Occurrence of brown adipocytes in rat white adipose tissue: molecular and morphological characterization

Transcription

1 Journal of Cell Science 103, (1992) Printed in Great Britain The Company of Biologists Limited Occurrence of brown adipocytes in rat white adipose tissue: molecular and morphological characterization B. COUSIN 1,2, S. CINTI 3, M. MORRONI 3, S. RAIMBAULT 2, D. RICQUIER 2, L. PÉNICAUD 1 and L. CASTEILLA 2, * 1 Laboratory of Physiopathology of Nutrition, CNRS URA 307, University of Paris VII, Paris, France 2 CEREMOD, CNRS, 9 rue Hetzel, Meudon, France 3 Institute of Normal Human Morphology, School of Medicine, University of Ancona, Ancona, Italy *Author for correspondence Summary Brown adipocytes are thermogenic cells which play an important role in energy balance. Their thermogenic activity is due to the presence of a mitochondrial uncoupling protein (UCP). Until recently, it was admitted that in rodents brown adipocytes were mainly located in classical brown adipose tissue (BAT). In the present study, we have investigated the presence of UCP protein or mrna in white adipose tissue (WAT) of rats. Using polymerase chain reaction or Northern blot hybridization, UCP mrna was detected in mesenteric, epidydimal, retroperitoneal, inguinal and particularly in periovarian adipose depots. The uncoupling protein was detected by Western blotting in mitochondria from periovarian adipose tissue. When rats were submitted to cold or to treatment with a -adrenoceptor agonist, UCP expression was increased in this tissue as in typical brown fat. Moreover, the expression was decreased in obese fa/fa rats compared to lean controls. Morphological studies showed that periovarian adipose tissue of rats kept at 24 C contained cells with numerous typical BAT mitochondria with or without multilocular lipid droplets. Immunocytochemistry confirmed that multilocular cells expressed mitochondrial UCP. Furthermore, the number of brown adipocytes and the density of mitochondrial cristae increased in parallel with exposure to cold. These results demonstrate that adipocytes expressing UCP are present in adipose deposits considered as white fat. They suggest the existence of a continuum in rodents between BAT and WAT, and a great plasticity between adipose tissue phenotypes. The physiological importance of brown adipocytes in WAT and the regulation of UCP expression remain open questions. Key words: adipocytes, thermogenic cells, mitochondria. Introduction Two functionally different types of adipocytes are known in mammals: white adipocytes, which store energy as triglycerides and release it according to organism needs, and brown adipocytes, which dissipate energy as heat. Until recently, brown and white adipocytes were considered to be mainly located in distinct depots, i.e. brown (BAT) and white (WAT) adipose tissue, respectively (Himms-Hagen, 1990; Klaus et al. 1991b). These pads are recognized by their different morphological structure and distribution (Napolitano, 1963; Afzelius, 1970; Néchad, 1986; Cinti, 1992). BAT plays an important role in the regulation of body temperature in hibernating as well as in small and newborn mammals. It has also been shown to play a role in diet-induced thermogenesis in small rodents, i.e. the release of excess food energy as heat (Rothwell and Stock, 1985; Trayhurn, 1986; Himms-Hagen, 1990; Klaus et al. 1991b). In BAT, all differentiated brown adipocytes express an uncoupling protein (UCP). This mitochondrial carrier, unique to these cells, uncouples mitochondrial ATP synthesis from the respiratory chain activity and is responsible for heat production by brown adipocytes (Nicholls and Locke, 1984; Klaus et al. 1991b). Based on these considerations, the presence of UCP is the unique feature that distinguishes brown from white adipocytes. The expression of UCP is strongly regulated at the transcriptional level by catecholamines (Ricquier et al. 1986; Rehnmark et al. 1990). Moreover, triiodothyronine and insulin also participate in this regulation (Silva, 1988; Geloën and Trayhurn, 1990; Klaus et al. 1991a). In adult rodents, the distribution of fat depots between BAT and WAT has been well documented but most of

2 932 B. Cousin and others Fig. 1. Atypical expression of UCP mrna in white fat pads of rat analyzed by Northern blotting experiments. A 20 µg sample of total RNA extracted from different adipose deposits or 2 µg of BAT total RNA were analyzed by Northern blotting. The nylon membranes were hybridized with 32 P-labelled UCP cdna or a 32 P-labelled plasmid containing the mitochondrial DNA. (A) Rats were maintained in standard conditions at 24 C. The fat pads were interscapular brown adipose tissue (BAT), periovarian (PO), retroperitoneal (RP), mesenteric (M) and inguinal deposits (I) of three rats. (B) Rats were cold exposed for 24 hours to 4 C before killing and the same adipose deposits were analyzed. these results were based on histological data (Afzelius, 1970; Néchad, 1986). Unfortunately, these criteria are somewhat insufficient; in only a few investigations antibodies against UCP or UCP cdna were used. Whether brown adipocytes are present among white fat and what are the relationships between both adipose cellular types remain open questions. These questions are major points of interest in understanding the development and regulation of body adipose mass. Thus, we have investigated the presence of UCP mrna in several fat deposits considered as white adipose tissue in rat using Northern blotting or PCR experiments combined with histological and functional studies characterizing