ELŐADÁS KIVONAT CLASSROOM LECTURE HANDOUT. financed by the program

Size: px
Start display at page:

Download "ELŐADÁS KIVONAT CLASSROOM LECTURE HANDOUT. financed by the program"

Transcription

1 TÁMOP C-13/1/KONV projekt Az élettudományi-klinikai felsőoktatás gyakorlatorientált és hallgatóbarát korszerűsítése a vidéki képzőhelyek nemzetközi versenyképességének erősítésére program keretében finanszírozott ELŐADÁS KIVONAT CLASSROOM LECTURE HANDOUT financed by the program Practice-oriented, student-friendly modernization of the biomedical education for strengthening the international competitiveness of the rural Hungarian universities Dátum / Date: FEBRUÁR 8. / FEBRUARY 8, 2017 Helyszín / Place: MTA SZBK Biofizika Tanácsterem / Lecture room of the Institute of Biophysics, BRC SZEGED, TEMESVÁRI KRT. 62. Az előadás címe / Title of the presentation: LIPIDS IN HEALTH AND DISEASE Előadó / Speaker: GÁBOR BALOGH Biological Research Centre Address: H-6726 Szeged, Temesvári krt. 62. Mail: H-6701 Szeged, POB

2 Lipids in health and disease Gábor Balogh Laboratory of Molecular Stress Biology Lipidomics Research Group Institute of Biochemistry BRC HAS 2017 Modern view of biological membranes The complex world of lipids Lipid metabolism The origin of lipid diversity The function of microdomains Lipids in Calcium regulation Lipids in apoptosis Lipids as endogenous receptor agonists Lipids in inflammation Lipidomics: How to quantify several hundreds of lipid species in a couple of minutes? Stress lipidomics Neurolipidomics & imaging MS 1. Lipid biomarkers of cancer: imaging MS 2. & intelligent knife Lipid biomarkers of diabetes Membrane lipid therapy New directions: towards single cell lipidomics Modern view of biological membranes The complex world of lipids Lipid metabolism The origin of lipid diversity The function of microdomains Lipids in Calcium regulation Lipids in apoptosis Lipids as endogenous receptor agonists Lipids in inflammation Lipidomics: How to quantify several hundreds of lipid species in a couple of minutes? Stress lipidomics Neurolipidomics & imaging MS 1. Lipid biomarkers of cancer: imaging MS 2. & intelligent knife Lipid biomarkers of diabetes Membrane lipid therapy New directions: towards single cell lipidomics 1

3 Classical textbook view Subcellular distribution of lipids Sites of lipid synthesis Redrawn after van Meer et al.,

4 Complexity, leaflet asymmetry Lateral segregation Seeger/Heimburg: Monte-Carlo simulation Modern view of biological membranes The complex world of lipids Lipid metabolism The origin of lipid diversity The function of microdomains Lipids in Calcium regulation Lipids in apoptosis Lipids as endogenous receptor agonists Lipids in inflammation Lipidomics: How to quantify several hundreds of lipid species in a couple of minutes? Stress lipidomics Neurolipidomics & imaging MS 1. Lipid biomarkers of cancer: imaging MS 2. & intelligent knife Lipid biomarkers of diabetes Membrane lipid therapy New directions: towards single cell lipidomics 3

5 Lipids OH H O O H/Radyl H/Radyl The complex world of lipids Fatty acids trans cis saturated unsaturated 4

6 Fatty acid nomenclature ω α Δ9 desaturation ω3 desaturation ω6 desaturation ω3 desaturation essential fatty acids (mammals) Lipid backbones H 3 C OH CH 3 CH 3 HO OH OH R NH 2 OH CH 3 CH 3 Glycerol Sphingoid base Sterane Phospholipids - headgroups CL anionic 5

7 6

8 Inverted hexagonal (H II ) and micellar hexagonal (H I ) phases Tresset PMC Biophysics :3 micelle Bristol model makers Lipid diversity Structure The complexity of lipidome 7

