Vincenzo Di Marzo Endocannabinoid id Research Group C di t d b Istituto di Chimica Biomolecolare C.N.R., Pozzuoli (NA), Italy
|
|
- Roger Stafford
- 6 years ago
- Views:
Transcription
1 Effects of Krill Oil Supplementation on the Endocannabinoid System Vincenzo Di Marzo Endocannabinoid id Research Group C di t d b Istituto di Chimica Biomolecolare C.N.R., Pozzuoli (NA), Italy Presented at Coordinated by Rejuvenation Science A4M 2011 Orlando, FL Brief introduction to the endocannabinoid (ecb) system and its role in the adipose tissue and liver Dysregulation of the ecb system in adipose depots, skeletal muscle and liver in abdominal obesity/hyperglycemia, and its consequences Causal relationship between ecb dysregulation and dysmetabolism Omega-3 PUFAs and krill oil against ecb system dysregulation
2 Krill oil is an efficient utilization of the world s largest biomass Antarctic Krill largest biomass on earth Efficient utilization of nature s resources Antarctic Krill (Euphausia superba) World s largest single species biomass of mill MT (almost (l double size of human beings) Live in large schools; up to 6 years Feed directly on phytoplankton p Pelagic life cycle Output comparison: 10 times more output < Fish Oil Krill Oil
3 Cannabinoid receptors CH 3 OH O OH O CH O (-)- 9 -tetrahydrocannabinol (THC, oil) 1 M L 1 OH 2-Arachidonoyl-glycerol Hippocampus Basal Ganglia Cortex Cerebellum Hypothalamus Limbic structures Brainstem G.I. Tract Adipocytes CB 1, CB 2 E Immune cells and tissues Adipocytes?
4 Endocannabinoids (ecbs) (endogenous agonists of cannabinoid receptors) 1) are produced on demand 2) activate cannabinoid receptors locally and exert a prohomeostatic function 3) are metabolized thereafter Phospholipid Remodelling R 1 O Phospholipid-derived precursorsrsors NAPE-PLD O N H O O P O O- O-R 2 O O-R 3 O CH OH DAG Lipase Endocannabinoids O N H OH O O OH CH OH Anandamide 2-Arachidonoyl-glycerol Fatty Acid Amide Hydrolase MAG Lipase Degradation products H 2 N OH O OH OH HO CH OH
5 CB 1 receptors play a crucial role in adipogenesis and lipogenesis Di Marzo, Diabetologia 2008 CB 1 receptor activation also reduces adipocyte mitochondrial biogenesis (Tedesco et al., Diabetes, 2010)
6 Dysregulation of the Adipose Tissue, Hepatic and Skeletal Muscle ecb System in Obesity and Type 2 Diabetes
7 Amounts Aberrant ecb system in the epididymal and subcutaneous adipose tissue of DIO mice epidydimal fat control diet diet-induced obesity * Amounts 60,0 40,0 20,0 2,0 1,5 ** Lean DIO 1 1,0 0 anandamide pmol/g damide (pmol/g wet tissue) 60 2-AG nmol/g ad lib fasted refed 0,5 0,0 Anandamide (pmol/g) ** 2-AG (nmol/g) Matias et al. J. Clin. Endocrinol. Metab Starowicz et al., Obesity, subcutaneous ad lib mesenteric fasted refed * Anan Lean ### **, ## Zucker #,# Izzo, Piscitelli, Capasso, Aviello,, Romano, Borrelli, Petrosino,, Di Marzo, 2009,## Zucker
8 Elevated ecb tone in human visceral adiposity and metabolic syndrome Endogenous ligands (ecbs) Visceral fat from normoweight patients (n=10) Visceral fat from obese patients (n=19) Subcutaneous fat from obese patients (n=8) ** CB 1 receptors pmol/g of tiss sue # # 20 0 Matias et al. J. Clin. Endocrinol. Metab Anandamide 2-AG (Sarzani et al., Metabolism, 2009)
9 The ecb system is down-regulated in the subcutaneous adipose tissue of obese/ow/t2d subjects CB 1 receptors CB 1 receptors Endogenous ligand (2-AG) (Bennetzen et al., Eur. J. Clin. Invest., 2009) (Sarzani et al., Metabolism, 2009) (Annuzzi et al., 2010)
10 ecb dysregulation might contribute to fat redistribution and ectopic (liver) fat formation Hypertrophic subcutaneous adipocytes from obese individuals Less and less fat in subcutaneous depots EC Adipocytes from lean individuals EC Hypertrophic visceral adipocytes from obese individuals More and more fat in visceral depots and possibly the liver
11 Elevated CB 1 tone in the liver of obese rodents DIO mice Zucker fa/fa rats AEA (fmol/m mg tissue) p<0.005 Standard diet Anandamide (p pmol/g wet tissue) 40 *** Lean *, ad lib fasted refed # ** Zucker 2-A AG (pmol/mg g/tissue) High fat diet 2-AG (nmol/g wet tis ssue) ** ** ad lib fasted refed ## Osei-Hyiaman et al J Clin Invest Lean Zucker Izzo et al Br. J. Pharmacol 2009
12 Liver-specific CB 1 null mice: hepatic CB 1 receptor is partly responsible for the development of high fat diet-inducedinduced fatty liver, dyslipidemia and insulin resistance Osei-Hyiaman et al J Clin Invest 2008
13 CB 1 Antagonism in the Skeletal Muscle Enhances Insulin Sensitivity and Glucose Uptake The cannabinoid CB 1 receptor antagonist rimonabant stimulates 2- deoxyglucose uptake in skeletal muscle cells by regulating the expression of phosphatidylinositol-3-kinase (Esposito et al., Mol Pharmacol. 2008) Cannabinoid type 1 receptors in human skeletal l muscle cells participate i t in the negative crosstalk between fat and muscle (Eckardt et al. Diabetologia. 2009) 2-AG (nmol/g) High fat diet Regulation of MAP kinase-directed mitogenic and protein kinase B- mediated signaling by cannabinoid receptor type 1inskeletal muscle cells (Lipina et al., Diabetes 2010) Matias et al. Mol. Cell. Endocrinol Effects of in vitro antagonism of endocannabinoid-1 receptors on the glucose transport system in normal and insulin-resistant rat skeletal muscle (Lindborg et al. Diabetes Obes Metab. 2010) Normal diet
14 Peripheral overactivity of the endocannabinoid system 1) strictly correlates with increased visceral AT, liver fat and insulin resistance
