined as a balance between two components: proper nutrition and appropriate physical

More information

: Overview of EFA metabolism

: Overview of EFA metabolism Figure 1 gives an overview of the metabolic fate of the EFAs when consumed in the diet. The n-6 and n-3 PUFAs when consumed in the form of dietary triglyceride from various food sources undergoes digestion

More information

teachers notes Answers to questions on Pupil sheets AO2: 1. A bar chart is the most suitable method of displaying the information.

teachers notes Answers to questions on Pupil sheets AO2: 1. A bar chart is the most suitable method of displaying the information. teachers notes AO2.1 AO2. Fats This exercise revises information on the structure of fats and encourages pupils to improve their diet with respect to fats. Some pupils may be over concerned with their

More information

The Role of LCPUFA in Obesity. M.Tom Clandinin. The Alberta Institute for Human Nutrition The University of Alberta Edmonton, Alberta, Canada

The Role of LCPUFA in Obesity. M.Tom Clandinin. The Alberta Institute for Human Nutrition The University of Alberta Edmonton, Alberta, Canada The Role of LCPUFA in Obesity by M.Tom Clandinin The Alberta Institute for Human Nutrition The University of Alberta Edmonton, Alberta, Canada How big is the Conceptual Problem? Some assumptions: 150lb

More information

Dietary Lipid Utilization by Haddock (Melanogrammus aeglefinus)

Dietary Lipid Utilization by Haddock (Melanogrammus aeglefinus) Dietary Lipid Utilization by Haddock (Melanogrammus aeglefinus) Santosh P. Lall & Dominic A. Nanton National Research Council of Canada Halifax, Canada vis, California ne 23, 2003 Body Components of Wild

More information

Palm Oil: A Preferred Healthy Dietary Choice

Palm Oil: A Preferred Healthy Dietary Choice Palm Oil: A Preferred Healthy Dietary Choice Kalyana Sundram, PhD Deputy Chief Executive Officer & Director, Science & Environment Malaysian Palm Oil Council (MPOC) Palm Kernel Oil (Oleochemical Applications

More information

2. lipophobic: Adverse to fat solvents; insoluble fat and fat solvents. 4. squalene: A cholesterol precursor found in whale liver and plants.

2. lipophobic: Adverse to fat solvents; insoluble fat and fat solvents. 4. squalene: A cholesterol precursor found in whale liver and plants. Chapter 5 Lipids Key Terms 1. hydrophilic: Can mix with or dissolve in water. 2. lipophobic: Adverse to fat solvents; insoluble fat and fat solvents. 3. adipocytes: Fat cells. 4. squalene: A cholesterol

More information