Tadalafil ameliorates metabolic syndrome induced alterations in visceral adipose tissue: an experimental study in the rabbit Mario Maggi Sexual

Size: px
Start display at page:

Download "Tadalafil ameliorates metabolic syndrome induced alterations in visceral adipose tissue: an experimental study in the rabbit Mario Maggi Sexual"

Transcription

1 Tadalafil ameliorates metabolic syndrome induced alterations in visceral adipose tissue: an experimental study in the rabbit Mario Maggi Sexual Medicine and Andrology Unit Dept. Experimental and Clinical Biomedical Sciences University of Florence Italy

2 Sexual Medicine & Andrology Unit Dept. «Mario Serio» University of Florence Linda Vignozzi Anatomy and Histology Units Department of Experimental and Clinical Medicine Prof.Daniele Bani Prof. Barbara Vannelli Dr. Annamaria Morelli, Dr. Erica Sarchielli Ilaria Cellai Paolo Comeglio Francesca Corcetto Chiara Cornio Sandra Filippi Elena Maneschi Gastroenterology Unit Department «Mario Serio» Dr. Tommaso Mello Prof. Andrea Galli

3 High triglycerides Low HDL cholesterol Hypertension Hyperglycemia Visceral obesity Metabolic syndrome (MetS)

4 BAT dissipates energy in the form of heat, by metabolizing fatty acids

5 Inhibition of PDE5 RhoA/ROCK

6 Aim of the Study: to investigate the effect of a PDE5 inhibitor, Tadalafil, on metabolic features in a rabbit model of MetS MetS Hyperglycaemia Reduced glucose tolerance (OGTT) Hypercholesterolemia Hypertriglyceridemia Hypertension Increased visceral fat mass Dysfunctional VAT NASH 0 Standard diet: control High fat diet: HFD 0.5% cholesterol and 4% peanuts oil weeks Hypogonadotropic hypogonadism o testosterone level ( FSH and LH level) o prostate, seminal vesicles weight Filippi S et al., J Sex Med 2009, 6(12): Vignozzi et al., Mol cell Endocrinol ;384: Vignozzi L et al., J Sex Med Jan;8(1):57-77 Vignozzi et al.,.j of Endocrinol 2012 Jan;212(1):71-84 Morelli et al., Prostate Sep 19. Morelli et al., J Steroid Biochem Mol Biol ;132:80. Maneschi et al., J Endocrinol Dec;215(3):

7 Rabbit model of Metabolic Syndrome MetS Hyperglycaemia Reduced glucose tolerance (OGTT) Hypercholesterolemia Hypertriglyceridemia Hypertension Increased visceral fat mass Dysfunctional VAT NASH 0 Standard diet: control High fat diet: HFD weeks 0.5% cholesterol and 4% peanuts oil Tadalafil (2mg/kg/day) Hypogonadotropic hypogonadism o testosterone level ( FSH and LH level) o prostate, seminal vesicles weight High fat diet + acute Tadalafil: HFD + 1 week Tad Vignozzi et al., Mol cell Endocrinol ;384: Vignozzi et al.,.j of Endocrinol 2012 Jan;212(1):71-84 Morelli et al., Prostate Sep 19. Morelli et al., J Steroid Biochem Mol Biol ;132:80. Maneschi et al., J Endocrinol Dec;215(3): Vignozzi L et al., J Sex Med Jan;8(1):57-77 Filippi S et al., J Sex Med 2009, 6(12):

8 Tadalafil significantly reduced HFD induced increase in triglycerides P< P=0.02 MetS Triglycerides (mg/dl) Hyperglycaemia Reduced glucose tolerance (OGTT) Hypercholesterolemia Hypertriglyceridemia Hypertension Increased visceral fat mass Dysfunctional VAT NASH RD HFD HFD+Tad1week Morelli et al., 2013, Prostate. 73(4): Vignozzi et al., unpublished 2014

9 Tadalafil significantly reduced HFD induced increase in VAT weigth P=0.004 P=0.011 MetS VAT (% of body weight) Hyperglycaemia Reduced glucose tolerance (OGTT) Hypercholesterolemia Hypertriglyceridemia Hypertension Increased visceral fat mass Dysfunctional VAT NASH RD HFD HFD+Tad1week Morelli et al., 2013, Prostate. 73(4): Vignozzi et al., unpublished 2014

10 VAT expresses high level of both PDE5 and PDE11 Vignozzi et al., unpublished 2014

11 HFD induced adipocyte hypertrophy and hypoxia were reduced by Tadalafil d. Adipocytediameter (μm) Control RD HFD HFD+Tadalafil h. Hypoxyprobepositivity (% of control) Control RD HFD HFD+Tadalafil HFD+tadalafil Maneschi et al. J of Endocrinol , 1-17 Maneschi et al., J of Endocrinol 218(2): Vignozzi et al., unpublished 2014

12 HFD induced reduction of GLUT4 translocation to plasma membrane was normalized by Tadalafil 120,00 mglut4/cglut4 % 100,00 80,00 60,00 40,00 20,00 0,00 Control RD HFD Diet HFD+Tadalafil Diet+Tad A mglut4 cglut4 STAT1 P<0.01 vs. all the other groups Maneschi et al. J of Endocrinol , 1-17 Maneschi et al., J of Endocrinol 218(2): Vignozzi et al., unpublished 2014

13 UCP1 immunolocalization in rabbit VAT 10x

14 Isolation of rpads from visceral fat RD rpad RD HFD rpad HFD HFD+TAD rpad HFD+TAD Maneschi et al., J Endocrinol Jul 6;218(2): Maneschi et al., J Endocrinol Dec;215(3):

15 Isolation of rpads from visceral fat RD NT DMEM with 4,5 g/l Glucose, P/S, L Glutamine FETAL BOVINE SERUM 5% rpad RD 10 days RD NT10 HFD rpad HFD 10 days HFD NT10 HFD+TAD rpad HFD+TAD 10 days HFD+Tad NT10 Vignozzi et al., unpublished 2014

16 Pre-adipocytes expresses very high level of PDE5 (similar to smooth muscle of corpora cavernosa) Vignozzi et al., unpublished 2014

17 A. RD B. HFD C. HFD+tadalafil D. E.

18 TFAM NRF1 CS SLC25A12 NDUFB5 NDUFB3 NDUFS1 SDHB GCb1 GCa1 PKG1 ROCK2 ROCK1 RhoA HOXC9 RB1 PPARγ PPARϒC 1β PPARϒC 1α BMP4 CD137 TMEM26 UCP1 CIDEA Mitochondrial biogenesis GC/PKG pathway White adipocyte markers p<0,0001, p<0,001, p<0,01, p<0,05 vs HFD mrna expression in HFD+Tadalafil (% of HFD) Brown/Brite adipocyte markers