15 Correlations between plasma 2-AG levels and cardio- metabolic risk factors in abdominal obese male subjects Variables 2-AG AEA Bd Body mass index id (kg/m (k/ ) r=0.30, 030 r=-0.13, 013 p< NS Waist circumference (cm) r=0.31, r=-0.19, p<0.02 NS Intra-abdominal AT (cm 2 ) r=0.45, r=-0.37, p< p<0.003 Subcutaneous AT (cm 2 ) r=0.07, r=-0.11, NS NS HDL cholesterol (mmol/l) r=-0.25, r=0.16, p<0.04 NS Triglycerides (mmol/l) r=0.35, r=-0.20, p<0.005 NS Fasting insulin (pmol/l) r=0.35, r=-0.26, p<0.005 p<0.04 Fasting glucose (mmol/l) r=0.16, r=-0.01, NS NS Insulin area (pmol/lx10-3 ) r=0.35, r=-0.15,,p<0.006 NS Glucose area (mmol/lx10-3 ) r=0.36, r=-0.04, p<0.005 NS Adiponectin ( g/ml) r=-0.30, r=0.18, p<0.02 NS Côté, Matias, Lemieux, Petrosino, Alméras, Després, Di Marzo, Int. J. Obes., 2007
16 One year lifestyle modification (healthy eating and physical activity) inducing a 8 cm reduction in waist circumference reduces plasma ecb levels in abdominally obese male patients 0,0 Di Marzo, Côté, Matias, Lemieux, Arsenault, Cartier, ndiabetologia, Piscitelli, Petrosino, Alméras & Després, g, 2009 wing intervention ol/ml) Changes follow (pmo -0,5-1,0 *** Anandamide **** 2-AG Positive correlations between 2-AG levels with: visceral adipose tissue (VAT); Free TG and TG in HDL, LDL and VLDL cholesterol; HDL 3 -cholesterol; insulin resistance Multivariate analyses showed that: The decrease in 2-AG and the decrease in VAT explained 13.7% and 38.0% of the decrease in TG, respectively; 20.3% of the decrease in RepIns30 was explained by the decrease of 2-AG
17 Peripheral overactivity of the endocannabinoid system 2) concurs to increased visceral AT, liver fat and insulin resistance
18 Pharmacologically- or genetically-inducedinduced ecb overactivity in mice leads to high triglycerides in a CB 1 -dependent way IDFP= non-selective inhibitor of ecb enzymatic hydrolysis that increases tissue ecb levels Ruby et al, PNAS U.S.A., 2008 FAAH null mice under a high fat diet. Tourino et al, Int. J. Obes., 2010
19 Weight-loss-Independent Effects of Rimonabant in Clinical Trials One year treatment with rimonabant (20 mg, per os) Placebo subtracted effects Di Marzo, Diabetologia, 2008
20 CB 1 antagonism reduces visceral adiposity in candy-diet diet fed female rats and obese humans Visceral fat Herling et al., Int. J. Obes Subcut. fat Strong reduction of liver fat too The ADAGIO-Lipids study Després et al., ATVB, 2009
21 Global CB 1 receptor antagonists are no longer in clinical development: what s next? Rimonabant Cl Cl Taranabant O F F N NH N N NH O N F Cl Cl N O N N Cl N N N NH O NH 2 Cl Otenabant
22 Future strategies for ecb overactivity counteraction Dietary -3 fatty acids against ectopic fat? Four week administration in Zucker fa/fa rats No effect on ecb levels in the subcutaneous fat The effects were stronger with krill oil (KO) than fish oil (FO) and were accompanied by reduction of ecb phospholipid h id biosynthetic precursors There was no effect on food intake and body weight Batetta et al., J Nutr 2009
23 Preventive effect of dietary krill oil in DIO mice (8 weeks co-administration with HFD) Reduction of fasting glycemia with no effect on food intake and body weight Tandy et al., J Agric Food Chem. 2009
24 The effect of dietary krill oil in DIO mice is accompanied by reductions in adipose EC levels Epididymal adipose tissue unpublished Inguinal adipose tissue
25 The effect of dietary krill oil in DIO mice is accompanied by reductions in muscle EC levels # # ** ** ** ** *** *** # # * ** * * *** *** Gastrocnemius muscle unpublished Heart
26 The effect of dietary krill oil in DIO mice is accompanied by reduction in EC precursors unpublished
27 Dietary krill oil lowers (4 weeks) plasma 2-AG levels in human obese subjects (BMI~30, mostly women, N=19-23) nm AG KO B 250 pre 200 post * 50 nm AG OO 150 pre post F Banni et al., Nutr. Metab norm OW OB norm OW OB 7.0 plasma n 6/n n R² = AG (nm)
28 Prolonged dietary krill oil (24 weeks) lowers plasma anandamide and TG levels in obese males (BMI~32, N=10) Plasma data % change Body data % change P<0.05 P<0.05 P<0.05 2,000 1,000 0, Adipon n. O 3 i EP PA DH HA DP PA 3 Omega Cho ol LD DL HD DL TA AG Glucos se P<0.05 in Insuli Week 12 1,000 Week 24 2,000 3,000 4,000 5,000 Week 12 Week 24 Endocannabinoids % change AG AEA PEA OEA Week 12 Week P<0.05 unpublished
29 Dietary -3 fatty acids reduce ecb levels in the brain less than peripheral tissues: less central side effects than CB 1 antagonists? Effect of 4 weeks administration of krill oil (KO) vs. fish oil (FO) No effect on anandamide levels (Di Marzo et al., Int Dairy J, 2010) Two weeks of DHA-supplemented diet in lean mice Woods et al., J Lipid Res, 2010
30 Acknowledgements Gianfranca Carta, Elisabetta Murru,, Lina Cordeddu, Sebastiano Banni Dipartimento di Biologia Sperimentale, Università di Cagliari, Italy Kjetil Berge, Hogne Vik Aker BioMarine, ASA, Oslo, Norway Sally Tandy, Jeffrey S. Cohn Heart Research Institute, Sydney, y, Australia Mikko Griinari Clanet Oy, Helsinki, Finland. ERG Tiziana Bisogno, Luigia Cristino, Luciano De Petrocellis, Roberta Imperatore, Alessia Ligresti, Aniello Schiano Moriello, Pierangelo Orlando, Stefania Petrosino, Fabiana Piscitelli, Noriko Shinjyo, Cris Silvestri, Marco Allarà, Roberta Verde Pozzuoli s ERG
Lipid Messengers in Obesity Positively Modulated by Superba Krill Oil
Lipid Messengers in Obesity Positively Modulated by Superba Krill Oil Endocannabinoid Overactivity and its Modulation by Omega-3 Fatty Acids with Potential Benefits for Metabolic Dysfunctions Sponsored
More informationFigure 1. Cardiovascular mortality increases with number of risk factors.
