Variants of the microsomal triglyceride transfer protein gene are associated with plasma cholesterol levels and body mass index

Transcription

1 Vrints of the microsoml triglyceride trnsfer protein gene re ssocited with plsm cholesterol levels nd ody mss index Helen Ledmyr,* Fredrik Krpe,*, Björn Lundhl,* Mrgret McKinnon,* Cmill Skoglund-Andersson,* nd Ew Ehrenorg 1, * King Gustf V Reserch Institute,* Krolinsk Hospitl, SE , Stockholm, Sweden; nd Oxford Lipid Metolism Group, University of Oxford, United Kingdom Astrct The microsoml triglyceride trnsfer protein (MTP) is required for the ssemly nd secretion of polipoprotein B (pob)-contining lipoproteins from liver nd intestine. We set out to study the phenotypic modultion of ll common genetic vrints in the MTP gene. In ddition, we imed t chrcterizing the ssocition etween the vrious polymorphisms. A totl of 564 helthy men were genotyped for the MTP 493 G/T, 400 A/T, nd 164 T/C promoter polymorphisms, s well s the Q/H 95, I/T 128, Q/E 244, nd H/Q 297 missense polymorphisms. The 493 G/T, 164 T/C, nd I/T 128 polymorphisms showed to e in lmost complete linkge disequilirium. Sujects homozygous for the less common 493 T, 164 C, nd T 128 lleles showed significntly lower plsm totl nd LDL cholesterol levels nd plsm LDL pob levels, nd lso significntly higher ody mss index (BMI) nd plsm insulin levels compred with crriers of the common lleles. The ssocitions etween plsm totl cholesterol nd MTP 493 genotype ws verified in cohort consisting of 1,117 disese-free control sujects of the West of Scotlnd Coronry Prevention Study (WOSCOPS). None of the other polymorphisms showed ny significnt chnge in either lipid nd lipoprotein levels or nthropometric vriles. In summry, two promoter polymorphisms nd one missense polymorphism in the MTP gene lter plsm totl nd LDL cholesterol levels, plsm LDL pob levels, BMI, nd insulin levels. This my, in turn, hve implictions for genetic regultion of crdiovsculr risk fctors. Ledmyr, H., F. Krpe, B. Lundhl, M. McKinnon, C. Skoglund-Andersson, nd E. Ehrenorg. Vrints of the microsoml triglyceride trnsfer protein gene re ssocited with plsm cholesterol levels nd ody mss index. J. Lipid Res : Supplementry key words polymorphism crdiovsculr disese LDL cholesterol microsoml triglyceride trnsfer protein (ER) in the liver, intestine, nd hert (2 4). The function of MTP is to lipidte the growing polipoprotein B (pob) polypeptide chin during trnsltion, llowing pob to fold correctly nd ssemle lipoprotein with neutrl lipid core efore secretion (5, 6). The unique suunit confers the lipid trnsfer ctivity of the complex, wheres the PDI possesses the ER retention signl tht is crucil for its locliztion (5). Functionl MTP is n solute requirement for the ssemly nd cellulr secretion of pob-contining lipoproteins, nd muttions cusing dysfunction of the 97 kd suunit results in etlipoproteinemi (7 9). Recent studies indicte tht the ctul concentrtion of MTP in the ER is the criticl determinnt of lipoprotein secretion (10). As the intrcellulr concentrtion of MTP is tightly controlled, ny constitutive or induced ltertions in MTP expression is likely to hve n effect on secretion pttern of lipoproteins, nd genetic vriility my modulte MTP concentrtion nd/or ctivity. Incresed MTP expression hs lso een ssocited with oesity nd viscerl ft ccumultion in the rt (11). A common promoter polymorphism in the MTP gene, 493 G/T, hs een shown to influence the trnscriptionl ctivity nd to e ssocited with low plsm levels of LDL cholesterol in helthy middle-ged men (12). The phenotype is switched to low plsm triglyceride concentrtions on fmilil hypercholesterolemi ckground suggestive of gene-gene interction with the LDL receptor (13). However, study of the Frminghm Offspring Study cohort ws unle to detect corresponding phenotype (14). In contrst, recent study of the MTP 493 polymorphism in helthy young lck men showed ssocition with high LDL cholesterol nd high The microsoml triglyceride trnsfer protein (MTP) is heterodimeric lipid trnsfer protein tht consists of lrge unique 97 kd suunit nd protein disulfide isomerse (PDI) (1). MTP is present in high concentrtion on the luminl side of the endoplsmtic reticulum Arevitions: pob, polipoprotein B; BMI, ody mss index; ER, endoplsmtic reticulum; MTP, microsoml triglyceride trnsfer protein; PDI, protein disulfide isomerse. 1 To whom correspondence should e ddressed. e-mil: ew.ehrenorg@ks.se Journl of Lipid Reserch Volume 43,