cells expressing UCP. Materials and methods Animals Male and female Wistar rats (8 to 11 week-old), lean (Fa/Fa) and obese (fa/fa) female Zucker rats, were housed in animal quarters in which the temperature was maintained at 24 C with food and water ad libitum, and 12 h light per day. Some rats were caged individually and kept at a constant cold temperature (4 C) for 24 hours, 3 or 10 days. Another group was treated with a β3-adrenoceptor agonist (BRL 26830A, 10 mg/kg, i.p.), and animals were killed 3 hours after the injection. Animals were killed by cervical dislocation. Whole separate fat pads were rapidly removed and immediately frozen in liquid nitrogen. For histological analysis, rats were anaesthetized with chloral hydrate (400 mg/kg) and transaortically perfused with a 2% paraformaldehyde-saline solution for 2 min. Northern blot analysis Adipose tissue samples from animals were powdered in liquid nitrogen and a sample (0.3 to 1 g) from each rat was used to extract total RNA using the guanidine thiocyanate technique (Chomczynski and Sacchi, 1987). RNA concentration was determined by absorbance at 260 nm, and RNAs were stored in water + diethyl pyrocarbonate (0.02%) at 80 C until used. In order to detect the presence of UCP mrna in different pads considered as white adipose tissue, Northern blotting experiments were performed according to the method of Sambrook et al. (1989) with 20 µg of total RNA extracted from these pads (Fig. 1A). Two µg of total RNA from interscapular BAT (IBAT, which will be considered as typical brown fat) was used as control in all experiments. After blotting, nylon membranes were colored with methylene blue to detect DNA contamination and verify the quality of loading and transfer (Sambrook et al. 1989). Blots were successively hybridized with several probes, labelled with 32 P using a Megaprime labelling system kit (Amersham, Bucks, UK). Hybridizations were made with a pucp 36 insert, containing the whole cdna for rat UCP mrna (Bouillaud et al. 1985), with a pbr 325 ST41 plasmid containing the total mouse mitochondrial genome (Bibb et al. 1981) and other probes used as controls. After stringent washings, the blots were then exposed for 4 to 48 hours at 80 C with intensifiying screens. Quantification was performed by scanning densitometry. Mitochondrial preparation and Western blot analysis Mitochondria were isolated from white and brown adipose tissues

3 Atypical localization of brown adipocytes 933 as described by Klaus et al. (1991a). Proteins were quantified using Bradford s (1976) technique. Immunodetection of UCP in homogenates and mitochondria was performed as previously described (Klaus et al. 1991a). Reverse transcription and polymerase chain reaction Both cdna synthesis and polymerase chain reaction (PCR) were performed in the same buffer (Tris-HCl, 20 mm, ph 8.4; KCl, 50 mm; MgCl 2, 2.5 mm; 0.1 mg/ml nuclease-free BSA) as described previously (Ricquier et al. 1992). Sense primer OL3 matched with UCP cdna (EMBL data bank: RNUCPG) from position 589 to position 608 (GTGAAGGTCAGAATGCAAGC), antisense primer OL4 matched from position 785 to position 766 (AGGGC- CCCCTTCATGAGGTC). Light microscopy Periovarian white adipose tissue was removed and immediately fixed overnight with 3% paraformaldehyde in 0.1 M phosphate buffer, ph 7.4, dehydrated in ethanol and paraffin embedded. Each pad was embedded at the same orientation and 30 sections (3 µm thick) were serially sectioned every 200 µm and stained with haematoxylin and eosin. Electron microscopy Periovarian adipose tissue was isolated and sectioned in fragments of about 1 mm 3. These pieces were immersed in a fixative consisting of 2% glutaraldehyde and 2% formaldehyde in 0.1 M phosphate buffer, ph 7.4, at 4 C for 3 hours. Specimens were then postfixed in 1% OsO4, dehydrated in ethanol and embedded in an Epon-Araldite mixture. Semithin sections (2 µm) were stained with toluidine blue; thin sections were obtained with a Reichert Ultracut E, stained with lead citrate and examined with a Philips CM10 or Zeiss 902 electron microscope. Morphometry Number of multilocular cells per section and multilocular cell density Each section of the periovarian pad was projected on a screen by a projecting light microscope Leitz Tele-Promar 500 at a final magnification of 150. At this magnification it was easy to distinguish between unilocular (i.e. showing absolute prevalence of one, large lipid droplet and a thin rim of cytoplasm) and multilocular (i.e. showing several small lipid droplets in a granulous eosinophilic cytoplam) cells. The latter were counted directly. The total area of the tissue in each section was measured using a SEM- IPS Kontron image analyzer (Germany) with a Panasonic CCTV camera. The maximum diameter of unilocular cells and the number of capillaries per unilocular cell were determined at the light microscopic level using eyepieces with an inbuilt calibrator, on resinembedded material: four samples were selected for each animal studied (four sections three or four animals). Thick sections (2 µm) were cut from each block and stained with toluidine blue. In every section we measured the diameter of the ten largest cells; therefore in total, for each experimental group, we measured the diameters of 106 cells. The 60 cells having the smallest diameters were eliminated and we calculated the mean diameter for the remaining 100 cells (mean maximal diameter) (Loncar et al. 1988). In the same sections, the ratio of capillaries to unilocular adipocytes has been measured. For these two measurements only sections composed