and the Endocannabinoid System James Early, M.D. Elizabeth Ablah, Ph.D., M.P.H. University of Kansas School of Medicine-Wichita Department of Preventive Medicine and Public Health A number of studies and
More informationTHE ENDOCANNABINOID SYSTEM IN ADIPOSE TISSUE. Key Points
December 2008 (Vol. 1, Issue 3, pages 31-35) THE ENDOCANNABINOID SYSTEM IN ADIPOSE TISSUE By Uberto Pagotto, MD, PhD Endocrinology Unit and Center of Applied Biomedical Research (C.R.B.A.), Department
More informationChronic treatment with krill powder reduces plasma triglyceride and anandamide levels in mildly obese men
Berge et al. Lipids in Health and Disease 2013, 12:78 RESEARCH Chronic treatment with krill powder reduces plasma triglyceride and anandamide levels in mildly obese men Kjetil Berge 1, Fabiana Piscitelli
More informationARTICLE. A. Bartelt & P. Orlando & C. Mele & A. Ligresti & K. Toedter & L. Scheja & J. Heeren & V. Di Marzo
Diabetologia (2011) 54:2900 2910 DOI 10.1007/s00125-011-2274-6 ARTICLE Altered endocannabinoid signalling after a high-fat diet in Apoe / mice: relevance to adipose tissue inflammation, hepatic steatosis
More informationThe Endocannabinoid System: Directing Eating Behavior and Macronutrient Metabolism
The Endocannabinoid System: Directing Eating Behavior and Macronutrient Metabolism Watkins and Kim 2015 Council of Hypothalamic Metabolites Agenda The Endocannabinoid System (ECS) Intro The ECS in the
More informationGetting into the weed: the endocannabinoid system of the gut-brain axis in energy homeostasis. Keith Sharkey
Getting into the weed: the endocannabinoid system of the gut-brain axis in energy homeostasis Keith Sharkey Department of Physiology & Pharmacology University of Calgary Dr. Keith Sharkey Financial Interest
More informationMetabolic defects underlying dyslipidemia in abdominal obesity
Metabolic defects underlying dyslipidemia in abdominal obesity Professor Marja-Riitta Taskinen Department of Medicine, Division of Cardiology Helsinki University Hospital, Finland Disclosures: Honorariums/
More informationThe Endocannabinoid System
The Endocannabinoid System Think of this system as the wizard behind the curtain. It underlies all the other systems, including the Autonomic Nervous System. Overall it influences well-being and the perception
More informationJNJ : selective and slowly reversible FAAH inhibitor. Central and Peripheral PK/PD
JNJ-42165279: selective and slowly reversible FAAH inhibitor Central and Peripheral PK/PD The Endocannabinoid System Research initiated by efforts to elucidate the active substance of Cannabis (THC in
More informationMetabolic syndrome. Metabolic syndrome and prediabetes appear to be the same disorder, just diagnosed by a different set of biomarkers.
Metabolic syndrome Metabolic syndrome is a disorder of energy utilization and storage, diagnosed by a co-occurrence of three out of five of the following medical conditions: abdominal (central) obesity,
More informationBlood fatty acids understanding the relevance of different tissue fractions and interpreting circulating concentrations.