2 plsm triglycerides (15). Presently, three promoter polymorphisms nd four common missense polymorphisms in the MTP gene hve een descried. The promoter polymorphisms re locted t positions 493 (G/T), 400 (A/T), nd 164 (T/C) upstrem of trnscription strt. The polymorphisms in the coding region ll led to exchnge of mino cid nd re thus puttively functionl. These missense polymorphisms, previously reported in Cucsins, re Q/H 95, I/T 128, Q/E 244, nd H/Q 297 (16). Aginst this ckground, we hypothesized tht the three promoter polymorphisms s well s the four mino cid chnges in the coding region of the MTP gene my influence plsm lipid nd lipoprotein levels. We set out to study this in lrge cohort of helthy 50-yer-old men in which there ws detiled informtion on plsm lipids, metolic, hormonl, nd nthropometric vriles. MATERIALS AND METHODS Humn sujects A totl of 564 helthy 50-yer-old men living in the northern region of the Stockholm re were recruited fter rndom popultion-sed screening. Exclusion criteri were chronic disese of ny kind, fmilil hypercholesterolemi, hyperthyroidism, liver disese, history of coronry hert disese or rteril thromoemolic disese, continuous tretment with ntihypertensive or lipid-lowering gents, lcohol use or ny psychitric disorders tht would interfere with complince, nd prticiption in other ongoing studies. Specific exclusion criteri were plsm LDL cholesterol levels ove 6.5 mm, fsting lood glucose levels ove 6.1 mm, serum thyroid-stimulting hormone (S-TSH) ove 5 mu/l, nd S-Cretinine ove 120 M. Only men of North Europen descent were included. The procedures descried in this study hve een pproved y the Ethics Committee t the Krolinsk Hospitl. All sujects gve informed consent to prticiption. A second cohort consisted of 1,117 disesefree control sujects of the West of Scotlnd Coronry Prevention Study (WOSCOPS): men 45 to 64 yers of ge. The smple, tken t rndom, ws used for the study of genotype-phenotype reltionship. The suset of 1,117 control sujects ws selected fter completion of the study to ensure tht they hd remined disese-free. The WOSCOPS hs previously een descried in detil (17, 18). The WOSCOPS ws pproved y the ethics committees of the University of Glsgow, the Krolinsk Hospitl, Stockholm, Sweden, nd ll prticipting helth ords. Blood smpling Venous lood smples were drwn into precooled sterile tues (Vcutiner, Becton Dickinson) contining N 2 -EDTA (finl concentrtion 4 mm), nd plsm ws immeditely recovered y low-speed centrifugtion (1.750 g, 20 min t 1 C). PMSF (10 mm, dissolved in isopropnol) nd protinin (1.4 mg/ml; Trsylol, Byer) were immeditely dded to the isolted plsm to concentrtions of 10 M nd 28 g/ml, respectively. Determintion of mjor plsm lipids, lipoproteins, nd insulin Fsting plsm concentrtions of cholesterol nd triglycerides in VLDL, LDL, nd HDL were determined y comintion of preprtive ultrcentrifugtion, precipittion of pob-contining lipoproteins, nd lipid determintion (19). Blood ws collected into vcutiner tues contining heprin (143 USP units) for determintion of insulin. Insulin ws mesured y ELISA sed on monoclonl ntiody ccording to the mnufcturer s dvice (DAKO Insulin, DAKO Dignostics Ltd.). In the WOSCOPS sujects, plsm totl cholesterol ws mesured twice during the course of the study, nd the men ws used s the se-line level (17). Sufrctiontion of pob-contining lipoproteins nd determintion of pob content LDL ws isolted y density grdient ultrcentrifugtion (20). After 16 h spin t 40,000 rpm nd 15 C (Beckmn SW40), the top 0.5 ml lyer ws spirted (VLDL). The tue ws then sliced 57 mm from the top to hrvest the frction (d kg/l) contining oth IDL nd LDL. The protein concentrtion of the isolted frction ws determined ccording to the method of Lowry et l. (21) fter ddition of SDS to the regent mixture to cler turidity. DNA nlysis The 493 G/T nd 400 A/T polymorphisms were genotyped s descried previously (12). All mplifictions were performed in 25 l rection mix contining 100 ng of genomic DNA, 0.8 M of ech primer, 2 mm of ech dntp (Boehringer Mnnheim, Germny), 1 unit Tq-polymerse (SDS Promeg, Mdison, WI), 50 mm KCl, 10 mm Tris-HCl, nd 0.1% Triton X-100. For genotyping of the MTP 164 T/C polymorphism, the MgCl 2 concentrtion ws 2 mm. Primers used were MTP164-1 (5 -GGTTTGGTTTAGCTCTCAAAAGTG) nd MTP164-2 (5 - AGTGAGGGAGTGACCCTCTTC). The mplifiction cycle strted with denturtion t 94 C for 3 min, followed y 40 cycles t 94 C for 45 s, 60 C for 30 s, nd 72 C for 1 min. A finl elongtion t 72 C for 5 min ended the rection. The nlysis of the MTP Q/H 95 polymorphism ws performed using primers MTP95-1 (5 -ATGAAGGATGTAAATGTTGAAAATGTGAATCTG CA) nd MTP95-2 (5 -AGTTGGAGAAAAAGTTGTGGAATC). Anneling temperture of this PCR ws 58 C nd the MgCl 2 concentrtion ws 2 mm. Also, in the nlysis of the I/T 128 polymorphism, primer MTP128-1 (5 -TTTTAACAGCTTTCTTTCTG TTACTC) ws used together with mismtch primer MTP128-2 (5 -GTTGTGGAATCTAAACGCCCCTTTATCCTTCCATGG). The PCR ws performed t n nneling temperture of 63 C nd MgCl 2 concentrtion of 3 mm. Primer MTP244-1 (5 -GATGATT ACTTGTTATAAAGATGG) nd the mismtch primer MTP244-2 (5 -AAAATTTTAGCATTATCTTACTTCG) were used to nlyze the MTP Q/E 244 polymorphism. Amplifiction ws performed with MgCl 2 concentrtion of 3 mm nd nneling temperture of 58 C. The nlysis of the MTP H/Q 297 polymorphism ws performed with primers MTP297-1 (5 -GAATGATTATAATATAG CATTTCC) nd MTP297-2 (5 -GTCTGATGTCATGATTATTCC), nd mplifiction ws performed t n nneling temperture of 52 C nd with finl MgCl 2 concentrtion of 3 mm. The PCR products were digested with 10 units of BsrI for detection of the 164 T/C nd H/Q 297, PstI for detection of the Q/H 95 polymorphism, BslI for the I/T 128 detection, nd XmnI for detection of the Q/E 244 polymorphisms, respectively. The digested frgments were seprted on 2.5 3% grose gels contining ethidium romide for visuliztion under UV light. The poe genotype ws determined s descried previously (22, 23). For the nlysis of the MTP 493 G/T polymorphism in the WOSCOPS sujects, ng of genomic DNA ws mplified in 50 l rection mix contining 0.1 M of ech primer, 3 mm MgCl, 15 mm Tris-HCl, ph 8.0, 50 mm KCl, nd 1 unit Ampli- TqGold (Applied Biosystems, NJ). Forwrd primers used were MTPNhe1 (5 -GCTAGCGCTGATTTGCTCCAAC) nd MTP493-U (5 -AGTTTCACACATAAGGACAATCATCTA). Reverse iotinleled primer ws MTP-4io (5 -CCAGCTAGGAGTCACTGA GA). The mplifiction strted with ctivtion of the Ampli- 52 Journl of Lipid Reserch Volume 43, 2002

3 TqGold t 95 C for 7 min followed y denturtion t 94 C for 45 s. The PCR mplifiction ws performed ccording to touchdown principle s follows: denturtion t 94 C for 45 s, nneling t 64 C (7 cycles), 60 C (7 cycles), 56 C (8 cycles), 54 C (8 cycles), 52 C (8 cycles), nd 48 C (13 cycles) for 30 s, respectively, nd elongtion t 72 C for 1 min. A finl elongtion t 72 C for 5 min ended the rection. Determintion of genotypes ws performed with rel-time sequencing using the Pyrosequencing equipment ccording to mnufcturer s dvice (Pyrosequencing AB, Uppsl, Sweden). The MTP493PSQ (5 -AAC ATTATTTTGAAGTGATTGG) or MTP493PSQ2 (5 -TATTTTG AAGTGATTGGT) ws used s sequencing primer. Sttisticl nlysis Allele frequencies were determined y gene counting. A 2 test ws used to compre the oserved numers of ech MTP genotype with those expected for popultion in Hrdy-Weinerg equilirium. The normlized linkge disequilirium coefficient (D ) for ll pirs of MTP polymorphisms ws clculted ccording to Ott (24). Distriution of continuous vriles in groups were expressed s mens SD. Coefficients of skewness were clculted to test devitions from norml distriution. Logrithmic trnsformtion ws performed on individul vlues of skewed vriles, nd norml distriution of trnsformed vlues ws confirmed efore sttisticl computtions nd significnce testing. One-wy nlyses of covrince (with BMI, insulin, or smoking s covrites) nd two-wy nlyses of vrince were performed to test whether genetic vrition in the MTP gene ws ssocited with differences in plsm lipid protein levels or nthropometric vriles. The Scheffé multiple comprison test ws used s post hoc test. All sttisticl nlyses were performed using SttView (SAS Institute Inc.) version for Windows. The sttisticl nlysis of the WOSCOPS dt ws per formed using the SAS Pckge version RESULTS Allele frequencies nd linkge disequilirium Three promoter ( 493 G/T, 400 A/T, nd 164 T/C) nd four missense polymorphisms (Q/H 95, I/T 128, Q/E 244, nd H/Q 297) in the MTP gene were nlyzed in 564 helthy 50-yer-old men of North Europen descent. Normlized linkge disequilirium coefficients (D ) nd llele frequencies ccording to MTP genotype re listed in Tle 1. The promoter polymorphisms, 493 G/T nd 164 T/C, oth showed rre llele frequencies of 0.24, wheres the T llele frequency of the 400 A/T polymorphism ws The Q/H 95 polymorphism showed rre llele frequency of 0.04, wheres the I/T 128 rre llele frequency ws The E llele frequency of the Q/E 244 polymorphism ws 0.06 nd the less common Q llele of the H/Q 297 polymorphism showed frequency of The 493 G/T, 164 T/C, nd I/T 128 polymorphisms were in lmost complete linkge disequilirium with D vlues vrying etween 0.95 nd 0.97 (P 0.001). The 400 A/T polymorphism showed D vlue of 0.96, which suggests n