19 Mitochondrial network morphology and dynamics by using a mitochondria specific probe (MitoTracker) RD HFD HFD+TADALAFIL

20 Mitochondrial ultrastructure by using TEM a. RD b. HFD c. HFD+ tadalafil d. Total Mitochondrial cristae surface/ outer membrane surface p< p< RD HFD HFD+Tadalafil

21 Superoxide production by using dihydroethidium (DHE) a. RD b. HFD c. HFD+tadalafil d.

22 In vitro treatment with tadalafil 100 nm in rpads from HFD rabbits Untreated 10 days HFD +Tadalafil rpad HFD +Tadalafil +KT5823 +KT5823 BAY : a selective sgc activator Tadalafil (inhibits cgmp degradation) +8Br cgmp +BAY KT5823: a selective inhibitor of PKG - 8Br cgmp: a PDE-resistant cgmp analog

23 In vitro treatment with tadalafil 100 nm in rpads from HFD rabbits a. RD b. HFD c. HFD+ tadalafil d. e. f rpad RD rpad HFD rpad HFD + tadalafil 3 H-glucose uptake (%) Insulin (M) Mean number of lipid droplets in rpad Mean volume (μm 3 ) of lipid droplets in rpad

24 Figure 10 a. RD rpad c. b. Untreated HFD rpad d. P< Mitochondrial lenght (µm) P< RD rpad HFD rpad +100nM tadalafil Untreated 100nMtadalafil HFD rpad

25 a. b. c. d. e. f. 140 Total mithoncondrialcristae surface / outer membrane surface P< P< P<0.05 P< Untreated RD RD rpad Untreated HFD +100nM Tadalafil tadalafil + KT KT nM KT+Tadalafil tadalafil+kt5823 HFD rpad

26 In vitro treatment with tadalafil 100 nm in rpads from HFD rabbits Tadalafil stimulates Brown-like phenotype mrna/18s UCP1 # TMEM26 # 0 0 control Tadalafil KT5823 Tadlf+KT 8BrcGMP BR5381 Untreated tadalafil KT 5823 tadalafil+kt Br-cGMP BAY HFD rpad control Untreated Tadalafil tadalafil KT KT5823 tadalafil+kt5823 Tadlf+KT 8-Br-cGMP 8BrcGMP BAY BR HFD rpad CD CIDEA mrna/18s # # Untreated tadalafil tadalafil+kt Br-cGMP BAY NT10 Tadalafil KT5823 Tadlf+KT 8BrcGMP BR5381 HFD rpad 0 control Tadalafil KT5823 Tadlf+KT 8BrcGMP BAY Untreated tadalafil KT 5823 tadalafil+kt Br-cGMP BAY

27 Antonio Aversa Davide Francomano Andrea Lenzi Department of Experimental Medicine, Medical Pathophysiology, Food Science and Endocrinology Section, Sapienza University of Rome, Viale Regina Elena 324, Rome, Italy Open label, single-arm, uncontrolled, single center, clinical trial, on 10 male patients aged 18 years, referring to an outpatient facility for the treatment of sexual dysfunction. Primary objective: to determine the potential effects of chronic tadalafil administration (2.5 mg/daily) on body composition in male subjects with erectile dysfunction. The primary outcomes was the variation of abdominal fat mass, measured with a whole body dual-energy X-ray absorptiometry (DXA- HOLOGIC QDR-1000), Further outcomes included body mass index (BMI) and other measures of fat distribution (waist circumference) and body composition (total fat mass with DXA)

28 Antonio Aversa Davide Francomano Andrea Lenzi Department of Experimental Medicine, Medical Pathophysiology, Food Science and Endocrinology Section, Sapienza University of Rome, Viale Regina Elena 324, Rome, Italy All patients were treated with tadalafil 2.5mg daily, in the early morning, for 8 weeks; the treatment was then stopped, and further follow-up evaluation was performed at week weeks 16 weeks Tadalafil 2.5mg daily Stop treatment Washout

29 Antonio Aversa Davide Francomano Andrea Lenzi Department of Experimental Medicine, Medical Pathophysiology, Food Science and Endocrinology Section, Sapienza University of Rome, Viale Regina Elena 324, Rome, Italy Open label, single-arm, uncontrolled, single center, clinical trial, on 10 male patients aged 18 years, referring to our outpatient facility for the treatment of sexual dysfunction.

30 a. b Fat (kg) Lean (kg) Total mass (kg) c. p<0.01 Baseline vs 8 weeks 8 weeks vs 16 weeks

31 conclusions: in an animal model of MetS (diet-induced) and in human subjects, in vivo tadalafil administration is able to decrease visceral adipose tissue (VAT), after short-term exposure (1 and 8 weeks, respectively). in vivo and in vitro studies demonstrated that tadalafil, via PKG activation in VAT, up-regulates browning-specific genes, including UCP1, and counteracts HFD-associated mitochondrial alterations, suggesting VAT browning

In The Name Of God. In The Name Of. EMRI Modeling Group

In The Name Of God. In The Name Of. EMRI Modeling Group In The Name Of God In The Name Of God EMRI Modeling Group Cells work together in functionally related groups called tissues Types of tissues: Epithelial lining and covering Connective support Muscle movement

More information

The Metabolic Syndrome Update The Metabolic Syndrome Update. Global Cardiometabolic Risk

The Metabolic Syndrome Update The Metabolic Syndrome Update. Global Cardiometabolic Risk The Metabolic Syndrome Update 2018 Marc Cornier, M.D. Professor of Medicine Division of Endocrinology, Metabolism & Diabetes Anschutz Health and Wellness Center University of Colorado School of Medicine

More information

Metabolic Syndrome: An overview. Kevin Niswender MD, PhD Vanderbilt University School of Medicine

Metabolic Syndrome: An overview. Kevin Niswender MD, PhD Vanderbilt University School of Medicine Metabolic Syndrome: An overview. Kevin Niswender MD, PhD Vanderbilt University School of Medicine Setting the scene GB, 43 yo AA man followed for hypothyroidism returns on LT4 125 mcg/d and has a TSH=1.1

More information

Late onset hypogonadism

Late onset hypogonadism Late onset hypogonadism Farrukh Javid Male Menopause Clinical AND biochemical syndrome Testosterone levels decline by 0.4-3% per year after the age of 30, as opposed to the more rapid decline that occurs

More information

The Role of Testosterone in the Sexual Function. Luiz Otavio Torres President Elect of ISSM Belo Horizonte - Brazil