of unilocular cells were used. Mitochondrial area and mitochondria cristae per mitochondrion A total of 300 mitochondria, well preserved at a final magnification of 17500, were measured for each experimental group. The total area and the total length of the cristae of each mitochondrion were plotted on the graphic tablet of the analyzer and automatically measured. All data were subjected to statistical analysis using Student s t-test, for differences among the three experimental groups. Immunocytochemistry We used sections of the tissue prepared for light microscopy as described above. The 3 µm sections were dewaxed and washed twice with ethanol before the endogenous peroxidase was blocked in 0.3% hydrogen peroxide in methanol for 30 min. A sheep antirat UCP serum was used at a dilution of 1:2500 by the ABC method (Hsu et al. 1981). In controls, non-immune purified sheep IgG (Sigma Chem., Saint Louis, USA) was substituted for the primary antiserum. Immunoelectron microscopy Some fragments of periovarian adipose tissue, fixed in Fig. 2. Atypical expression of UCP mrna in white fat pads of rat analyzed by PCR experiments. PCR analysis was performed on 300 ng of total RNA with (lanes +) or without (lanes ) reverse transcriptase in the buffer. The different fat pads were inguinal (lanes 1), epididymal (lanes 2), periovarian (lanes 3), mesenteric (lanes 4) and retroperitoneal (lanes 5) adipose tissues of male (lanes *) and female rats. 100 ng (lane 6.1), 50 ng (lane 6.2) and 10 ng (lane 6.3) of total IBAT RNA were used as control. We used 300 ng of total liver RNA (lanes 7) as negative control and the plasmid containing the UCP cdna (lane 0) as positive control. The size of the mrna was determined by using a kb ladder (MW).

4 934 B. Cousin and others paraformaldehyde, 3% in phosphate buffer, were embedded in LR White Resin (London Resin Company Ltd, England) and heatcured at 52 C. Ultrathin sections were collected on 300-mesh nickel grids and placed on droplets of bovine serum albumin (BSA, fraction V, Sigma Chem.) in 0.1 M phosphate buffered saline (PBS, ph 7.4) containing 1% Tween 20 (Sigma Chem.) for 20 min at room temperature. After removing excess reagent without washing, the grids were incubated with 20 µl of a sheep antirat UCP antibody at a dilution of 1:10 in PBS/BSA + 1% Tween 20 overnight at 4 C in a humid chamber. Grids were then washed by flotation on several droplets of PBS/BSA (1%) and successively exposed to Protein A-colloidal gold complex (pag, 10 mm particle size, Sigma Chem.), diluted 1:25 in 1% PBS/BSA + 1% Tween 20, for 3 hours, at room temperature in a humid chamber. This step was followed by successive washes in PBS, postfixation in 1% glutaraldehyde in PBS for 5 min and a final wash in distilled water. The grids were then observed under a Philips CM10 electron microscope. In controls, non-immune purified sheep IgG (Sigma Chem.) was substituted for the primary antiserum. Results Molecular and functional studies Atypical UCP mrna expression The presence of UCP mrna was investigated by Northern blotting (Fig. 1A) or PCR experiments (Fig. 2). As shown in Fig. 1A, using Northern blotting of 20 µg of total RNA, no UCP mrna could be detected in inguinal and mesenteric adipose deposits from control rats even after overexposure of the autoradiographs (not shown). However, in periovarian adipose tissue and, to a lesser extent, in retroperitoneal fat pad, two signals were detected. These signals correspond to the sizes identified in IBAT (1.8 and 1.5 kb) and the shorter signal was the more abundant, as in IBAT RNA. These results demonstrated that UCP mrna was expressed in other sites than those described as typical BAT. Twenty-four hours cold-acclimatation led to an increase in UCP mrna in BAT, as well as in periovarian and retroperitoneal fat pads. Again no signal could be detected in inguinal and mesenteric adipose tissue (Fig. 1B). To determine the level of mitochondrial transcription, which is high in brown adipocytes, we also hybridized these blots with mitochondrial DNA. As shown in Fig. 1, the mitochondrial transcript level was higher in depots which expressed UCP mrna, except in inguinal fat pad. Great individual variability was noticed and it was higher in retroperitoneal than in periovarian pads. When the same blots were hybridized with probes detecting lipoprotein lipase, Glut 4, fatty acid synthase or protein disulfide isomerase mrnas, such variability was not found in WAT (data not shown), leading to the conclusion that the variability was specific to the UCP mrna expression level. To investigate the faint expression of UCP mrna in epididymal, mesenteric and inguinal deposits, we performed PCR experiments on 300 ng of total RNA extracted from different white fat pads and liver. To test the efficiency of the amplification and to quantify the reaction, the same procedure was carried out using 10, 50 or 100 ng of total RNA from IBAT. In the presence of reverse polymerase, a band of expected size (196 bp) was detected in all white adipose tissues studied, but not in liver. As shown in Fig. 2, no signal was obtained when the reverse polymerase was omitted, except in mesenteric adipose tissue from a male rat. In this case, the faint signal at 287 bp is probably due to amplification of genomic DNA: actually, the primers, OL3 and OL4, that were used match exons III and IV, respectively, and a size of 287 bp can be obtained by amplification of the end of exon III (117 bp), all of intron III (91 bp) and the beginning of exon IV (79 bp) (Bouillaud et al. 1988). Since the highest level of