llelic ssocition with the 493 G/T polymorphism, ut other unknown ssocitions could not e excluded. Also, the 493 G/T nd the H/Q 297 polymorphisms showed sttisticlly significnt D vlue of 0.20 (P 0.001). Neither of the other polymorphisms, TABLE 1. Allele frequencies nd normlized linkge disequilirium coefficients (D ) ccording to MTP genotype Rre Allele Frequency D P 493 G/T A/T T/C Q/H I/T Q/E H/Q D vlue indictes linkge disequilirium with the 493 G/T polymorphism. Unle to discriminte etween llelic nd other unknown ssocitions. Unle to compute relile P vlue due to insignificnt numer of rre homozygotes in the cohort. Q/H 95 or Q/E 244, showed ny sttisticlly significnt D vlues when compred with the 493 G/T polymorphism. None of the llelic distriutions devited significntly from tht predicted y the Hrdy-Weinerg equilirium. Assocition of the MTP polymorphisms with lipid nd lipoprotein levels Men plsm concentrtions of totl nd LDL cholesterol re shown ccording to MTP genotype in Tle 2. Sujects homozygous for the 493 T llele hd lower totl cholesterol levels compred with crriers of the G llele (4.89 mm vs mm vs mm, respectively, P 0.03). This ws reflected y lower plsm LDL cholesterol levels (3.16 mm vs mm vs mm, P 0.03). Becuse the 164 T/C nd I/T 128 polymorphisms re in lmost complete llelic ssocition with the 493 G/T polymorphism, these polymorphisms lso showed sttisticlly significnt ssocitions with plsm totl nd LDL cholesterol with similr numericl vlues (dt not shown). To vlidte these findings, 1,117 disese-free control sujects of the WOSCOPS were genotyped for the 493 G/T polymorphism. Men plsm concentrtions of totl nd LDL cholesterol in control sujects in the WOSCOPS re shown ccording to MTP genotype in Tle 3. Individuls homozygous for the 493 T llele showed significntly lower totl cholesterol levels compred with crriers of the G llele (6.84 mm vs mm vs mm, respectively, P 0.04). There ws lso trend towrd decresed LDL cholesterol concentrtions in sujects homozygous for the T llele compred with sujects homozygous for the G llele (4.97 mm vs mm, respectively, P 0.04) Tle 3. No significnt chnge in plsm totl or LDL cholesterol levels were oserved for ny of the 400 A/T (dt not shown), Q/H 95, Q/E 244, or H/Q 297 genotype groups (Tle 2). In ddition, no significnt chnge in plsm totl or VLDL triglyceride levels or HDL cholesterol levels were oserved with ny MTP genotype group (Tles 2 nd 3). Assocition of the MTP genotypes with plsm totl nd LDL pob levels Men plsm concentrtions of totl nd LDL pob mesured in suset of the 564 sujects (etween 355 nd Ledmyr et l. MTP polymorphisms ffect plsm cholesterol levels 53

4 TABLE 2. Plsm concentrtions of lipids nd mjor lipoproteins in helthy sujects grouped ccording to MTP genotype Triglycerides Cholesterol Plsm Totl VLDL LDL HDL Plsm Totl VLDL LDL HDL mm mm MTP 493 G/T GG, n GT, n TT, n P MTP Q/H 95 QQ, n QH HH, n P MTP Q/E 244 QQ, n QE, n P MTP H/Q 297 HH, n HQ, n QQ, n P Vlues re men SD. Differences etween genotype groups were ssessed y ANOVA. P 0.05 re shown in old. Significntly different from individuls crrying the TT genotype. Significntly different from individuls crrying the QQ ccording to Sheffé s post hoc test for continuous vriles. 392 individuls, depending on ville genotype) re shown ccording to MTP genotype in Tle 4. Individuls homozygous for the 493 T llele showed significntly lower plsm LDL pob levels thn individuls crrying one or two copies of the 493 G llele (71.5 mg/l vs mg/l vs mg/l, respectively, P 0.01). Similr vlues were oserved for the 164 T/C nd I/T 128 genotype groups (dt not shown). This effect ws of the sme proportionl mgnitude s tht for LDL cholesterol. Also, individuls homozygous for the 400 T llele showed significntly decresed plsm LDL pob level compred with crriers of one or two A lleles (77.2 mg/l vs mg/l vs mg/l, respectively, P 0.03). The sme effect ws seen in individuls hetero- or homozygous for the 95 H llele (79.1 mg/l vs mg/l, respectively, P 0.03). No significnt chnges in plsm totl or LDL pob levels were oserved for either one of the Q/E 244 or H/Q 297 genotype groups (Tle 4). Assocition of the MTP genotypes with nthropometric vriles nd insulin Tle 5 shows insulin concentrtions nd nthropometric vriles in the cohort grouped ccording to MTP genotype. Sujects homozygous for the rre 493 T llele showed significnt increse in BMI (27.5 kg/m 2 vs kg/m 2 vs kg/m 2, respectively, P 0.02) nd significnt increse in wist circumference (100.8 cm vs cm vs cm, respectively, P 0.02) compred with sujects crrying one or two copies of