Blood fatty acids understanding the relevance of different tissue fractions and interpreting circulating concentrations Leanne Hodson Fatty acid composition as a biomarker of intake Complements dietary
More informationAAOCS 10 th Biennial Conference Barossa Valley, September Presenter: Petter-Arnt Hals MSc PhD Co-authors: Nils Hoem, Xiaoli Wang, Yong-Fu Xiao
Effects of a purified, omega-3 rich krill oil phospholipid on cardiovascular disease risk factors and fatty acid composition of erythrocyte membranes in non-human primates AAOCS 10 th Biennial Conference
More informationGetting Ahead of the Curve in the Trouble with Fat
Getting Ahead of the Curve in the Trouble with Fat Zhaoping Li, M.D., Ph.D. Professor of Medicine David Geffen School of Medicine, UCLA VA Greater Los Angeles Health Care System Obesity Pandemic Predicted
More informationSelective cannabinoid-1 receptor blockade benefits fatty acid and triglyceride metabolism significantly in weight-stable nonhuman primates
Am J Physiol Endocrinol Metab 303: E624 E634, 2012. First published July 3, 2012; doi:10.1152/ajpendo.00072.2012. Selective cannabinoid-1 receptor blockade benefits fatty acid and triglyceride metabolism
More informationBrain health Heart health Liver health. Phospholipids in nutritional products Mikko Griinari, Clanet
Phospholipids in nutritional products Mikko Griinari, Clanet Contact information: e-mail mikko.griinari@clanet.fi phone +358-50-363-4570 Phospholipids in nutritional products Targets, research, products,
More informationMales- Western Diet WT KO Age (wks) Females- Western Diet WT KO Age (wks)
Relative Arv1 mrna Adrenal 33.48 +/- 6.2 Skeletal Muscle 22.4 +/- 4.93 Liver 6.41 +/- 1.48 Heart 5.1 +/- 2.3 Brain 4.98 +/- 2.11 Ovary 4.68 +/- 2.21 Kidney 3.98 +/-.39 Lung 2.15 +/-.6 Inguinal Subcutaneous
More informationOmega-3 Phospholipids from Krill
Omega-3 Phospholipids from Krill SUPERBA KRILL POWDER By Lena Burri, Ph.D. Table 1. Typical krill powder composition Aker BioMarine s krill powder called Superba Krill powder is prepared from an aqueous
More informationWe are IntechOpen, the world s leading publisher of Open Access books Built by scientists, for scientists. International authors and editors
We are IntechOpen, the world s leading publisher of Open Access books Built by scientists, for scientists 3,900 116,000 120M Open access books available International authors and editors Downloads Our
More informationFatemeh Haidari 1, Vahideh Aghamohammadi 2*, Majid Mohammadshahi 1 and Kambiz Ahmadi- Angali 3
Haidari et al. Nutrition Journal (2017) 16:70 DOI 10.1186/s12937-017-0294-x STUDY PROTOCOL Open Access Effect of whey protein supplementation on levels of endocannabinoids and some of metabolic risk factors
More informationTHE IMPORTANCE OF KNOWING YOUR OMEGA-3 INDEX: RECENT FINDINGS AND IMPLICATIONS FOR PUBLIC HEALTH PEOPLE MATTER PLANET MATTERS PROFIT MATTERS
THE IMPORTANCE OF KNOWING YOUR OMEGA-3 INDEX: RECENT FINDINGS AND IMPLICATIONS FOR PUBLIC HEALTH PEOPLE MATTER PLANET MATTERS PROFIT MATTERS Andreas Berg Storsve PhD, Director R&D 9.7 Billion people 2x
More informationEffects of growth hormone secretagogue receptor agonist and antagonist in nonobese type 2 diabetic MKR mice
Effects of growth hormone secretagogue receptor agonist and antagonist in nonobese type 2 diabetic MKR mice Rasha Mosa (MBCHC, M.D, PhD candidate) School of Biomedical Sciences University of Queensland
More informationThe art of tracing dietary fat in humans. Leanne Hodson
The art of tracing dietary fat in humans Leanne Hodson Dietary fat Other lipoproteins: IDL, LDL, HDL Hodson and Fielding linical Lipidology (2010) Relationship between blood & dietary fatty acids Typically:
More informationUse of cannabinoid CB1 receptor antagonists for the treatment of metabolic. disorders. André J. Scheen and Nicolas Paquot 1
Best Practice & Research Clinical Endocrinology & Metabolism Use of cannabinoid CB1 receptor antagonists for the treatment of metabolic disorders André J. Scheen and Nicolas Paquot 1 1 Division of Diabetes,
More information902 Biomed Environ Sci, 2014; 27(11):
902 Biomed Environ Sci, 2014; 27(11): 902-906 Letter to the Editor Curcuminoids Target Decreasing Serum Adipocyte-fatty Acid Binding Protein Levels in Their Glucose-lowering Effect in Patients with Type
More information2.5% of all deaths globally each year. 7th leading cause of death by % of people with diabetes live in low and middle income countries
Lipid Disorders in Diabetes (Diabetic Dyslipidemia) Khosrow Adeli PhD, FCACB, DABCC Head and Professor, Clinical Biochemistry, The Hospital for Sick Children, University it of Toronto Diabetes A Global
More information3-Thia Fatty Acids A New Generation of Functional Lipids?
Conference on Food Structure and Food Quality 3-Thia Fatty Acids A New Generation of Functional Lipids? Rolf K. Berge rolf.berge@med.uib.no Fatty acids- Essential cellular metabolites Concentrations must
More informationHSN301 Diet and Disease Entire Note Summary
Topic 1: Metabolic Syndrome Learning Objectives: 1. Define obesity 2. Factors causing obesity 3. Obesity as a risk factor for metabolic syndrome 4. The pathogenesis of metabolic syndrome 5. Treatment of
More informationRole and regulation of acylethanolamides in energy balance: focus on adipocytes and b-cells
British Journal of Pharmacology (2007) 152, 676 690 & 2007 Nature Publishing Group All rights reserved 0007 1188/07 $30.00 www.brjpharmacol.org REVIEW Role and regulation of acylethanolamides in energy
More informationThe Metabolic Syndrome Prof. Jean-Pierre Després
The Metabolic Syndrome 1 Jean-Pierre Després, Ph.D., FAHA, FIAS Quebec Heart and Lung Institute Department of Medicine Université Laval Québec, Canada Reaven s syndrome X Triglycerides HDL cholesterol
More informationEffects of cannabinoids and cannabinoid-enriched Cannabis extracts on TRP channels and endocannabinoid metabolic enzymes
1479..1494 BJP British Journal of Pharmacology DOI:10.1111/j.1476-5381.2010.01166.x www.brjpharmacol.org Themed Issue: Cannabinoids in Biology and Medicine, Part I RESEARCH PAPERbph_1166 Effects of cannabinoids
More informationSlide 1. Contemporary Management of Cardiometabolic Risk
Slide 1 Contemporary Management of Cardiometabolic Risk Contemporary Management of Cardiometabolic Risk 1 Slide 2 A continuing epidemic: 2 of 3 US adults are overweight or obese National Health and Nutrition
More informationObesity, Metabolic Syndrome, and Diabetes: Making the Connections
Obesity, Metabolic Syndrome, and Diabetes: Making the Connections Alka M. Kanaya, M.D. Associate Professor of Medicine & Epi/Biostats University of California, San Francisco February 26, 21 Roadmap 1.