The Role of Testosterone in the Sexual Function. Luiz Otavio Torres President Elect of ISSM Belo Horizonte - Brazil The Role of Testosterone in the Sexual Function Luiz Otavio Torres President Elect of ISSM Belo Horizonte - Brazil Hormones and Sexual Function Paraventricular Nucleus Stimuli visual Sexual Desire Melatonine

More information

Effects of Exercise and Physical Activity on Diabetes Mellitus and Obesity

Effects of Exercise and Physical Activity on Diabetes Mellitus and Obesity 1 EXERCISE IS MEDICINE: The Science Behind the Movement Effects of Exercise and Physical Activity on Diabetes Mellitus and Obesity Rosa Allyn G. Sy, MD, FPCP, FPSEDM Endocrinology, Diabetes, Metabolism

More information

ab Adipogenesis Assay Kit (Cell-Based)

ab Adipogenesis Assay Kit (Cell-Based) ab133102 Adipogenesis Assay Kit (Cell-Based) Instructions for Use For the study of induction and inhibition of adipogenesis in adherent cells. This product is for research use only and is not intended

More information

The Metabolic Syndrome Update The Metabolic Syndrome: Overview. Global Cardiometabolic Risk

The Metabolic Syndrome Update The Metabolic Syndrome: Overview. Global Cardiometabolic Risk Update 2013 Marc Cornier, M.D. Associate Professor of Medicine Division of Endocrinology, Metabolism & Diabetes Anschutz Health and Wellness Center University of Colorado School of Medicine Denver Health

More information

HSN301 Diet and Disease Entire Note Summary

HSN301 Diet and Disease Entire Note Summary Topic 1: Metabolic Syndrome Learning Objectives: 1. Define obesity 2. Factors causing obesity 3. Obesity as a risk factor for metabolic syndrome 4. The pathogenesis of metabolic syndrome 5. Treatment of

More information

Testosterone and PDE5 inhibitors in the aging male

Testosterone and PDE5 inhibitors in the aging male Testosterone and PDE5 inhibitors in the aging male Francesco Romanelli Department of Experimental Medicine Medical Pathophysiology, Food Science and Endocrinology Section Sapienza University of Rome 3005

More information

Supplementary Table 2. Plasma lipid profiles in wild type and mutant female mice submitted to a HFD for 12 weeks wt ERα -/- AF-1 0 AF-2 0

Supplementary Table 2. Plasma lipid profiles in wild type and mutant female mice submitted to a HFD for 12 weeks wt ERα -/- AF-1 0 AF-2 0 Supplementary Table 1. List of specific primers used for gene expression analysis. Genes Primer forward Primer reverse Hprt GCAGTACAGCCCCAAAATGG AACAAAGTCTGGCCTGTATCCA Srebp-1c GGAAGCTGTCGGGGTAGCGTC CATGTCTTCAAATGTGCAATCCAT

More information

Metabolic Solutions Development Company, Kalamazoo, USA.

Metabolic Solutions Development Company, Kalamazoo, USA. New Insulin Sensitizers Produce Differentiation of Brown-like Adipose Cells from a Subcutaneous Fat Depot and Increase Secretion of Adiponectin in vitro William G. McDonald, Serena L. Cole, Danielle D.

More information

Changes and clinical significance of serum vaspin levels in patients with type 2 diabetes

Changes and clinical significance of serum vaspin levels in patients with type 2 diabetes Changes and clinical significance of serum vaspin levels in patients with type 2 diabetes L. Yang*, S.J. Chen*, G.Y. Yuan, D. Wang and J.J. Chen Department of Endocrinology, Affiliated Hospital of Jiangsu

More information

Metabolic Syndrome. Shon Meek MD, PhD Mayo Clinic Florida Endocrinology

Metabolic Syndrome. Shon Meek MD, PhD Mayo Clinic Florida Endocrinology Metabolic Syndrome Shon Meek MD, PhD Mayo Clinic Florida Endocrinology Disclosure No conflict of interest No financial disclosure Does This Patient Have Metabolic Syndrome? 1. Yes 2. No Does This Patient

More information

9/26/2018. Andy Weiler, M.Ed. September 26 th, 2018

9/26/2018. Andy Weiler, M.Ed. September 26 th, 2018 Andy Weiler, M.Ed. September 26 th, 2018 1 2 Stay tuned for the answer to our riddle Riddle #2 3 Riddle #2 Riddle #2 4 Riddle #2 The answer: 50%/50% chance to be right Fluids: blood volume, body water,

More information

WEIGHT GAIN DURING MENOPAUSE EMERGING RESEARCH

WEIGHT GAIN DURING MENOPAUSE EMERGING RESEARCH MENOPAUSE WHEN DOES IT OCCUR? The cessation of the menstrual cycle for one year. WEIGHT GAIN DURING MENOPAUSE EMERGING RESEARCH Jan Schroeder, Ph.D. Chair of The Department of Kinesiology California State

More information

A Central Role of MG53 in Metabolic Syndrome. and Type-2 Diabetes

A Central Role of MG53 in Metabolic Syndrome. and Type-2 Diabetes A Central Role of MG53 in Metabolic Syndrome and Type-2 Diabetes Yan Zhang, Chunmei Cao, Rui-Ping Xiao Institute of Molecular Medicine (IMM) Peking University, Beijing, China Accelerated Aging in China

More information

Benign prostatic enlargement can be influenced by metabolic profile: results of a multicenter prospective study

Benign prostatic enlargement can be influenced by metabolic profile: results of a multicenter prospective study Gacci et al. BMC Urology (2017) 17:22 DOI 10.1186/s12894-017-0211-9 RESEARCH ARTICLE Benign prostatic enlargement can be influenced by metabolic profile: results of a multicenter prospective study Open

More information

METABOLISMO E VITAMINA D

METABOLISMO E VITAMINA D CONVEGNO NAZIONALE GIBIS ROMA 14-15 MAGGIO 2015 METABOLISMO E VITAMINA D Alfredo Scillitani UO Endocrinologia Ospedale Casa Sollievo della Sofferenza Holick MF, NEJM 2007 Sindrome Metabolica E un cluster

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION doi:10.1038/nature11464 Supplemental Figure S1. The expression of Vegfb is increased in obese and diabetic mice as compared to lean mice. a-b, Body weight and postprandial blood

More information

FGF21 Resistance in Adipose Tissues as a Cause of Insulin Resistance

FGF21 Resistance in Adipose Tissues as a Cause of Insulin Resistance Resistance in Adipose Tissues as a Cause of Insulin Resistance The ICDM 213 & 5 th AASD Scientific Meeting Seoul, Korea, Nov 8, 213 Aimin Xu Dept of Medicine & Dept of Pharmacology and Pharmacy The University

More information

3-Thia Fatty Acids A New Generation of Functional Lipids?