the G llele. These ssocitions were lso seen in the 164 T/C nd I/T 128 genotype groups, nd in the 400 A/T genotype group (dt not shown). However, when djusting BMI nd wist circumference for insulin, the significnce etween these vriles nd MTP genotype groups ws lost, which indictes tht these vriles were interdependent. The significnt ltertions in plsm totl nd LDL cholesterol were still sttisticlly significnt fter djustment for insulin, TABLE 3. Plsm concentrtions of lipids nd mjor lipoproteins in control sujects grouped ccording to MTP 493 genotype in the WOSCOPS Triglycerides Plsm Totl Cholesterol Plsm Totl LDL HDL BMI mm mm kg/m 2 MTP 493 G/T GG, n GT, n TT, n P Vlues re men SD. Differences etween genotype groups were ssessed y ANOVA. WOSCOPS, West of Scotlnd Coronry Prevention Study. P 0.05 re shown in old. Significntly different from individuls crrying the TT genotype (P 0.04). 54 Journl of Lipid Reserch Volume 43, 2002

5 TABLE 4. Plsm concentrtions of totl nd LDL polipoprotein B ccording to MTP genotype Plsm Totl ApoB Plsm LDL ApoB mg/dl mg/dl MTP 493 G/T GG (n 220) (n 193) GT (n 150) (n 142) TT (n 22) (n 20) P MTP Q/H 95 QQ (n 368) (n 330) QH HH (n 24) (n 25) P MTP Q/E 244 QQ (n 352) (n 315) QE (n 39) (n 40) P MTP H/Q 297 HH (n 218) (n 203) HQ (n 152) (n 133) QQ (n 18) (n 16) P Vlues re men SD. Differences etween genotype groups were ssessed y ANOVA. P 0.05 re shown in old. Significntly different from individuls crrying the TT genotype. Significnt difference from individuls crrying the QH or HH genotype ccording to Sheffé s post hoc test for continuous vriles. BMI, nd smoking. To nlyze the potentil gene-environmentl interction etween oesity nd the MTP polymorphism, the cohort ws medin split for wist (medin 96 cm) nd BMI (medin 25.6 kg/m 2 ) Tle 6. This split enled the comprison of phenotypic modultion y the MTP polymorphism of strictly nonoese with modertely TABLE 5. overweight sujects. The LDL cholesterol modultion y the MTP polymorphism ws mintined only in the group with wist mesurement ove 96 cm, suggesting tht the effect ws dependent of oesity. Plsm triglycerides were not ffected y the medin split. Surprisingly, the BMI grdient ws completely lost in the nonoese group, wheres the genotype modultion on BMI ws lmost completely ccounted for y n effect in the modertely oese group. Furthermore, there ws significnt ggregtion of 493T llele crrier sttus in the modertely oese group. The Q/H 95, Q/E 244, or H/Q 297 genotype group could not e significntly ssocited with ny ltertions in BMI or wist circumference (Tle 5). In concordnce with the higher BMI nd wist mesurements, significntly higher levels of plsm insulin were oserved in individuls homozygous for the less common 493T llele (55.5 pm vs pm vs pm, P 0.05). The sme effect ws seen in individuls hetero- or homozygous for the 95 H llele (50.9 pm vs pm, respectively, P 0.04). No significnt chnges in plsm insulin levels were oserved for either one of the Q/E 244 or H/Q 297 genotype groups. DISCUSSION Secretion of pob-contining lipoproteins is dependent on expression of the MTP gene nd is regulted y lipid vilility (5, 6, 25). It is therefore plusile tht polymorphisms in the MTP gene would ffect the heptic secretion of pob-contining lipoproteins. The present study shows tht two promoter polymor- MTP genotypes in reltion with nthropometric vriles nd insulin BMI Wist Circumference Insulin kg/m 2 cm pmol/l MTP 493 G/T GG (n 315) (n 316) (n 315) GT (n 218) (n 218) (n 217) TT (n 30) (n 30) (n 30) P MTP Q/H 95 QQ (n 526) (n 527) (n 525) QH HH (n 36) (n 36) (n 36) P MTP Q/E 244 QQ (n 507) (n 508) (n 506) QE (n 55) (n 55) (n 55) P MTP H/Q 297 HH (n 349) (n 349) (n 349) HQ (n 187) (n 188) (n 186) QQ (n 20) (n 20) (n 20) P Vlues re men SD. Differences etween genotype groups were ssessed y ANOVA. P 0.05 re shown in old. Significntly different from individuls crrying the TT genotype. Significntly different from individuls crrying the QH or HH genotype ccording to Sheffé s post hoc test for continuous vriles. Ledmyr et l. MTP polymorphisms ffect plsm cholesterol levels 55