UCP mrna expression was found in periovarian fat pad, studies to characterize better the cell type expressing UCP were undertaken on this pad. Immunological detection of UCP protein Using anti-ucp antibodies, the presence of UCP could be faintly detected in homogenates from periovarian fat pads (lane 3, Fig. 3A) in contrast to homogenates from IBAT (lane 1, Fig. 3A). UCP was enriched in mitochondrial fractions (lane 4 compared to lane 3, Fig. 3A) and its level was increased after cold adaptation of rats for 3 days (lanes 2, 3, 4 versus 5, 6, 7, Fig. 3B). However, UCP levels were still much lower than in mitochondria isolated from BAT (lane 2, Fig. 3A; lane 1, Fig. 3B). Regulation of UCP in periovarian fat pad: effect of cold, β-agonist and obesity In IBAT, acute exposure to cold led to a rapid increase in thermogenic response and UCP mrna levels, which returned to near control values after 10 days of cold exposure (Reichling et al. 1987). The same phenomenon was observed in periovarian fat (Fig. 1A and data not shown). Treatment with a β3-adrenoceptor agonist (BRL 26830A, 10 mg/kg) increased UCP mrna levels considerably in periovarian adipose tissue. The relative increase was even higher than it was in IBAT (Fig. 4). These results indicate that the regulation of UCP mrna expression by cold and β3-adrenoceptor agonist are qualitatively similar in white adipose deposit and in IBAT. Fig. 3. Detection, by immunoblotting, of UCP in mitochondria of periovarian fat pads and increase during cold exposure. (A) Immunoblotting of UCP was performed on homogenates (lanes 1, 3) or mitochondria (lanes 2, 4), isolated from IBAT (lanes 1, 2) and periovarian fat pads (lanes 3, 4). 5 and 10 µg of proteins were loaded per lane for IBAT and periovarian fat, respectively. (B) Mitochondria were isolated from IBAT (lane 1) and periovarian tissue of control (lanes 5 to 7) and animals exposed to cold for 3 days (lanes 2 to 4). 10 µg of proteins was loaded on each lane.

5 Atypical localization of brown adipocytes 935 Fig. 4. Adrenergic control of the UCP mrna level in IBAT and periovarian fat pads. Rats were injected with either physiological serum (control rats) or BRL 26830A (10 mg/1 kg). Three hours later, animals were killed and IBAT (A) and periovarian fat pads (B) were collected. Total RNA was extracted and analyzed by Northern blotting (A, 2 µg; B, 20 µg). The membrane was autoradiographed for 3 days. A defect in thermoregulation is believed to be involved in the development of obesity (Himms-Hagen, 1990; Rothwell and Stock, 1979; Trayhurn, 1986). Indeed, a decreased UCP mrna concentration was observed in periovarian adipose tissue of obese (fa/fa) versus lean (Fa/Fa) Zucker rats, as in IBAT (Fig. 5). Morphological studies Macroscopically, the periovarian adipose tissue looked white and was quite indistinguishable from classical white adipose tissue both in control rats (24 C, group A, n = 4) and in cold-exposed animals (3 days at 4 C, group B, n = 4; 10 days at 4 C, group C, n = 3). To characterize better the cells expressing UCP in periovarian fat, histological analysis was then undertaken. Cell phenotypes in control rats Light microscopy revealed the presence of multilocular cells in periovarian adipose tissue. Most multilocular cells were isolated among unilocular cells. The number of multilocular adipocytes varied considerably from one section to the other of the same fat pad (data not shown). In electron microscopic analysis, histological data showed the presence of at least five types of cells: poorly differentiated Fig. 5. Decrease of UCP mrna expression in periovarian fat pads of obese Zucker rats compared to lean rats. RNA was extracted from IBAT (A) and periovarian fat pads (B) of 8-weekold obese and lean Zucker rats. After electrophoresis and blotting onto membrane, the nylon blots were hybridized to detect UCP mrna (A, 20 µg; B, 5 µg) and autoradiographed for 3 days. cells with numerous atypical WAT-like mitochondria (Fig. 6A), weakly differentiated multilocular cells with numerous typical mitochondria (young brown adipocytes) (Figs 6B, 8A) found in proximity to capillary walls, well differentiated multilocular cells (brown adipocytes) (Fig. 8A), unilocular cells (white adipocytes) (Fig. 6A,B) and unilocular cells with numerous mitochondria showing a morphology between BAT and WAT (Fig. 6B). It was noteworthy that the cell diameter was very variable, depending on the differentiation state. Using immunocytochemistry, multilocular cells were found positive for UCP (Fig. 7). By contrast, unilocular cells were always negative for UCP. Multilocular cells were negative when non-immune purified sheep antiserum was substituted for the primary antiserum (data not shown). Effect of cold on morphological parameters In periovarian pads of rats submitted to 3 or 10 days of cold exposure (groups B and C, respectively), both the mean number per section and the mean cellular density of multilocular cells increased when compared with control group (A) (Table 1). The maximal diameter of unilocular Table 1. Influenceof temperature on morphological parameters (± s.e.m.) in the periovarian adipose tissue 20 C 4 C for 3 days 4 C for 10 days Mean maximal unilocular cell diameter (µm) 74.21± ± ±2.78 Capillaries per unilocular cell (no.) 0.13± ± ±0.04 Mean number of multilocular cells per section (no.) 9.625± ± ±85.07* Mean density of multilocular cells (no./mm 2 ) 0.112± ± ±1.175* Mean mitochondrial area (µm 2 ) 0.534± ± ±0.031 Mitochondrial cristae per mitochondrion (µm/µm 2 ) 5.551± ±0.28* 7.573±0.267 *P<0.05 (t-test Newman-Keuls).