3-Thia Fatty Acids A New Generation of Functional Lipids? Conference on Food Structure and Food Quality 3-Thia Fatty Acids A New Generation of Functional Lipids? Rolf K. Berge rolf.berge@med.uib.no Fatty acids- Essential cellular metabolites Concentrations must

More information

Test5, Here is Your My5 to Health Profile with Metabolic Syndrome Insight

Test5, Here is Your My5 to Health Profile with Metabolic Syndrome Insight Test5, Here is Your My5 to Health Profile with Metabolic Syndrome Insight Quest, Quest Diagnostics, the associated logo, and all associated Quest Diagnostics marks are the registered trademarks of Quest

More information

Nicolucci C. (1), Rossi S. (2), Catapane M. (1), Introduction:

Nicolucci C. (1), Rossi S. (2), Catapane M. (1), Introduction: Bisphenol A and Nicolucci C. (1), Rossi S. (2), Catapane M. (1), (1) Dept. Experimental Medicine, Second University of (2) Institute of Genetic and Biophysics, CNR, Naples (3) Dept. of Pediatrics 'F. Fede',

More information

Sexual dysfunction in male LUTS. M. Gacci Department of Urology, University of Florence

Sexual dysfunction in male LUTS. M. Gacci Department of Urology, University of Florence Sexual dysfunction in male LUTS M. Gacci Department of Urology, University of Florence Roma, 25-26 June, 2015 Cross-sectional population-based study of 4800 men (40 79 yr of age) UK, Netherlands, France,

More information

Diabetes: Across the Lifespan Friday, October 17, Obesity, Insulin Resistance and Type 2 Diabetes Cardiovascular Risks in Children.

Diabetes: Across the Lifespan Friday, October 17, Obesity, Insulin Resistance and Type 2 Diabetes Cardiovascular Risks in Children. Diabetes: Across the Lifespan Friday, October 17, 2014 Obesity, Insulin Resistance and Type 2 Diabetes Cardiovascular Risks in Children. Don P. Wilson, M.D., FNLA Diplomate, Am Brd of Clinical Lipidology

More information

Forebyggelse af metabolisk syndrom vha. mejeriprodukter

Forebyggelse af metabolisk syndrom vha. mejeriprodukter Forebyggelse af metabolisk syndrom vha. mejeriprodukter Kjeld Hermansen Medicinsk Endokrinologisk afd. MEA, Aarhus Universitetshospital Mejeriforskningens Dag 2. marts 2017, Hotel Legoland Metabolic Syndrome

More information

control kda ATGL ATGLi HSL 82 GAPDH * ** *** WT/cTg WT/cTg ATGLi AKO/cTg AKO/cTg ATGLi WT/cTg WT/cTg ATGLi AKO/cTg AKO/cTg ATGLi iwat gwat ibat

control kda ATGL ATGLi HSL 82 GAPDH * ** *** WT/cTg WT/cTg ATGLi AKO/cTg AKO/cTg ATGLi WT/cTg WT/cTg ATGLi AKO/cTg AKO/cTg ATGLi iwat gwat ibat body weight (g) tissue weights (mg) ATGL protein expression (relative to GAPDH) HSL protein expression (relative to GAPDH) ### # # kda ATGL 55 HSL 82 GAPDH 37 2.5 2. 1.5 1..5 2. 1.5 1..5.. Supplementary

More information

Alternative management of hypogonadism Tamoxifen. Emmanuele A. Jannini, MD Tor Vergata University of Rome ITALY

Alternative management of hypogonadism Tamoxifen. Emmanuele A. Jannini, MD Tor Vergata University of Rome ITALY Alternative management of hypogonadism Tamoxifen Emmanuele A. Jannini, MD Tor Vergata University of Rome ITALY eajannini@gmail.com What hypogonadism is? What hypogonadism is? It is an empty glass The two

More information

Metabolic Syndrome Update The Metabolic Syndrome: Overview. Global Cardiometabolic Risk

Metabolic Syndrome Update The Metabolic Syndrome: Overview. Global Cardiometabolic Risk Metabolic Syndrome Update 21 Marc Cornier, M.D. Associate Professor of Medicine Division of Endocrinology, Metabolism & Diabetes University of Colorado Denver Denver Health Medical Center The Metabolic

More information

The role of apolipoprotein D in lipid metabolism and metabolic syndrome

The role of apolipoprotein D in lipid metabolism and metabolic syndrome UQÀM: Department of Biological Sciences The role of apolipoprotein D in lipid metabolism and metabolic syndrome Catherine Mounier PhD Apolipoprotein D Apolipoprotéine D (apod) Secreted protein Associated

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi: 1.138/nature7221 Brown fat selective genes 12 1 Control Q-RT-PCR (% of Control) 8 6 4 2 Ntrk3 Cox7a1 Cox8b Cox5b ATPase b2 ATPase f1a1 Sirt3 ERRα Elovl3/Cig3 PPARα Zic1 Supplementary Figure S1. stimulates

More information

Module 2: Metabolic Syndrome & Sarcopenia. Lori Kennedy Inc & Beyond

Module 2: Metabolic Syndrome & Sarcopenia. Lori Kennedy Inc & Beyond Module 2: Metabolic Syndrome & Sarcopenia 1 What You Will Learn Sarcopenia Metabolic Syndrome 2 Sarcopenia Term utilized to define the loss of muscle mass and strength that occurs with aging Progressive

More information

Metabolic Issues in Transgender Women Living With HIV. Jordan E. Lake, MD, MSc 2 November 2018

Metabolic Issues in Transgender Women Living With HIV. Jordan E. Lake, MD, MSc 2 November 2018 Metabolic Issues in Transgender Women Living With HIV Jordan E. Lake, MD, MSc 2 November 2018 Disclosures -No relevant financial disclosures Learning Objectives Understand metabolic issues relevant to

More information

3/20/2011. Body Mass Index (kg/[m 2 ]) Age at Issue (*BMI > 30, or ~ 30 lbs overweight for 5 4 woman) Mokdad A.H.