6 TABLE 6. MTP 493 G/T genotypes in reltion to LDL cholesterol, VLDL triglycerides, insulin, nd BMI LDL Cholesterol VLDL TG Insulin BMI mm mm mu/ml kg/m 2 Wist 96 cm GG (n 157) GT (n 117) TT (n 8) P Wist 96 cm GG (n 159) GT (n 101) TT (n 22) P BMI 25.6 kg/m 2 GG (n 156) GT (n 117) TT (n 9) P BMI 25.6 kg/m 2 GG (n 157) GT (n 98) TT (n 19) P Vlues re expressed mens. Differences etween genotype groups were ssessed y ANOVA. The cohort is split in two groups ccording to medin vlue. TG, triglycerides. P 0.05 re shown in old. Significntly different from individuls crrying the TT genotype ccording to Sheffé s post hoc test for continuous vriles. phisms nd one missense polymorphism in the MTP gene re in lmost complete linkge disequilirium. These three polymorphisms significntly ffect lipid, lipoprotein, nd LDL pob levels in helthy 50-yer-old men. Furthermore, disese-free slightly hypercholesterolemic men homozygous for the 493 T llele lso showed significntly lower plsm totl cholesterol levels, verifying the lipid findings in the middle-ged North Europen cohort. The 493 G/T nd to some extent the 164 T/C polymorphism, hve een investigted in other cohorts with differing results. Genotyping for the 493 G/T polymorphism of the Coronry Artery Risk Development in Young Adults popultion (young helthy lck men) showed n increse in totl plsm triglycerides s well s in LDL cholesterol (15). In ptients dignosed with fmilil hypercholesterolemi, serum triglycerides levels were 40% lower in sujects homozygous for the 493 T llele, ut the LDL cholesterol level ws not ffected (13). A previous study in helthy individuls showed significnt decrese in plsm totl nd LDL cholesterol in sujects homozygous for the rre 493 T llele (12). Although the Frminghm Offspring Study is prospective study consisting of individuls yers of ge nd similr ethnic ckground, there were no significnt ssocitions etween the MTP 493 G/T polymorphism nd lipid, lipoprotein, or nthropometric vriles. A possile explntion for the lck of ssocitions in the Frminghm Offspring Study is tht the dt from sujects with crdiovsculr disese hve een comined with dt from disese-free individuls, nd nlyzed together. Approximtely 12.6% (155/1,226) of sujects hd crdiovsculr disese in the Frminghm Offspring Study, wheres oth popultions in the present study consist of 1,681 disesefree individuls. Another difference etween the Frminghm Offspring Study nd the cohorts in the present study is the fct tht some individuls in the Frminghm Offspring Study re closely relted individuls, which is not the cse in the present study. Previously, only one study involving the 164 T/C polymorphism hs een pulished. The sujects investigted were ptients dignosed with myocrdil infrction nd ge-mtched controls [the Etude Cs-Témoins sur l Infrctus du Myocrde (ECTIM) study]; this study ws not le to detect ny significnt ssocition etween ltertions of plsm triglycerides or LDL cholesterol (26). This is in greement with unpulished oservtions from our group showing tht the MTP 493 G/T polymorphism hs no effect on plsm lipid levels in group of 200 survivors of first myocrdil infrction efore the ge of 45 nd, therefore, rgues tht disese sttes influencing lipid metolism my override the phenotypic modultion y the polymorphism. The present study shows significnt 9% decrese in plsm totl cholesterol levels, 12% decrese in LDL cholesterol levels, nd 17% decrese in plsm LDL pob levels in sujects homozygous for the rre MTP 493T/ 164C/T128 lleles. Differences in inclusion criteri s well s disese stte re likely to contriute in explining the contrdictory results. The ssocition etween the 493 G/T polymorphism nd plsm totl cholesterol levels ws verified in lrge cohort consisting of 1,117 disese-free modertely hypercholesterolemic men prticipting in the WOSCOPS. Furthermore, significnt decrese of LDL cholesterol concentrtion ws noted for sujects homozygous for the T llele compred with sujects homozygous for the G llele. The WOSCOPS popultion ws recruited on the sis of moderte hypercholesterolemi nd the selection ws mde within rther nrrow limit ( mm LDL cholesterol) (17). This my hve restricted the expression of the MTP phenotype, which ws smller in mgnitude compred with our selected Swedish popultion. The polymorphism locted t 493 upstrem from trnscription strt is the only one in this study tht hs een investigted in vitro, nd the study showed n incresed expression of the MTP gene with the rre T llele (12). Becuse homozygous crriers of the T llele hve een shown to hve fewer ut more lipid-rich prticles, we hypothesized tht n incresed expression of the MTP gene would led to more efficient lipidtion of immture VLDL prticles (12). As lrge VLDLs re not direct precursors of LDL, the input from VLDL to the LDL frction will decrese nd this, in turn, would explin the lower LDL cholesterol level seen in sujects homozygous for the MTP 493 T llele. No gene dose effect is ovious for the 493 G/T polymorphism, which is in greement with findings regrding the previously reported MTP muttions cusing etlipoproteinemi (7, 9). No mjor chnge in lipid or lipoprotein concentrtion hs een thus noted for heterozygous crriers of MTP muttions. MTP polymorphisms hve not previously een ssoci- 56 Journl of Lipid Reserch Volume 43, 2002