6 936 B. Cousin and others Fig. 6. Periovarian adipose tissue (group A: control animals). (A) Poorly differentiated cell with numerous mitochondria, in proximity to a capillary (c) and three unilocular adipocytes (U). Inset: enlargement of the framed area showing that the mitochondria are not typical of the mitochondria usually present in brown adipocytes. (B) Young brown adipocyte among two capillaries (c) and three unilocular cells (U). The unilocular cell on the upper left shows mitochondria with morphology transitional between typical (BAT-like) and atypical (WAT-like) mitochondria. Inset: enlargement of the framed area showing typical mitochondria.

7 Atypical localization of brown adipocytes 937 cells and the number of capillaries per unilocular adipocyte were not significantly altered in groups B and C. Mitochondrial area of groups submitted to cold exposure (B and C) did not change significantly, but the density of mitochondrial cristae increased (Table 1). In rats exposed for 3 days to cold (group B), as in control rats (group A), most cells exhibiting the typical morphology of brown adipocytes were isolated among the unilocular cells. In group B, most of the weakly differentiated cells surrounding capillaries were young brown adipocytes with BAT-like mitochondria (Fig. 8A). We also observed cells with BAT-like mitochondria, that had a portion of their cytoplasm partially surrounding a capillary wall (Fig. 8B). In samples from group C (10 days at 4 C), we found well-differentiated brown adipocytes containing numerous large mitochondria packed with cristae (Fig. 9) and joined by numerous gap junctions (Fig. 10). Young brown adipocytes were easily found in close apposition to capillaries. Parenchymal nerve fibres were present only in areas having groups of brown adipocytes from an animal of group C (Fig. 9). All multilocular cells from the three groups were positive for UCP (Fig. 7). In the sections from rats exposed to cold (groups B and C), the reaction looked more intense than in the section from control rats (group A). Cells from the three groups were processed for immunoelectron microscopy. In group C, numerous UCP-gold particles were present in the well-differentiated mitochondria of the multilocular cells (Fig. 9). Young brown fat cell showed a less intense, but still positive, reaction in the mitochondria (Fig. 11). Interestingly, WAT-like mitochondria of the unilocular cells showed a few UCP-gold particles (Fig. 11). Discussion The main result of this work was the detection of UCP in rat fat pads that were considered until now to be WAT. UCP is expressed in cells morphologically identical to typical brown adipocytes found in IBAT. Fig. 7. Periovarian adipose tissue. (A) Animal kept at 20 C; (B) animal kept at 4 C for 3 days; (C) animal kept at 4 C for 10 days. Immunocytochemical staining with UCP antibodies (ABC method). Multilocular cells are positive for UCP. UCP is not expressed exclusively in areas described as typical brown adipose tissue Utilization of antibodies and/or cdnas led several authors to conclude that UCP is unique to BAT (Cannon et al. 1982; Klaus et al. 1991b). The only exhaustive study of UCP expression in different fat pads of animals kept at normal temperature was made in ruminant species (Casteilla et al. 1987; Vatnick et al. 1987; Casteilla et al. 1989; Soppela et al. 1991). To our knowledge, no such study has been performed in adult rodents not exposed to cold and no PCR analysis has been performed on any species. The present data show clearly that UCP expression is not specific to areas described as typical BAT, but can also be found in fat pads classically considered to be white. Thus, Northern analysis and/or PCR experiments showed the presence of UCP in periovarian, retroperitoneal and to a lesser extent epididymal, mesenteric and inguinal fat pads. The cells expressing UCP in these deposits have the bio-

8 938 B. Cousin and others Fig. 8. Periovarian adipose tissue (group B: animal kept at 4 C for 3 days ). (A) Brown adipocytes at different levels of differentiation, surrounding a capillary (C). Inset: enlargment of the framed area showing numerous typical mitochondria. (B) Poorly differentiated cell with a portion of its cytoplasm (arrowheads) partially surrounding the capillary (C) wall. The cell is surrounded by a distinct basal lamina (BL) and contains typical mitochondria.