More informationOptimizing The Omega-3 Index with Krill Oil By Lena Burri, PhD
Optimizing The Omega-3 Index with Krill Oil By Lena Burri, PhD THE OMEGA-3 INDEX is a diagnostic tool that is quickly becoming more popular with medical professionals and consumers. Beyond assessing cardiovascular
More informationResponses of blood lipids to aerobic and resistance type of exercise
Responses of blood lipids to aerobic and resistance type of exercise Labros Sidossis, Ph.D. Laboratory of Nutrition and Clinical Dietetics Harokopio University of Athens, Greece Triacylglycerol structure
More information1Why lipids cannot be transported in blood alone? 2How we transport Fatty acids and steroid hormones?
1Why lipids cannot be transported in blood alone? 2How we transport Fatty acids and steroid hormones? 3How are dietary lipids transported? 4How lipids synthesized in the liver are transported? 5 Lipoprotien
More informationEnergy balance. Factors affecting energy input. Energy input vs. Energy output Balance Negative: weight loss Positive: weight gain
1 Energy balance Energy input vs. Energy output Balance Negative: weight loss Positive: weight gain Special implications Infancy, Illness, Pregnancy & Lactation, Sports Factors affecting energy input neuro-endocrine
More informationObesity and the Metabolic Syndrome in Developing Countries: Focus on South Asians
Obesity and the Metabolic Syndrome in Developing Countries: Focus on South Asians Anoop Misra Developing countries, particularly South Asian countries, are witnessing a rapid increase in type 2 diabetes
More informationInteractions of exercise and diet in health prevention
Interactions of exercise and diet in health prevention Dr Jason Gill Institute of Cardiovascular and Medical Sciences University of Glasgow Physical activity and health outcomes does one size fit all?
More informationLIPID METABOLISM. Sri Widia A Jusman Department of Biochemistry & Molecular Biology FMUI
LIPID METABOLISM Sri Widia A Jusman Department of Biochemistry & Molecular Biology FMUI Lipid metabolism is concerned mainly with fatty acids cholesterol Source of fatty acids from dietary fat de novo
More informationEndocannabinoids are lipid mediators derived
Original Article Dysregulation of the Peripheral and Adipose Tissue Endocannabinoid System in Human Abdominal Obesity Matthias Blüher, 1 Stefan Engeli, 2 Nora Klöting, 1 Janin Berndt, 1 Mathias Fasshauer,
More informationEffects of Exercise and Physical Activity on Diabetes Mellitus and Obesity
1 EXERCISE IS MEDICINE: The Science Behind the Movement Effects of Exercise and Physical Activity on Diabetes Mellitus and Obesity Rosa Allyn G. Sy, MD, FPCP, FPSEDM Endocrinology, Diabetes, Metabolism
More informationNutrients and Circulatory Function
Clinical Nutrition Research Centre Nutrients and Circulatory Function Peter Howe Clinical Nutrition Research Centre University of Newcastle Nutritional Physiology Research Centre University of South Australia
More informationAdiponectin Normalization, A Clue To Anti-Metabolic
Author manuscript, published in "Drug Discovery Today 2009;14(3-4):192-7" DOI : 10.1016/j.drudis.2008.09.009 Adiponectin Normalization, A Clue To Anti-Metabolic Syndrome Action of Rimonabant Magali Gary-Bobo
More informationA Central Role of MG53 in Metabolic Syndrome. and Type-2 Diabetes
A Central Role of MG53 in Metabolic Syndrome and Type-2 Diabetes Yan Zhang, Chunmei Cao, Rui-Ping Xiao Institute of Molecular Medicine (IMM) Peking University, Beijing, China Accelerated Aging in China
More informationMETABOLISM of ADIPOSE TISSUE
METABOLISM of ADIPOSE TISSUE 2. LF UK Prof. Rudolf Poledne, PhD. TYPES OF ADIPOSE TISSUE brown adipose tissue subcutaneous adipose tissue visceral adipose tissue ADIPOSE TISSUE FUNCTIONS: thermal isolation
More informationForebyggelse af metabolisk syndrom vha. mejeriprodukter
Forebyggelse af metabolisk syndrom vha. mejeriprodukter Kjeld Hermansen Medicinsk Endokrinologisk afd. MEA, Aarhus Universitetshospital Mejeriforskningens Dag 2. marts 2017, Hotel Legoland Metabolic Syndrome
More informationObesity and the Endocannabinoid System: Is There Still a Future for CB 1 Antagonists in Obesity?