7 ted with the degree of oesity such s BMI or wist circumference ut, in this study, we show n increse in oth BMI nd wist circumference in individuls homozygous for the rre 493T/ 164C/T128 lleles. The sis of the unexpected ut pprent reltionship is difficult to understnd. Although it my e speculted tht the triglycerides of lrge VLDL my e preferentilly deposited into dipose tissue, this does not explin the full effect, s it must lso involve n imlnce etween energy intke nd expenditure. Therefore, it cnnot e ssumed tht these vritions in BMI nd wist circumference re cused y specific MTP genotype. One cnnot exclude the possiility of linkge disequilirium etween the rre 493/ 164/128 lleles nd functionl polymorphism in n diposity-regulting gene locted in the sme chromosoml region. Recently, genome-wide scn for genes influencing the propensity to store ft in the dominl re showed evidence of linkge to the long rm of chromosome 4 (27). The MTP genotypic effect shown in the present study seemed to e independent of oesity: Numericlly, the sme group differences were otined in the oese nd nonoese groups, ut the lower LDL cholesterol level in the homozygous crriers of the less common vrint ws not sttisticlly significnt in the nonoese group, s it contined only nine sujects. In summry, we found tht two polymorphisms in the promoter region, nd one missense polymorphism in exon 3 of the MTP gene re in lmost complete linkge disequilirium, nd individuls homozygous for the three rre lleles show significntly decresed levels of plsm totl nd LDL cholesterol nd plsm pob. The sme individuls lso show significntly higher BMI nd wist circumference mesurements nd plsm insulin levels. Bsed on these findings, we herey suggest tht genetic vrition in the MTP gene my hve importnt implictions for the development of crdiovsculr disese in humns. Professor Chris Pckrd, Dr. Alex McMhon, nd the WOSCOPS investigtors re thnked for ssistnce with the study. The present study ws supported y grnts from the Hert-Lung Foundtion, the Swedish Medicl Reserch Council (12659), the Swedish Medicl Society, nd the following foundtions: Hrld nd Gret Jensson, Sigurd nd Els Golje Memoril, Fredrik nd Ingrid Thuring, Tore Nilson, the Mgn. Bergwll, Professor Nnn Svrtz, the Old Servnts, nd the Lrs Hiert Memoril. Helen Ledmyr is supported y Ph.D. studentship from the Ntionl Network for Crdiovsculr Reserch. Mnuscript received 5 Mrch 2001, in revised form 13 August 2001, nd in re-revised form 8 Octoer REFERENCES 1. Wetteru, J. R., K. A. Coms, S. N. Spinner, nd B. J. Joiner Protein disulfide isomerse is component of the microsoml triglyceride trnsfer protein complex. J. Biol. Chem. 265: Wetteru, J. R., nd D. B. Zilversmit Locliztion of intrcellulr tricylglycerol nd cholesteryl ester trnsfer ctivity in rt tissues. Biochim. Biophys. Act. 875: Boren, J., M. M. Venint, nd S. G. Young Apo B100- contining lipoproteins re secreted y the hert. J. Clin. Invest. 101: Nielsen, L. B., M. Venint, J. Boren, M. Re, J. S. Wong, C. Tm, L. Flynn, T. Vnni-Reyes, M. D. Gunn, I. J. Golderg, R. L. Hmilton, nd S. G. Young Genes for polipoprotein B nd microsoml triglyceride trnsfer protein re expressed in the hert: evidence tht the hert hs the cpcity to synthesize nd secrete lipoproteins. Circultion. 98: Gordon, D. A., H. Jmil, D. Shrp, D. Mullney, Z. Yo, R. E. Gregg, nd J. Wetteru Secretion of polipoprotein B- contining lipoproteins from HeL cells is dependent on expression of the microsoml triglyceride trnsfer protein nd is regulted y lipid vilility. Proc. Ntl. Acd. Sci. USA. 91: Leiper, J. M., J. D. Byliss, R. J. Pese, D. J. Brett, J. Scott, nd C. C. Shoulders Microsoml triglyceride trnsfer protein, the etlipoproteinemi gene product, medites the secretion of polipoprotein B-contining lipoproteins from heterologous cells. J. Biol. Chem. 269: Wetteru, J. R., L. P. Aggereck, M. E. Boum, C. Eisenerg, A. Munck, M. Hermier, J. Schmitz, G. Gy, D. J. Rder, nd R. E. Gregg Asence of microsoml triglyceride trnsfer protein in individuls with etlipoproteinemi. Science. 258: Shrp, D., L. Blindermn, K. A. Coms, B. Kienzle, B. Ricci, K. Wger- Smith, C. M. Gil, C. W. Turck, M. E. Boum, D. J. Rder, L. P. Aggereck, R. E. Gregg, D. Gordon, nd J. R. Wetteru Cloning nd gene defects in microsoml triglyceride trnsfer protein ssocited with etlipoproteinemi. Nture. 