9 Atypical localization of brown adipocytes 939 Fig. 9. Periovarian adipose tissue (group C: animal kept at 4 C for 10 days). Cytoplasm of a brown adipocyte showing typical mitochondria packed with cristae. Right bottom inset: same type of cell tested with antibodies to UCP protein linked to 10 nm gold particles (pag method). The presence of numerous gold particles on the mitochondria demonstrates the presence of UCP in this organelle. Left upper inset: a parenchymal nerve fibre with numerous vesicles. chemical and morphological characteristics of brown adipocytes. Among the biochemical characteristics, the increase in UCP level in these tissues after cold exposure or β-adrenoceptor agonist treatment favours the presence of true brown adipocytes. This was confirmed in periovarian adipose tissue of control rats by immunohistological studies. When animals were cold-adapted, the number of multilocular cells and the density of mitochondrial cristae increased. These results are in agreement with those found for inguinal (Loncar, 1991) and parametrial adipose tissue (Young et al. 1984) of mice. Physiological relevance Taking into account the total RNA content of IBAT and WAT, and the results of Northern analysis, periovarian and retroperitoneal adipose depots are equivalent to one hundredth and one thousandth of IBAT, respectively, regarding UCP expression. Although this amount of UCP mrna in WAT is relatively small in comparison with that found in BAT, one cannot exclude the possibility that there is some physiological relevance. Indeed, it should be noted that under cold stress or β-adrenoceptor agonist treatment, the enhanced expression of UCP was more marked in periovarian adipose tissue (7-fold) than in IBAT (3-fold). These observations are in agreement with the thermogenic role of brown adipocytes. In addition to non-shivering thermogenesis and arousal from hibernation, brown fat thermogenesis may also participate in the regulation of energy balance. BAT thermogenesis is defective in genetic and experimental models of obesity (Himms-Hagen, 1990; Trayhurn, 1986). UCP reinduction in dogs treated with a β3-adrenoceptor agonist is concomitant with a decreased weight gain (Champigny et al. 1991). In the present work, UCP mrna was expressed less in periovarian adipose tissue of obese

10 940 B. Cousin and others Zucker rats than in lean rats. This is similar to results found for IBAT of obese rats (Ricquier et al. 1986). Thus, brown adipocytes from periovarian fat pad seem to behave like brown adipocytes from typical brown fat. A specific function for these brown fat cells related to their location cannot be ruled out. On the other hand, the great individual variability of UCP expression in periovarian adipose tissue, which persists after cold exposure or β3-agonist treatment, cannot be explained. The possibility of hormonal regulation linked to the sexual cycle is under investigation. Fig. 10. A gap junction between two brown adipocytes in the periovarian adipose tissue of animal exposed in cold for 10 days (group C). Tissue and cell plasticity The present data demonstrate the great plasticity of adipose tissues in rodents but the mechanism underlying the reorganization of periovarian fat pad upon exposure to cold is still difficult to explain. Adipose tissue plasticity has already been observed in developing hamsters (Smalley, 1970), cats (Loncar and Afzelius, 1989) and ruminants (Gemell et al. 1972; Casteilla et al. 1987; Vatnick et al. 1987; Casteilla et al. 1989; Soppela et al. 1991). In these species, studies have suggested that rapidly after birth all Fig. 11. Periovarian adipose tissue (group C). Immunoelectron microscopy of UCP antibodies (pag method). A brown adipocyte precursor with poorly differentiated mitochondria. Upper right inset: enlargement of the framed area showing the UCP-gold particles on the mitochondria. Lower left inset: atypical mitochondrion of a unilocular cell showing only a few UCP-gold particles (arrows).

11 Atypical localization of brown adipocytes 941 deposits loose BAT characteristics and seem to be transformed into white-like adipose tissues. On the other hand, WAT of adult humans and animals can be reconverted to BAT in particular conditions (Ricquier et al. 1982; Young et al. 1984; Loncar et al. 1988; Champigny et al. 1991; Cinti et al. 1991). Taken together, these results suggest a possible interconversion at the cellular level between brown and white-like adipocytes. It is rather difficult to decide whether there has been a new recruitment of preadipocytes to the tissue or a real conversion of adipocyte phenotypes. Cells exhibiting the ultrastructure of brown adipocyte precursors as defined by Barnard and Skala (1970) and Néchad and Barnard (1979) are present in periovarian adipose tissue of rats kept at 20 C. On the other hand, the presence of unilocular cells with a morphology between BAT and WAT, or with mitochondria faintly positive for UCP, suggests that some unilocular cells are masked brown adipocytes which could be unmasked under physiological or pharmacological stimuli. This is reminiscent of the histological observations made by Gemmel et al. (1972) and of the proposal that there is convertible adipose tissue, made by Loncar (Loncar et al. 1986; Loncar, 1991). Innervation, which has been observed in BAT-like arrangements of the tissue from cold-adapted rats, could be a major determinant of these processes. Nevertheless, more