Obesity and the Endocannabinoid System: Is There Still a Future for CB 1 Antagonists in Obesity? Antonia Serrano, Francisco Javier Pavon, Juan Suarez, Miguel Romero- Cuevas, Elena Baixeras, Pilar Goya
More informationAdipose tissue dysfunction in obesity. Gijs Goossens, PhD
Adipose tissue dysfunction in obesity -The role of adipose tissue oxygenation - Gijs Goossens, PhD NUTRIM School of Nutrition and Translational Research in Metabolism Maastricht University Medical Centre
More informationTesamorelin Clinical Data Overview Jean-Claude Mamputu, PhD Senior Medical Advisor, Theratechnologies
Tesamorelin Clinical Data Overview Jean-Claude Mamputu, PhD Senior Medical Advisor, Theratechnologies Copyright 2016. All Rights Reserved. Property of Theratechnologies Inc. Mechanism of Action of Tesamorelin
More informationEnergy balance. Factors affecting energy input. Energy input vs. Energy output Balance Negative: weight loss Positive: weight gain
1 Energy balance Energy input vs. Energy output Balance Negative: weight loss Positive: weight gain Special implications Infancy, Illness, Pregnancy & Lactation, Sports Factors affecting energy input neuro-endocrine
More informationTadalafil ameliorates metabolic syndrome induced alterations in visceral adipose tissue: an experimental study in the rabbit Mario Maggi Sexual
Tadalafil ameliorates metabolic syndrome induced alterations in visceral adipose tissue: an experimental study in the rabbit Mario Maggi Sexual Medicine and Andrology Unit Dept. Experimental and Clinical
More informationDiabesity. Metabolic dysfunction that ranges from mild blood glucose imbalance to full fledged Type 2 DM Signs
Diabesity Metabolic dysfunction that ranges from mild blood glucose imbalance to full fledged Type 2 DM Signs Abdominal obesity Low HDL, high LDL, and high triglycerides HTN High blood glucose (F>100l,
More informationHSN301 REVISION NOTES TOPIC 1 METABOLIC SYNDROME
HSN301 REVISION NOTES TOPIC 1 METABOLIC SYNDROME What does the term Metabolic Syndrome describe? Metabolic syndrome describes a cluster of cardio-metabolic conditions that increase one's risk of developing
More informationMetabolic Syndrome. DOPE amines COGS 163
Metabolic Syndrome DOPE amines COGS 163 Overview - M etabolic Syndrome - General definition and criteria - Importance of diagnosis - Glucose Homeostasis - Type 2 Diabetes Mellitus - Insulin Resistance
More informationDiabetes mellitus. Treatment
Diabetes mellitus Treatment Recommended glycemic targets for the clinical management of diabetes(ada) Fasting glycemia: 80-110 mg/dl Postprandial : 100-145 mg/dl HbA1c: < 6,5 % Total cholesterol: < 200
More informationFAPESP Week /21/2017
Texas Tech University Dr Naima Moustaid-Moussa Texas Tech University FAPESP Week 2017 09/21/2017 University of Sao Paulo Dr Sonia Jancar ICB-USP Theresa Ramalho MS PhD candidate, Immunology ICB-USP Dr
More informationUpdate On Diabetic Dyslipidemia: Who Should Be Treated With A Fibrate After ACCORD-LIPID?
Update On Diabetic Dyslipidemia: Who Should Be Treated With A Fibrate After ACCORD-LIPID? Karen Aspry, MD, MS, ABCL, FACC Assistant Clinical Professor of Medicine Warren Alpert Medical School of Brown
More informationAssociation of serum adipose triglyceride lipase levels with obesity and diabetes
Association of serum adipose triglyceride lipase levels with obesity and diabetes L. Yang 1 *, S.J. Chen 1 *, G.Y. Yuan 1, L.B. Zhou 2, D. Wang 1, X.Z. Wang 1 and J.J. Chen 1 1 Department of Endocrinology,
More informationRegulation of adipose tissue remodeling by peripheral serotonin
Regulation of adipose tissue remodeling by peripheral serotonin Sangkyu Park Catholic Kwandong University College of Medicine Department of Biochemistry Serotonin (5-HT) is a signaling molecule Hemostasis
More informationChanges and clinical significance of serum vaspin levels in patients with type 2 diabetes
Changes and clinical significance of serum vaspin levels in patients with type 2 diabetes L. Yang*, S.J. Chen*, G.Y. Yuan, D. Wang and J.J. Chen Department of Endocrinology, Affiliated Hospital of Jiangsu
More informationUNIVERSITY OF PNG SCHOOL OF MEDICINE AND HEALTH SCIENCES DIVISION OF BASIC MEDICAL SCIENCES DISCIPLINE OF BIOCHEMISTRY AND MOLECULAR BIOLOGY
1 UNIVERSITY OF PNG SCHOOL OF MEDICINE AND HEALTH SCIENCES DIVISION OF BASIC MEDICAL SCIENCES DISCIPLINE OF BIOCHEMISTRY AND MOLECULAR BIOLOGY GLUCOSE HOMEOSTASIS An Overview WHAT IS HOMEOSTASIS? Homeostasis
More informationFacts on Fats. Ronald P. Mensink
Facts on Fats Ronald P. Mensink Department of Human Biology NUTRIM, School for Nutrition, Toxicology and Metabolism Maastricht University Maastricht The Netherlands Outline of the Presentation Saturated
More informationTBP (H) CACAGTGAATCTTGGTTGTAAACTTGA AAACCGCTTGGGATTATATTCG ANGPTL8 (H) CTGGGCCCTGCCTACCGAGA CCGATGCTGCTGTGCCACCA [1]
ESM Table 1. Immunoblot antibodies. Primary Supplier Dilution Antibody Akt Cell Signaling 1:1000 Technology Phosphorylated Cell Signaling 1:1000 Akt (Ser 473) Technology PKCε Cell Signaling 1:1000 Technology
More informationCarol Davila University of Medicine and Pharmacy, Bucharest, Romania