365: Shoulders, C. C., D. J. Brett, J. D. Byliss, T. M. Nrcisi, A. Jrmuz, T. T. Grnthm, P. R. Leoni, S. Bhttchry, R. J. Pese, P. M. Cullen, S. Levi, P. Byfield, P. Purkiss, nd J. Scott Aetlipoproteinemi is cused y defects of the gene encoding the 97 kd suunit of microsoml triglyceride trnsfer protein. Hum. Mol. Genet. 2: Leung, G. K., M. M. Venint, S. K. Kim, C. H. Zlot, M. Re, J. Bjorkegren, R. A. Neese, M. K. Hellerstein, nd S. G. Young A deficiency of microsoml triglyceride trnsfer protein reduces polipoprotein B secretion. J. Biol. Chem. 275: Kuriym, H., S. Ymshit, I. Shimomur, T. Funhshi, M. Ishigmi, K. Argne, K. Miyok, T. Nkmur, K. Tkemur, Z. Mn, K. Toide, N. Nkym, Y. Fukud, M. C. Lin, J. R. Wetteru, nd Y. Mtsuzw Enhnced expression of heptic cyl-coenzyme A synthetse nd microsoml triglyceride trnsfer protein messenger RNAs in the oese nd hypertriglyceridemic rt with viscerl ft ccumultion. Heptology. 27: Krpe, F., B. Lundhl, E. Ehrenorg, P. Eriksson, nd A. Hmsten A common functionl polymorphism in the promoter region of the microsoml triglyceride trnsfer protein gene influences plsm LDL levels. Arterioscler. Throm. Vsc. Biol. 18: Lundhl, B., T. P. Leren, L. Ose, A. Hmsten, nd F. Krpe A functionl polymorphism in the promoter region of the microsoml triglyceride trnsfer protein (MTP 493G/T) influences lipoprotein phenotype in fmilil hypercholesterolemi. Arterioscler. Throm. Vsc. Biol. 20: Couture, P., J. D. Otvos, L. A. Cupples, P. W. Wilson, E. J. Schefer, nd J. M. Ordovs Asence of ssocition etween genetic vrition in the promoter of the microsoml triglyceride trnsfer protein gene nd plsm lipoproteins in the Frminghm Offspring Study. Atherosclerosis. 148: Juo, S. H., Z. Hn, J. D. Smith, L. Colngelo, nd K. Liu Common polymorphism in promoter of microsoml triglyceride trnsfer protein gene influences cholesterol, ApoB, nd triglyceride levels in young fricn mericn men: results from the coronry rtery risk development in young dults (CARDIA) study. Arterioscler. Throm. Vsc. Biol. 20: Nrcisi, T. M., C. C. Shoulders, S. A. Chester, J. Red, D. J. Brett, G. B. Hrrison, T. T. Grnthm, M. F. Fox, S. Povey, T. W. de Bruin, D. W. Erkelens, D. Muller, J. K. Lloyd, nd J. Scott Muttions of the microsoml triglyceride-trnsfer-protein gene in etlipoproteinemi. Am. J. Hum. Genet. 57: Shepherd, J., S. M. Coe, I. Ford, C. G. Isles, A. R. Lorimer, P. W. McFrlne, J. H. McKillop, nd C. J. Pckrd Prevention of coronry hert disese with prvsttin in men with hypercholesterolemi. West of Scotlnd Coronry Prevention Study Group. N. Engl. J. Med. 333: Pckrd, C. J., D. S. O Reilly, M. J. Cslke, A. D. McMhon, I. Ford, J. Cooney, C. H. Mcphee, K. E. Suckling, M. Krishn, F. E. Wilkinson, A. Rumley, nd G. D. Lowe Lipoprotein-ssocited phospholipse A2 s n independent predictor of coronry Ledmyr et l. MTP polymorphisms ffect plsm cholesterol levels 57

8 hert disese. West of Scotlnd Coronry Prevention Study Group. N. Engl. J. Med. 343: Crlson, K Lipoprotein frctiontion. J. Clin. Pthol. 5: Krpe, F., nd A. Hmsten Determintion of polipoproteins B-48 nd B-100 in triglyceride-rich lipoproteins y nlyticl SDS-PAGE. J. Lipid Res. 35: Lowry, O. H., A. C. Roserough, A. C. Frr, nd R. J. Rndll Protein mesurement with the Folin phenol regent. J. Biol. Chem. 193: vn den Mgdenerg, A. M., P. de Knijff, A. F. Stlenhoef, J. A. Gevers Leuven, L. M. Hvekes, nd R. R. Frnts Apolipoprotein E*3-Leiden llele results from prtil gene dupliction in exon 4. Biochem. Biophys. Res. Commun. 165: Hixson, J. E., nd D. T. Vernier Restriction isotyping of humn polipoprotein E y gene mplifiction nd clevge with HhI. J. Lipid Res. 31: Ott, J Anlysis of Humn Genetic Linkge. Rev. edition. Johns Hopkins University Press, Bltimore, MD. 25. Tietge, U. J., A. Bkillh, C. Mugeis, K. Tsukmoto, M. Hussin, nd D. J. Rder Heptic overexpression of microsoml triglyceride trnsfer protein (MTP) results in incresed in vivo secretion of VLDL triglycerides nd polipoprotein B. J. Lipid Res. 40: Herrmnn, S. M., O. Poirier, V. Nicud, A. Evns, J. B. Ruidvets, G. Luc, D. Arveiler, C. Bo-Sheng, nd F. Cmien Identifiction of two polymorphisms in the promoter of the microsoml triglyceride trnsfer protein (MTP) gene: lck of ssocition with lipoprotein profiles. J. Lipid Res. 39: Perusse, L., T. Rice, Y. C. Chgnon, J. P. Despres, S. Lemieux, S. Roy, M. Lcille, M. A. Ho-Kim, M. Chgnon, M. A. Province, D. C. Ro, nd C. Bouchrd A genome-wide scn for dominl ft ssessed y computed tomogrphy in the Queec Fmily Study. Dietes. 50: Journl of Lipid Reserch Volume 43, 2002