3/20/2011. Body Mass Index (kg/[m 2 ]) Age at Issue (*BMI > 30, or ~ 30 lbs overweight for 5 4 woman) Mokdad A.H. U.S. Adults: 1988 Nineteen states with 10-14% 14% Prevalence of Obesity (*BMI > 30, or ~ 30 lbs overweight for 5 4 woman) Metabolic John P. Cello, MD Professor of Medicine and Surgery, University of California,

More information

A microrna-34a/fgf21 Regulatory Axis and Browning of White Fat

A microrna-34a/fgf21 Regulatory Axis and Browning of White Fat A microrna-34a/fgf21 Regulatory Axis and Browning of White Fat Jongsook Kim Kemper, Ph.D Department of Molecular and Integrative Physiology, University of Illinois at Urbana-Champaign, USA 213 International

More information

SALIVARY CORTISOL FLUCTUATIONS AND HYPERGLICEMIC STRESS IN PATIENTS WITH ABDOMINAL OBESITY

SALIVARY CORTISOL FLUCTUATIONS AND HYPERGLICEMIC STRESS IN PATIENTS WITH ABDOMINAL OBESITY SALIVARY CORTISOL FLUCTUATIONS AND HYPERGLICEMIC STRESS IN PATIENTS WITH ABDOMINAL OBESITY Corina Dima-Cozma 1, Andreea Szalontay 2, Cristina Ghiciuc 3, Sebastian Cozma 4, Francesca Romana Patacchioli

More information

Metabolic Syndrome. DOPE amines COGS 163

Metabolic Syndrome. DOPE amines COGS 163 Metabolic Syndrome DOPE amines COGS 163 Overview - M etabolic Syndrome - General definition and criteria - Importance of diagnosis - Glucose Homeostasis - Type 2 Diabetes Mellitus - Insulin Resistance

More information

SUPPLEMENTARY DATA. Supplementary Table 1. Primer sequences for qrt-pcr

SUPPLEMENTARY DATA. Supplementary Table 1. Primer sequences for qrt-pcr Supplementary Table 1. Primer sequences for qrt-pcr Gene PRDM16 UCP1 PGC1α Dio2 Elovl3 Cidea Cox8b PPARγ AP2 mttfam CyCs Nampt NRF1 16s-rRNA Hexokinase 2, intron 9 β-actin Primer Sequences 5'-CCA CCA GCG

More information

Regulation of adipose tissue remodeling by peripheral serotonin

Regulation of adipose tissue remodeling by peripheral serotonin Regulation of adipose tissue remodeling by peripheral serotonin Sangkyu Park Catholic Kwandong University College of Medicine Department of Biochemistry Serotonin (5-HT) is a signaling molecule Hemostasis

More information

Testosterone therapy (TTh) prevents progression from prediabetes to type 2 diabetes (T2DM) in hypogonadal: 9-year data from a registry study

Testosterone therapy (TTh) prevents progression from prediabetes to type 2 diabetes (T2DM) in hypogonadal: 9-year data from a registry study Testosterone therapy (TTh) prevents progression from prediabetes to type 2 diabetes (T2DM) in hypogonadal: 9-year data from a registry study F Saad 1,2, KS Haider 3, A Haider 3 1 Global Medical Affairs

More information

Obesity, Metabolic Syndrome, and Diabetes: Making the Connections

Obesity, Metabolic Syndrome, and Diabetes: Making the Connections Obesity, Metabolic Syndrome, and Diabetes: Making the Connections Alka M. Kanaya, M.D. Associate Professor of Medicine & Epi/Biostats University of California, San Francisco February 26, 21 Roadmap 1.

More information

R. Leibel Naomi Berrie Diabetes Center 19 March 2010

R. Leibel Naomi Berrie Diabetes Center 19 March 2010 Pathophysiology of type 2 diabetes mellitus R. Leibel Naomi Berrie Diabetes Center 19 March 2010 Body Mass Index Chart 25-29.9 29.9 = overweight; 30-39.9= 39.9 obese; >40= extreme obesity 5'0" 5'2" 52

More information

ShapePerfection Burns fat fights cellulite

ShapePerfection Burns fat fights cellulite Burns fat fights cellulite Burns fat fights cellulite Spicy Substances to Fight Cellulite and Excess Centimeters ShapePerfection is a liposoluble anti-cellulite slimming active ingredient that is based

More information

Supplementary Online Content

Supplementary Online Content Supplementary Online Content Larsen JR, Vedtofte L, Jakobsen MSL, et al. Effect of liraglutide treatment on prediabetes and overweight or obesity in clozapine- or olanzapine-treated patients with schizophrenia

More information

Visceral adipose tissue and carotid intimamedia thickness in HIV-infected patients undergoing cart: a prospective cohort study

Visceral adipose tissue and carotid intimamedia thickness in HIV-infected patients undergoing cart: a prospective cohort study Beires et al. BMC Infectious Diseases (2018) 18:32 DOI 10.1186/s12879-017-2884-9 RESEARCH ARTICLE Visceral adipose tissue and carotid intimamedia thickness in HIV-infected patients undergoing cart: a prospective

More information

HSN301 REVISION NOTES TOPIC 1 METABOLIC SYNDROME

HSN301 REVISION NOTES TOPIC 1 METABOLIC SYNDROME HSN301 REVISION NOTES TOPIC 1 METABOLIC SYNDROME What does the term Metabolic Syndrome describe? Metabolic syndrome describes a cluster of cardio-metabolic conditions that increase one's risk of developing

More information

Cardiometabolic Side Effects of Risperidone in Children with Autism

Cardiometabolic Side Effects of Risperidone in Children with Autism Cardiometabolic Side Effects of Risperidone in Children with Autism Susan J. Boorin, MSN, PMHNP-BC PhD Candidate Yale School of Nursing 1 This speaker has no conflicts of interest to disclose. 2 Boorin

More information

Lipoatrophic Diabetes: What can zebras teach us about horses? Ranganath Muniyappa, MD, PhD Diabetes, Endocrinology, and Obesity Branch NIDDK, NIH

Lipoatrophic Diabetes: What can zebras teach us about horses? Ranganath Muniyappa, MD, PhD Diabetes, Endocrinology, and Obesity Branch NIDDK, NIH Lipoatrophic Diabetes: What can zebras teach us about horses? Ranganath Muniyappa, MD, PhD Diabetes, Endocrinology, and Obesity Branch NIDDK, NIH Objectives 1. Describe the clinical manifestations of abnormal

More information

Conclusions. Keywords

Conclusions. Keywords Central obesity is predictive of persistent storage lower urinary tract symptoms (LUTS) after surgery for benign prostatic enlargement: results of a multicentre prospective study Mauro Gacci, Arcangelo

More information

DEVELOPMENTAL ORIGINS OF DIABETES AND CARDIOVASCULAR DISEASE. Goals

DEVELOPMENTAL ORIGINS OF DIABETES AND CARDIOVASCULAR DISEASE. Goals DEVELOPMENTAL ORIGINS OF DIABETES AND CARDIOVASCULAR DISEASE Goals Evolutionary paradox of obesity/diabetes Thrifty gene hypothesis Thrifty phenotype hypothesis Effects of small for gestational age (SGA)

More information

PCOS & Diet Therapy. Dr. Ladan Giahi Immunonutritionist Avicenna Research Institute October 2015