Mædica - a Journal of Clinical Medicine MAEDICA a Journal of Clinical Medicine 2016; 11(5): 32-37 ORIGINAL PAPER Changes in Fasting Plasma Glucose, HbA1c and Triglycerides Are Related to Changes in Body
More informationAdipose tissue: Roles and function in diabetes and beyond. August 2015; SAGLB.DIA
Adipose tissue: Roles and function in diabetes and beyond August 2015; SAGLB.DIA.15.07.0398 Acknowledgement The following slides intend to summarise the key points presented during the Banting Medal for
More informationNiacin Metabolism: Effects on Cholesterol
Niacin Metabolism: Effects on Cholesterol By Julianne R. Edwards For Dr. William R. Proulx, PhD, RD Associate Professor of Nutrition and Dietetics In partial fulfillments for the requirements of NUTR342
More informationWEIGHT GAIN DURING MENOPAUSE EMERGING RESEARCH
MENOPAUSE WHEN DOES IT OCCUR? The cessation of the menstrual cycle for one year. WEIGHT GAIN DURING MENOPAUSE EMERGING RESEARCH Jan Schroeder, Ph.D. Chair of The Department of Kinesiology California State
More informationThe Egyptian Journal of Hospital Medicine (July 2017) Vol.68 (3), Page
The Egyptian Journal of Hospital Medicine (July 2017) Vol.68 (3), Page 1505-1512 Assessment of Serum Levels in Patients with Acne Vulgaris Hanan M Saleh a, Manal A Sharara b, Mohamed A Habib c Department
More informationSerum Levels of Endocannabinoids are Independently Associated with Nonalcoholic Fatty Liver Disease
Serum Levels of Endocannabinoids are Independently Associated with Nonalcoholic Fatty Liver Disease Shira Zelber-Sagi 1,2, Shahar Azar 3, Alina Nemirovski 3, Muriel Webb 1,4, Zamir Halpern 1,4, Oren Shibolet
More informationRole of oxytocin in energy metabolism
Role of oxytocin in energy metabolism Peptides 45 (2013) 9 14. Valéria Ernestânia Chaves Federal University of São João Del Rei Brazil Oxytocin First peptide hormone whose structure was determined and
More informationSupplementary Table 2. Plasma lipid profiles in wild type and mutant female mice submitted to a HFD for 12 weeks wt ERα -/- AF-1 0 AF-2 0
Supplementary Table 1. List of specific primers used for gene expression analysis. Genes Primer forward Primer reverse Hprt GCAGTACAGCCCCAAAATGG AACAAAGTCTGGCCTGTATCCA Srebp-1c GGAAGCTGTCGGGGTAGCGTC CATGTCTTCAAATGTGCAATCCAT
More informationBone Metabolism in Postmenopausal Women Influenced by the Metabolic Syndrome
Bone Metabolism in Postmenopausal Women Influenced by the Metabolic Syndrome Thomas et al. Nutrition Journal (2015) 14:99 DOI 10.1186/s12937-015-0092-2 RESEARCH Open Access Acute effect of a supplemented
More informationZoektocht naar innovatieve geneesmiddelen voor de toekomst - Verslaving en ander gedrag in moleculair perspectief
Zoektocht naar innovatieve geneesmiddelen voor de toekomst - Verslaving en ander gedrag in moleculair perspectief Prof. dr. Chris Kruse Swammerdam Institute, UvA Solvay Pharmaceuticals Drug Discovery Assets
More informationMetabolic Syndrome: An overview. Kevin Niswender MD, PhD Vanderbilt University School of Medicine
Metabolic Syndrome: An overview. Kevin Niswender MD, PhD Vanderbilt University School of Medicine Setting the scene GB, 43 yo AA man followed for hypothyroidism returns on LT4 125 mcg/d and has a TSH=1.1
More information3/20/2011. Body Mass Index (kg/[m 2 ]) Age at Issue (*BMI > 30, or ~ 30 lbs overweight for 5 4 woman) Mokdad A.H.
U.S. Adults: 1988 Nineteen states with 10-14% 14% Prevalence of Obesity (*BMI > 30, or ~ 30 lbs overweight for 5 4 woman) Metabolic John P. Cello, MD Professor of Medicine and Surgery, University of California,
More informationObjectives. Objectives. Alejandro J. de la Torre, MD Cook Children s Hospital May 30, 2015
Alejandro J. de la Torre, MD Cook Children s Hospital May 30, 2015 Presentation downloaded from http://ce.unthsc.edu Objectives Understand that the obesity epidemic is also affecting children and adolescents
More informationEffect of fructose overfeeding. hepatic de novo lipogenesis and insulin sensitivity in healthy males
Effect of fructose overfeeding and fish oil administration on hepatic de novo lipogenesis and insulin sensitivity in healthy males David Faeh 1,2, Kaori Minehira 1, Jean-Marc Schwarz 3,4, Raj Periasami
More informationUPDATE ON PHARMACOTHERAPY FOR WEIGHT CONTROL AND
UPDATE ON PHARMACOTHERAPY FOR WEIGHT CONTROL AND OBESITY There are serious health, economic and social consequences of obesity. OVERVIEW OF ECONOMIC COSTS M-T VAN DER MERWE MB ChB, FCP (SA), PhD Senior
More informationNEW CLINICAL GUIDELINES FOR THE MANAGEMENT OF OBESITY AND METABOLIC SYNDROME
NEW CLINICAL GUIDELINES FOR THE MANAGEMENT OF OBESITY AND METABOLIC SYNDROME Alexander Frame, Richard Mathias School of Population and Public Health Obesity Pandemic (WHO) Developed Nations Developing
More informationIn The Name Of God. In The Name Of. EMRI Modeling Group
In The Name Of God In The Name Of God EMRI Modeling Group Cells work together in functionally related groups called tissues Types of tissues: Epithelial lining and covering Connective support Muscle movement
More informationRegulation, Function, and Dysregulation of Endocannabinoids in Models of Adipose and - Pancreatic Cells and in Obesity and Hyperglycemia
0021-972X/06/$15.00/0 The Journal of Clinical Endocrinology & Metabolism 91(8):3171 3180 Printed in U.S.A. Copyright 2006 by The Endocrine Society doi: 10.1210/jc.2005-2679 Regulation, Function, and Dysregulation