quantitative data are necessary in order to draw reliable conclusions. A new classification for adipose tissue: analogy with muscle The present study suggests a new classification for adipose tissues. Ashwell proposed the existence of a continuum between BAT and WAT among different types of mammals (Ashwell, 1985; Ashwell et al. 1990). Our results are in favor of this hypothesis and suggest that this continuum of adipose tissue from typical BAT to typical WAT exists in the same species. In rodents, the adipose tissues forming the extremities of this spectrum would have a population of adipocytes with a major phenotype and the intermediates would be made up of mixed populations, like periovarian adipose tissue. Furthermore, the data suggest that transformation during cold exposure or in obese rats could take place along this spectrum. According to their place along this spectrum, adipose tissues could participate in different functions and in metabolic regulation. This suggests an analogy between muscle and adipose tissue. Like adipose tissue, muscle is a heterogeneous tissue composed of a mixture of red and white fibres the proportions of which vary from one muscle to another. Red fibres and brown adipocytes, as opposed to white fibres and white adipocytes, are highly oxidative cells. In rodents, skeletal muscles, as well as adipose tissues, seem to be very adaptable and to respond to different situations by changing their structure and metabolism according to new metabolic demands. As in adipose tissue, in a given muscle the proportions of each type of cells vary, according to the physiological (Salmon and Henriksson, 1981), and/or pathological situation (Lillioja et al. 1987; Torgan et al. 1989). In summary, these data demonstrate the presence of brown adipocytes in numerous white fat pads of rodents. This suggests that adipocytes with thermogenic properties may be more generally distributed than previously thought. Whether this is the case in other species, particularly in humans, remains to be determined. The authors thank C. Zingaretti, E. Ceresi and V. Carboni for their excellent technical assistance, and Dr J. Girard for his support. We thank Drs Odette Champigny and Susi Klaus for their helpful comments and corrections on this manuscript. B. Cousin was a fellow of the French Ministry of Research and Technology. This work was made possible by grants from the Centre National de la Recherche Scientifique, Fondation pour la Recherche Médicale. References Afzelius, B. A. (1970). Brown adipose tissue: Its gross anatomy, histology and cytology. In Brown Adipose Tissue (ed. O. Lindberg), pp New York: American Elsevier. Ashwell, M. (1985). Is there a continuous spectrum of the adipose tissues in animals and man? In Metabolic Complications of Human Obesities (ed. J. Vague et al.), pp New York: Elsevier Science Publishers B. V. Ashwell, M., Stirling, D., Freeman, S. and Holloway, B. (1990). Transformations within the continuous spectrum of the adipose tissues. In Recent Advances in Obesity Research: V (ed. E. M. Berry et al.), pp London: J. Libbey. Barnard, T. and Skala, J. (1970). The development of brown adipose tissue. In Brown Adipose Tissue (ed. O. Lindberg), pp New York: American Elsevier. Bibb, M., Van Etten, R., Wright, C., Walberg, M. and Clayton, D. (1981). Sequence and gene organization of mouse mitochondrial DNA. Cell 26, Bouillaud, F., Raimbault, S., and Ricquier, D. (1988) The gene for rat uncoupling protein: complete sequence, structure of primary transcript and evolutionary relationship between exons. Biochem. Biophys. Res. Commun. 157, Bouillaud, F., Ricquier, D., Thibault, J. and Weissenbach, J. (1985). Molecular approach to thermogenesis in brown adipose tissue. cdna cloning of the mitochondrial uncoupling protein. Proc. Nat. Acad. Sci. U.S.A. 82, Bradford, M. M. (1976). A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 72, Bukowiecki, L. J., Geloen, A. and Collet, A. J. (1986). Proliferation and differentiation of brown adipocytes from interstitial cells during cold exposure. Amer. J. Physiol. 250, C880-C887. Cannon, B., Hedin, A. and Nedergaard, J. (1982). Exclusive occurrence of thermogenin antigen in brown adipose tissue. FEBS Lett. 150, Casteilla, L., Champigny, O., Bouillaud, F., Robelin, J. and Ricquier, D. (1989). Sequential changes in the expression of mitochondrial protein mrna during the development of brown adipose tissue in bovine and ovine species. Biochem. J. 257, Casteilla, L., Forest, C., Robelin, J., Ricquier, D., Lombet, A. and Ailhaud, G. (1987). Characterization of mitochondrial uncoupling protein in bovine fetus and newborn calf. Disappearance in lamb during aging. Amer. J. Physiol. 252, E627-E636. Champigny, O., Ricquier, D., Blondel, O., Mayers, R. M., Briscoe, M. G. and Holloway, B. R. (1991). β3-adrenergic receptor stimulation restores message and expression of brown-fat mitochondrial uncoupling protein in adult dogs. Proc. Nat. Acad. Sci. U.S.A. 88, Chomczynski, P. and Sacchi, N. (1987). Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal. Biochem. 162, Cinti, S. (1992). Morphological and functional aspects of brown adipose tissue. In The Obese Child, vol. 2 (ed. P. L. Giorgi et al.), pp Basel, Karger. Cinti, S., Morroni, M. and Carboni, V. (1991). Interscapular brown adipose tissue of old rats after cold acclimatation and cafeteria diet: a morphometric study. Int. J. Obes. 15 (Suppl. 1), 64.