PCOS & Diet Therapy. Dr. Ladan Giahi Immunonutritionist Avicenna Research Institute October 2015 PCOS & Diet Therapy Dr. Ladan Giahi Immunonutritionist Avicenna Research Institute October 2015 Questions to be discussed: 1) Why dietary modification is considered as first line of treatment? 2) What

More information

THE ENDOCANNABINOID SYSTEM IN ADIPOSE TISSUE. Key Points

THE ENDOCANNABINOID SYSTEM IN ADIPOSE TISSUE. Key Points December 2008 (Vol. 1, Issue 3, pages 31-35) THE ENDOCANNABINOID SYSTEM IN ADIPOSE TISSUE By Uberto Pagotto, MD, PhD Endocrinology Unit and Center of Applied Biomedical Research (C.R.B.A.), Department

More information

Impact of Testosterone Deficiency and Testosterone Therapy on Lower Urinary Tract Symptoms in Men with Metabolic Syndrome

Impact of Testosterone Deficiency and Testosterone Therapy on Lower Urinary Tract Symptoms in Men with Metabolic Syndrome Review Article pissn: 2287-4208 / eissn: 2287-4690 World J Mens Health 2018 September 36(3): 199-222 Impact of Testosterone Deficiency and Testosterone Therapy on Lower Urinary Tract Symptoms in Men with

More information

American Journal of Oral Medicine and Radiology

American Journal of Oral Medicine and Radiology American Journal of Oral Medicine and Radiology e - ISSN - XXXX-XXXX ISSN - 2394-7721 Journal homepage: www.mcmed.us/journal/ajomr PREVALENCE OF NONALCOHOLIC FATTY LIVER DISEASE AMONG TYPE 2 DIABETIC POPULATION

More information

METABOLIC SYNDROME AND HCV: FROM HCV

METABOLIC SYNDROME AND HCV: FROM HCV METABOLIC SYNDROME AND HCV: FROM THEORY TO PRACTICE HCV Steatosis Insulin resistance Arun J Sanyal M.D. Chairman, Div. of Gastroenterology, Hepatology and Nutrition Virginia Commonwealth University Richmond,

More information

majority of the patients. And taking an aggregate of all trials, very possibly has a modest effect on improved survival.

majority of the patients. And taking an aggregate of all trials, very possibly has a modest effect on improved survival. Hello. I am Farshid Dayyani. I am Assistant Professor in Genitourinary Medical Oncology at The University of Texas MD Anderson Cancer Center. We will be talking today about prostate cancer for survivorship

More information

UMHS-PUHSC JOINT INSTITUTE

UMHS-PUHSC JOINT INSTITUTE Role of Visceral Adiposity in the Pathogenesis of Non-Alcoholic Fatty Liver Disease in Lean versus Obese Patients: A Comparative Study between Patients at UMHS versus PUHSC Lai WEI and Anna LOK W Zhang,

More information

Implications of mitochondrial skeletal muscle metabolism on diabetes and obesity before and after weight loss

Implications of mitochondrial skeletal muscle metabolism on diabetes and obesity before and after weight loss GG2 Implications of mitochondrial skeletal muscle metabolism on diabetes and obesity before and after weight loss Dr Giacomo Gastaldi CHRU Montpellier Folie 1 GG2 19.10.2009 GG_PC; 12.10.2009 Plan Introduction

More information

Client Report Screening Program Results For: Missouri Western State University October 28, 2013

Client Report Screening Program Results For: Missouri Western State University October 28, 2013 Client Report For: Missouri Western State University October 28, 2013 Executive Summary PROGRAM OVERVIEW From 1/1/2013-9/30/2013, Missouri Western State University participants participated in a screening

More information

The Pennsylvania State University. The Graduate School. College of Health and Human Development

The Pennsylvania State University. The Graduate School. College of Health and Human Development The Pennsylvania State University The Graduate School College of Health and Human Development EFFECTS OF DIETS LOW IN SFA AND WITH VARYING MUFA AND PUFA PROFILES ON BODY COMPOSITION AND HDL FUNCTION IN

More information

A synergistic anti-obesity effect by a combination of capsinoids and cold temperature through the promotion of beige adipocyte biogenesis

A synergistic anti-obesity effect by a combination of capsinoids and cold temperature through the promotion of beige adipocyte biogenesis A synergistic anti-obesity effect by a combination of capsinoids and cold temperature through the promotion of beige adipocyte biogenesis Kana Ohyama, 1,2 Yoshihito Nogusa, 1 Kosaku Shinoda, 2 Katsuya

More information

Lipout. Burns stored fat and achieves centimetric reduction BODY SCULPTURE

Lipout. Burns stored fat and achieves centimetric reduction BODY SCULPTURE April 14 Burns stored fat and achieves centimetric reduction » The modern lifestyle Stress Sedentism Unbalanced diet EXCESS FAT + CELLULITE » How to remove excess fat and cellulite? The fatty tissue is

More information

Supplementary Table 1.

Supplementary Table 1. Supplementary Table 1. Expression of genes involved in brown fat differentiation in WAT of db/db mice treated with HDAC inhibitors. Data are expressed as fold change (FC) versus control. symbol FC SAHA

More information

Tesamorelin Clinical Data Overview Jean-Claude Mamputu, PhD Senior Medical Advisor, Theratechnologies

Tesamorelin Clinical Data Overview Jean-Claude Mamputu, PhD Senior Medical Advisor, Theratechnologies Tesamorelin Clinical Data Overview Jean-Claude Mamputu, PhD Senior Medical Advisor, Theratechnologies Copyright 2016. All Rights Reserved. Property of Theratechnologies Inc. Mechanism of Action of Tesamorelin

More information

Cardiovascular Complications of Diabetes

Cardiovascular Complications of Diabetes VBWG Cardiovascular Complications of Diabetes Nicola Abate, M.D., F.N.L.A. Professor and Chief Division of Endocrinology and Metabolism The University of Texas Medical Branch Galveston, Texas Coronary

More information

Metabolic defects underlying dyslipidemia in abdominal obesity

Metabolic defects underlying dyslipidemia in abdominal obesity Metabolic defects underlying dyslipidemia in abdominal obesity Professor Marja-Riitta Taskinen Department of Medicine, Division of Cardiology Helsinki University Hospital, Finland Disclosures: Honorariums/

More information

Zia H Shah MD FCCP. Director of Sleep Lab Our Lady Of Lourdes Hospital, Binghamton

Zia H Shah MD FCCP. Director of Sleep Lab Our Lady Of Lourdes Hospital, Binghamton Zia H Shah MD FCCP Director of Sleep Lab Our Lady Of Lourdes Hospital, Binghamton Obesity 70-80% of cases Alcohol use Hypognathism Marfan s syndrome Smoking ENT problems OSA and DM epidemics have