More informationCardiovascular Complications of Diabetes
VBWG Cardiovascular Complications of Diabetes Nicola Abate, M.D., F.N.L.A. Professor and Chief Division of Endocrinology and Metabolism The University of Texas Medical Branch Galveston, Texas Coronary
More informationDevelopment of the Automated Diagnosis CT Screening System for Visceral Obesity
Review Asian Pacific Journal of Disease Management 2008; 2(2), 31-38 Development of the Automated Diagnosis CT Screening System for Visceral Obesity Toru Nakagawa 1), Syuichiro Yamamoto 1), Masataka Irokawa
More informationMetabolic Syndrome in Asians
Metabolic Syndrome in Asians Alka Kanaya, MD Asst. Professor of Medicine, UCSF Asian CV Symposium, November 17, 2007 The Metabolic Syndrome Also known as: Syndrome X Insulin Resistance Syndrome The Deadly
More informationHemp Oil Complex 3-in-1 Benefit for Whole Body Support
Hemp Oil Complex 3-in-1 Benefit for Whole Body Support Endocannabinoid Support* Antioxidant Activity* Supports the endocannabinoid system* Supports the body s natural inflammatory response function* Ingredients
More informationFats, Cholesterol, and Hormones
Fats, Cholesterol, and Hormones 1 Types of Fats Lipids biological origin sparingly soluble in water Main classes of lipids Fatty Acids long hydrocarbon chains with a carboxylic acid on one end Triacylglycerols
More informationΦΛΕΓΜΟΝΗ ΚΑΙ ΔΙΑΒΗΤΗΣ
ΦΛΕΓΜΟΝΗ ΚΑΙ ΔΙΑΒΗΤΗΣ ΘΩΜΑΣ ΠΑΠΑΔΟΠΟΥΛΟΣ, MD, PHD ΕΠΕΜΒΑΤΙΚΟΣ ΚΑΡΔΙΟΛΟΓΟΣ ΙΑΤΡΙΚΟ ΔΙΑΒΑΛΚΑΝΙΚΟ ΚΕΝΤΡΟ Inflammation as a cause of disease has entered the popular imagination. Diet ( macronutrients )
More information298 Biomed Environ Sci, 2015; 28(4):
298 Biomed Environ Sci, 2015; 28(4): 298-302 Letter to the Editor Effects of Maternal Linseed Oil Supplementation on Metabolic Parameters in Cafeteria Diet-induced Obese Rats * BENAISSA Nawel 1, MERZOUK
More informationMetabolic Syndrome. Shon Meek MD, PhD Mayo Clinic Florida Endocrinology
Metabolic Syndrome Shon Meek MD, PhD Mayo Clinic Florida Endocrinology Disclosure No conflict of interest No financial disclosure Does This Patient Have Metabolic Syndrome? 1. Yes 2. No Does This Patient
More informationScreening Results. Juniata College. Juniata College. Screening Results. October 11, October 12, 2016
Juniata College Screening Results Juniata College Screening Results October 11, 2016 & October 12, 2016 JUNIATA COLLEGE The J.C. Blair Hospital CARES team screened 55 Juniata College employees on October
More informationNutracode KrillCode A premium omega 3 solution.
Nutracode KrillCode A premium omega 3 solution Krill Small Creature Big Advantage Antarctic Krill (Euphausia Superba) Antarctic Krill are swimming crustaceans that live in the Antarctic waters of the Southern
More informationObesity mediated hypertension and renal dysfunction
Obesity mediated hypertension and renal dysfunction Gergely Bodor Marion Hervouet Nicky Honnef Mariarosaria Malgadi Julie Robert Tutor: Pr Alina Parvu Objectives 1. Introduction 2. Renal structural and
More informationPlasma lipoproteins & atherosclerosis by. Prof.Dr. Maha M. Sallam
Biochemistry Department Plasma lipoproteins & atherosclerosis by Prof.Dr. Maha M. Sallam 1 1. Recognize structures,types and role of lipoproteins in blood (Chylomicrons, VLDL, LDL and HDL). 2. Explain
More informationThe Relationship between Dietary Fatty Acids and Inflammatory Genes on the Obese Phenotype and Serum Lipids
Nutrients 2013, 5, 1672-1705; doi:10.3390/nu5051672 Review OPEN ACCESS nutrients ISSN 2072-6643 www.mdpi.com/journal/nutrients The Relationship between Dietary Fatty Acids and Inflammatory Genes on the
More informationInflammation & Type 2 Diabetes Prof. Marc Y. Donath
Inflammation & Type 2 Diabetes 1, MD Chief Endocrinology, Diabetes & Metabolism University Hospital Basel Petersgraben 4 CH-431 Basel, Switzerland MDonath@uhbs.ch Innate immunity as a sensor of metabolic
More informationOBESITY IN PRIMARY CARE
OBESITY IN PRIMARY CARE Obesity- definition Is a chronic disease In ICD 10 E66 Overweight and obesity are defined as abnormal or excessive fat accumulation that may impair health. Obesity is a leading
More informationHypertriglyceridemia: Why, When, and How to Treat. Gregory Cohn, MD, FNLA, FASPC
Hypertriglyceridemia: Why, When, and How to Treat Gregory Cohn, MD, FNLA, FASPC DISCLOSURES Consultant to Akcea Therapeutics (in the past 12 months). OUTLINE I. Lipoproteins II. Non-HDL-C III. Causes and
More informationA COMPARATIVE STUDY ON THE EFFECTS OF VCO AND OTHER UNSATURATED OIL SOURCES ON THE LIPID PROFILE OF SPRAGUE DAWLEY RATS
A COMPARATIVE STUDY ON THE EFFECTS OF VCO AND OTHER UNSATURATED OIL SOURCES ON THE LIPID PROFILE OF SPRAGUE DAWLEY RATS Rosario S. Sagum, Ph.D., Mildred A. Udarbe, MSc., Trinidad P. Trinidad, Ph.D. And
More informationTraditional Asian Soyfoods. Proven and Proposed Cardiovascular Benefits of Soyfoods. Reduction (%) in CHD Mortality in Eastern Finland ( )
Proven and Proposed Cardiovascular Benefits of Soyfoods Mark Messina, PhD, MS Soy Nutrition Institute Loma Linda University Nutrition Matters, Inc. markjohnmessina@gmail.com 1000 80 20 60 40 40 60 20 80
More information