12 942 B. Cousin and others Geloën, A. and Trayhurn, P. (1990). Regulation of the level of uncoupling protein in brown adipose tissue by insulin requires the mediation of the sympathetic nervous system. FEBS Lett. 267, Gemmell, R. T., Bell, A. W. and Alexander, G. (1972). Morphology of adipose cells in lambs at birth and during subsequent transition of brown to white adipose tissue in cold and in warm conditions. Amer. J. Anat. 133, Himms-Hagen, J. (1990). Brown adipose tissue thermogenesis: interdisciplinary studies. FASEB J. 4, Hsu, S. M., Raine, L., and Fanger, H. (1981). Use of avidin-biotin-peroxydase complex (ABC) in immunoperoxydase technic: a comparison between ABC and unlabelled antibody (PAP procedures). J. His - tochem. Cytochem. 29, Klaus, S., Cassard-Doulcier, A. M. and Ricquier, D. (1991a). Development of Phodopus Sungorus brown preadipocytes in primary cell culture: Effect of an atypical beta-adrenergic agonist, insulin, and triiodothyronine on differentiation, mitochondrial development, and expression of the uncoupling protein UCP. J. Cell Biol. 115, Klaus, S., Casteilla, L., Bouillaud, F. and Ricquier, D. (1991b). The uncoupling protein UCP: a membraneous mitochondrial ion carrier exclusively expressed in brown adipose tissue. Int. J. Biochem. 23, Lillioja, S., Young, A. A., Culter, C. L., Ivy, J. L., Abbott, W. G. H., Zawadzki, J. K., Yki-Jarvinen, H., Christin, L., Secomb, T. W. and Bogardus, C. (1987). Skeletal muscle capillary density and fiber type are possible determinants of in vivo insulin resistance in man. J. Clin. Invest. 80, Loncar, D. (1991). Convertible adipose tissue in mice. Cell Tiss. Res. 266, Loncar, D. and Afzelius, B. A. (1989). Ontogenetical changes in adipose tissue of the cat: convertible adipose tissue. J. Ultrastruct. Res. 102, Loncar, D., Afzelius, B. A. and Cannon, B. (1988). Epididymal white adipose tissue after cold stress in rats. I. Nonmitochondrial changes. J. Ultrastruct. Res. 101, Loncar, D., Bedrica, L., Mayer, J., Cannon, B., Nedergaard, J., Afzelius, B. A. and Svajger, A. (1986). The effect of intermittent cold treatment on the adipose tissue of the cat. Apparent transformation from white to brown adipose tissue. J. Ultrastruct. Mol. Struct. Res. 97, Napolitano, L. (1963). The differentiation of white adipose cells. J. Cell Biol. 18, Néchad, M. and Barnard, T. (1979). Development of the interscapular brown adipose tissue in the hamster. Two pathways of adipocyte differentiation and the development of the sympathetic innervation. Biol. Cell 36, Néchad, M. (1986). Structure and development of brown adipose tissue. In Brown Adipose Tissue (ed. P. Trayhurn and D. G. Nicholls), pp London: E. Arnold. Nicholls, D. G. and Locke, R. M. (1984). Thermogenic mechanisms in brown fat. Physiol. Rev. 64, Reichling, S., Ridley, R.G., Patel, R. H., Harley, C. V., and Freeman K. B. (1987) Loss of brown adipose tissue uncoupling protein mrna on deacclimation of cold-exposed rats. Biochem. Biophys. Res. Commun. 142, Rehnmark, S., Néchad, M., Herron, D., Cannon, B. and Nedergaard, J. (1990). α and β-adrenergic induction of the expression of the uncoupling protein thermogenin in brown adipocytes differentiated in culture. J. Biol. Chem. 265, Ricquier, D., Bouillaud, F., Toumelin, P., Mory, G., Bazin, R., Arch, J. and Pénicaud, L. (1986). Expression of the uncoupling protein mrna in thermogenic or weakly thermogenic brown adipose tissue. Evidence for a rapid β-adrenoceptor-mediated and transcriptionally regulated step during activation of thermogenesis. J. Biol. Chem. 261, Ricquier, D., Néchad, M. and Mory, G. (1982). Ultrastructural and biochemical characterization of human brown adipose tissue in pheochromocytoma. J. Clin. Endocrinol. Metab. 54, Ricquier, D., Raimbault, S., Champigny, O., Miroux, B. and Bouillaud, F. (1992). The uncoupling protein is not expressed in rat liver. FEBS Lett. 303, Rothwell, N. J. and Stock, M. J. (1979). A role for brown adipose tissue in diet-induced thermogenesis. Nature 281, Rothwell, N. J. and Stock, M. J. (1985). Biological distribution and significance of brown adipose tissue. Comp. Biochem. Physiol. 82A, Salmon, S. and Henriksson, J. (1981). The adaptative response to skeletal muscle to increased used. Muscle Nerve 4, Sambrook, J., Fritsch, E. F. and Maniatis, T. (1989). In Molecular Cloning. A Laboratory Manual (ed. C. Nolan et al.), New York: C. S. H. Silva, J. E. (1988). Full expression of uncoupling protein gene requires the concurrence of norepinephrine and triiodothyronine. Mol. Endocrinol. 2, Smalley, R. L. (1970). Changes in composition and metabolism during adipose tissue development. In Brown Adipose Tissue (ed. O. Lindberg), pp New York: American Elsevier. Soppela, P., Nieminen, M., Saarela, S., Keith, J. S., Morrison, J. N., McFarlane, F. and Trayhurn, P. (1991). Brown fat-specific mitochondrial uncoupling protein in adipose tissues of newborn reindeer. Amer. J. Physiol. 260, R1229-R1234. Torgan, C. E., Brozinick, J. T., Kastello, G. M. and Ivy, J. L. (1989). Muscle morphological and biochemical adaptation to training in obese Zucker rats. J. Appl. Physiol. 67, Trayhurn, P. (1986). Brown adipose tissue and energy balance. In Brown Adipose Tissue (ed. P. Trayhurn and D. G. Nicholls), pp London: E. Arnold. Vatnick, I., Tyzbir, R. S., Welch, J. G. and Hooper, A. P. (1987). Regression of brown adipose tissue mitochondrial function and structure in neonatal goats. Amer. J. Physiol. 252, E391-E395. Young, P., Arch, J. R. S. and Ashwell, M. (1984). Brown adipose tissue in the parametrial fat pad of the mouse. FEBS Lett. 167, (Received 16 June Accepted 3 September 1992)