More information

Relationship between Low Muscle Mass and Metabolic Syndrome in Elderly People with Normal Body Mass Index

Relationship between Low Muscle Mass and Metabolic Syndrome in Elderly People with Normal Body Mass Index J Bone Metab 2015;22:99-106 http://dx.doi.org/10.11005/jbm.2015.22.3.99 pissn 2287-6375 eissn 2287-7029 Original Article Relationship between Low Muscle Mass and Metabolic Syndrome in Elderly People with

More information

Timing and tempo of first year growth in relation to cardiovascular and metabolic risk profile in early adulthood

Timing and tempo of first year growth in relation to cardiovascular and metabolic risk profile in early adulthood Note: for non-commercial purposes only Timing and tempo of first year growth in relation to cardiovascular and metabolic risk profile in early adulthood Anita Hokken-Koelega Professor of Pediatric Endocrinology

More information

Development of the Automated Diagnosis CT Screening System for Visceral Obesity

Development of the Automated Diagnosis CT Screening System for Visceral Obesity Review Asian Pacific Journal of Disease Management 2008; 2(2), 31-38 Development of the Automated Diagnosis CT Screening System for Visceral Obesity Toru Nakagawa 1), Syuichiro Yamamoto 1), Masataka Irokawa

More information

ANTHROPOMETRIC CHARACTERISTICS OF SOME LIMB AND BODY CIRCUMFERENCES IN MALES AND FEMALES WITH TYPE 2 DIABETES MELLITUS

ANTHROPOMETRIC CHARACTERISTICS OF SOME LIMB AND BODY CIRCUMFERENCES IN MALES AND FEMALES WITH TYPE 2 DIABETES MELLITUS PROCEEDINGS OF THE BALKAN SCIENTIFIC CONFERENCE OF BIOLOGY IN PLOVDIV (BULGARIA) FROM 19 TH TILL 21 ST OF MAY 2005 (EDS B. GRUEV, M. NIKOLOVA AND A. DONEV), 2005 (P. 159 164) ANTHROPOMETRIC CHARACTERISTICS

More information

Placental Transport in Pathologic Pregnancies

Placental Transport in Pathologic Pregnancies Note: for non-commercial purposes only Placental Transport in Pathologic Pregnancies Gernot Desoye Clinic of Obstetrics and Gynaecology Medical University, Graz Most Common Pregnancy Pathologies Diabetes

More information

Testosterone therapy in hypogonadal men results in sustained and clinically meaningful weight loss

Testosterone therapy in hypogonadal men results in sustained and clinically meaningful weight loss clinical obesity doi: 10.1111/cob.12022 Testosterone therapy in hypogonadal men results in sustained and clinically meaningful weight loss A. A. Yassin 1 and G. Doros 2 What is already known about this

More information

Obesity and the Metabolic Syndrome in Developing Countries: Focus on South Asians

Obesity and the Metabolic Syndrome in Developing Countries: Focus on South Asians Obesity and the Metabolic Syndrome in Developing Countries: Focus on South Asians Anoop Misra Developing countries, particularly South Asian countries, are witnessing a rapid increase in type 2 diabetes

More information

Hormone Replacement Therapy

Hormone Replacement Therapy Hormone Replacement Therapy What Role Should It Play With Our Patients? Noel R. Williams MD, FACOG TESTOSTERONE FOR MEN: SALVATION OR SNAKE OIL? Definition Male hypogonadism means the testicles don't produce

More information

Understanding Body Composition

Understanding Body Composition PowerPoint Lecture Outlines 7 Understanding Body Composition Objectives Define body composition. Explain why the assessment of body size, shape, and composition is useful. Explain how to perform assessments

More information

NHS England. Evidence review: Metreleptin for Congenital Leptin Deficiency

NHS England. Evidence review: Metreleptin for Congenital Leptin Deficiency NHS England Evidence review: Metreleptin for Congenital Leptin Deficiency 1 NHS England Evidence review: Metreleptin for Congenital Leptin Deficiency First published: July 2017 Updated: Not applicable

More information

Supplementary Figure 1. DJ-1 modulates ROS concentration in mouse skeletal muscle.

Supplementary Figure 1. DJ-1 modulates ROS concentration in mouse skeletal muscle. Supplementary Figure 1. DJ-1 modulates ROS concentration in mouse skeletal muscle. (a) mrna levels of Dj1 measured by quantitative RT-PCR in soleus, gastrocnemius (Gastroc.) and extensor digitorum longus

More information

Testosterone Regulates PDE5 Expression and in vivo Responsiveness totadalafil in Rat Corpus Cavernosum

Testosterone Regulates PDE5 Expression and in vivo Responsiveness totadalafil in Rat Corpus Cavernosum European Urology European Urology 47 (2005) 409 416 Testosterone Regulates PDE5 Expression and in vivo Responsiveness totadalafil in Rat Corpus Cavernosum Xin-hua Zhang a,1, Annamaria Morelli a,1, Michaela

More information

NAFLD AND TYPE 2 DIABETES

NAFLD AND TYPE 2 DIABETES NAFLD AND TYPE 2 DIABETES Sonia Caprio, MD STOPNASH Symposium on the Origin and Pathways of Nonalcoholic Steatohepatitis Washington 7, 215 Global Projection of Diabetes Hossain P et al. N Engl J Med 27;356:213

More information

Supplemental Table 1: Demographics and characteristics of study participants. Male, n (%) 3 (20%) 6 (50%) Age, years [mean ± SD] 33.3 ± ± 9.

Supplemental Table 1: Demographics and characteristics of study participants. Male, n (%) 3 (20%) 6 (50%) Age, years [mean ± SD] 33.3 ± ± 9. SUPPLEMENTAL DATA Supplemental Table 1: Demographics and characteristics of study participants Lean (n=15) Obese (n=12) Male, n (%) 3 (20%) 6 (50%) Age, years [mean ± SD] 33.3 ± 9.5 44.8 ± 9.1 White, n

More information

Metabolic Syndrome.

Metabolic Syndrome. www.bmiweightloss.com.au What is the metabolic syndrome? The was first described in 1988 by Gerald Reavson It was originally described as the clustering of four conditions These conditions when present

More information

Body Mass Index Chart = overweight; = obese; >40= extreme obesity

Body Mass Index Chart = overweight; = obese; >40= extreme obesity Pathophysiology of type 2 diabetes mellitus R. Leibel Naomi Berrie Diabetes Center 25 February 2008 Body Mass Index Chart 25-29.9 = overweight; 30-39.9= obese; >40= extreme obesity 5'0" 5'2" Weight (lbs)

More information

FAPESP Week /21/2017

FAPESP Week /21/2017 Texas Tech University Dr Naima Moustaid-Moussa Texas Tech University FAPESP Week 2017 09/21/2017 University of Sao Paulo Dr Sonia Jancar ICB-USP Theresa Ramalho MS PhD candidate, Immunology ICB-USP Dr

More information

Association of hypothyroidism with metabolic syndrome - A case- control study

Association of hypothyroidism with metabolic syndrome - A case- control study Article ID: ISSN 2046-1690 Association of hypothyroidism with metabolic syndrome - A case- control study Peer review status: No Corresponding Author: Dr. Veena K Karanth, Associate Professor, Surgery,

More information

Antipsychotic-Related Risk for Weight Gain and Metabolic Abnormalities During Development Christoph U. Correll, MD

Antipsychotic-Related Risk for Weight Gain and Metabolic Abnormalities During Development Christoph U. Correll, MD Antipsychotic-Related Risk for Weight Gain and Metabolic Abnormalities During Development Christoph U. Correll, MD Professor of Psychiatry and Molecular Medicine Hofstra North Shore - LIJ School of Medicine

More information

Supplementary Fig. 1 eif6 +/- mice show a reduction in white adipose tissue, blood lipids and normal glycogen synthesis. The cohort of the original

Supplementary Fig. 1 eif6 +/- mice show a reduction in white adipose tissue, blood lipids and normal glycogen synthesis. The cohort of the original Supplementary Fig. 1 eif6 +/- mice show a reduction in white adipose tissue, blood lipids and normal glycogen synthesis. The cohort of the original phenotypic screening was n=40. For specific tests, the

More information

The Impact of High Intensity Interval Training On Lipid Profile, Inflammatory Markers and Anthropometric Parameters in Inactive Women

The Impact of High Intensity Interval Training On Lipid Profile, Inflammatory Markers and Anthropometric Parameters in Inactive Women Brief Report The Impact of High Intensity Interval Training On Lipid Profile, Inflammatory Markers and Anthropometric Parameters in Inactive Women Nasrin Zaer Ghodsi (MSc) Department of Physical Education,

More information

Reproductive outcome in women with body weight disturbances

Reproductive outcome in women with body weight disturbances Reproductive outcome in women with body weight disturbances Zeev Shoham M.D. Dep. Of OB/GYN Kaplan Hospital, Rehovot, Israel Weight Status BMI (kg/m 2 ) Underweight

More information

Fat Accumulation and Obesity-related Cardiovascular Risk Factors in Middle-aged Japanese Men and Women

Fat Accumulation and Obesity-related Cardiovascular Risk Factors in Middle-aged Japanese Men and Women ORIGINAL ARTICLE Fat Accumulation and Obesity-related Cardiovascular Risk Factors in Middle-aged Japanese Men and Women Miwa Ryo 1, Tohru Funahashi 1, Tadashi Nakamura 1, Shinji Kihara 1, Kazuaki Kotani

More information

GPR120 *** * * Liver BAT iwat ewat mwat Ileum Colon. UCP1 mrna ***

GPR120 *** * * Liver BAT iwat ewat mwat Ileum Colon. UCP1 mrna *** a GPR120 GPR120 mrna/ppia mrna Arbitrary Units 150 100 50 Liver BAT iwat ewat mwat Ileum Colon b UCP1 mrna Fold induction 20 15 10 5 - camp camp SB202190 - - - H89 - - - - - GW7647 Supplementary Figure

More information

The interplay between premature ejaculation and erectile dysfunction a systematic review and meta-analysis

The interplay between premature ejaculation and erectile dysfunction a systematic review and meta-analysis The interplay between premature ejaculation and erectile dysfunction a systematic review and meta-analysis Giulia Rastrelli MD, PhD Sexual Medicine and Andrology Unit Department of Experimental and Clinical

More information

Present and future association between obesity and hypogonadism in Italian male

Present and future association between obesity and hypogonadism in Italian male ORIGINAL PAPER DOI: 10.4081/aiua.2014.1.26 Present and future association between obesity and hypogonadism in Italian male Valentina Boddi 1, Valeria Barbaro 2, Paul Mc Nieven 3, Mario Maggi 1, Carlo Maria

More information

AECOM, Bronx, NY; 2 Incyte Corporation, Wilmington, DE; 3 dgd Research, San Antonio, TX; 4 Profil Institute, San Diego, CA

AECOM, Bronx, NY; 2 Incyte Corporation, Wilmington, DE; 3 dgd Research, San Antonio, TX; 4 Profil Institute, San Diego, CA INCB013739, a Selective Inhibitor of 11β-Hydroxysteroid Dehydrogenase Type 1 (11βHSD1), Improves Insulin Sensitivity and Lowers Plasma Cholesterol Over 28 Days in Patients with Type 2 Diabetes Mellitus

More information

Rehabilitation and Research Training Center on Secondary Conditions in Individuals with SCI. James S. Krause, PhD

Rehabilitation and Research Training Center on Secondary Conditions in Individuals with SCI. James S. Krause, PhD Disclosure The contents of this presentation were developed with support from educational grants from the Department of Education, NIDRR grant numbers H133B090005, H133B970011 and H133G010160. However,

More information

Diabetes in Older Adults

Diabetes in Older Adults Diabetes in Older Adults NICOLAS MUSI, MD Barshop Institute for Longevity and Aging Studies San Antonio GRECC University of Texas Health Science Center San Antonio, TX Metabolic Alterations in Aging Sarcopenia

More information

The Metabolic Syndrome Prof. Jean-Pierre Després

The Metabolic Syndrome Prof. Jean-Pierre Després The Metabolic Syndrome 1 Jean-Pierre Després, Ph.D., FAHA, FIAS Quebec Heart and Lung Institute Department of Medicine Université Laval Québec, Canada Reaven s syndrome X Triglycerides HDL cholesterol

More information

METABOLIC SYNDROME IN OBESE CHILDREN AND ADOLESCENTS

METABOLIC SYNDROME IN OBESE CHILDREN AND ADOLESCENTS Rev. Med. Chir. Soc. Med. Nat., Iaşi 2012 vol. 116, no. 4 INTERNAL MEDICINE - PEDIATRICS ORIGINAL PAPERS METABOLIC SYNDROME IN OBESE CHILDREN AND ADOLESCENTS Ana-Maria Pelin 1, Silvia Mǎtǎsaru 2 University

More information

Impact of Physical Activity on Metabolic Change in Type 2 Diabetes Mellitus Patients

Impact of Physical Activity on Metabolic Change in Type 2 Diabetes Mellitus Patients 2012 International Conference on Life Science and Engineering IPCBEE vol.45 (2012) (2012) IACSIT Press, Singapore DOI: 10.7763/IPCBEE. 2012. V45. 14 Impact of Physical Activity on Metabolic Change in Type

More information