9 Lipid diversity Structure and function Fully substituted Storage lipids O O O FA1 FA2 FA3 TG R Energy storage and lipid transport Membrane lipids O O P FA1 FA2 Choline OH NH FA P Choline Membrane structure and function PC SM Partially substituted Signal lipids O O FA1 FA2 R OH NH FA Cell signalling and metabolic homeostasis OH DG OH Cer Modern view of biological membranes The complex world of lipids Lipid metabolism The origin of lipid diversity The function of microdomains Lipids in Calcium regulation Lipids in apoptosis Lipids as endogenous receptor agonists Lipids in inflammation Lipidomics: How to quantify several hundreds of lipid species in a couple of minutes? Stress lipidomics Neurolipidomics & imaging MS 1. Lipid biomarkers of cancer: imaging MS 2. & intelligent knife Lipid biomarkers of diabetes Membrane lipid therapy New directions: towards single cell lipidomics Lipid metabolism - regulation New tools to investigate the regulation of lipid metabolism - genetic manipulations - lipidomics - systems biology (e.g. flux balance) Eugene P. Kennedy ( ) 60 years ago Yeast 8

10 Yeast Lipid synthesis (yeast) Global analysis of the yeast lipidome, Ejsing, PNAS, 2009 Lipid synthesis in Drosophila 9

11 Phospholipid synthesis and remodelling (mammalian) Lipid metabolism (mammalian) in context Sphingolipid metabolism (mammalian) 10

12 Modern view of biological membranes The complex world of lipids Lipid metabolism The origin of lipid diversity The function of microdomains Lipids in Calcium regulation Lipids in apoptosis Lipids as endogenous receptor agonists Lipids in inflammation Lipidomics: How to quantify several hundreds of lipid species in a couple of minutes? Stress lipidomics Neurolipidomics & imaging MS 1. Lipid biomarkers of cancer: imaging MS 2. & intelligent knife Lipid biomarkers of diabetes Membrane lipid therapy New directions: towards single cell lipidomics 11

13 The origin of lipid diversity Phylogenetic tree of life after Woese et al with representative membrane lipids of the three domains of life: Bacteria, Archaea and Eukarya (modified after Schubotz, 2009) The origin of lipid diversity temperature adaptation homeoviscous adaptation T= 60 C Alvinella pompejana 'Textbook biology tells us that animals can be psychrophilic [cold loving] or thermophilic [heat loving] but not both. The alvinellids just didn't read the textbook.' S.C. Cary Modern view of biological membranes The complex world of lipids Lipid metabolism The origin of lipid diversity The function of microdomains Lipids in Calcium regulation Lipids in apoptosis Lipids as endogenous receptor agonists Lipids in inflammation Lipidomics: How to quantify several hundreds of lipid species in a couple of minutes? Stress lipidomics Neurolipidomics & imaging MS 1. Lipid biomarkers of cancer: imaging MS 2. & intelligent knife Lipid biomarkers of diabetes Membrane lipid therapy New directions: towards single cell lipidomics 12

14 Lateral segregation Seeger/Heimburg: Monte-Carlo simulation anullar lipids microdomains (e.g. rafts), anullar lipids protein Annular lipid-binding sites (Lee AG.) Cardiolipin is required for the proper respiratory supercomplex function membrane Cardiolipin is required for the proper respiratory supercomplex function Althoff et al.; Schlame M, Dowhan W 13

15 Membrane lipids such as cholesterol and sphingolipids influence the function of GPCRs The structure of the human A2A adenosine receptor (in light blue), with three bound cholesterol molecules (in yellow) The structure of the human 2-adrenergic receptor (in blue) with a bound partial inverse agonist carazolol (in green) embedded in a lipid bilayer. Cholesterol molecules between two receptor molecules are shown in orange. Jafurulla M & Chattopadhyay A 2013 Lateral segregation, microdomains (e.g. rafts), anullar lipids Seeger/Heimburg: Monte-Carlo simulation Membrane microdomain-mediated intracellular signaling pathways in colorectal cancer (Jahn KA et al. 2011) 14

16 Modern view of biological membranes The complex world of lipids Lipid metabolism The origin of lipid diversity The function of microdomains Lipids in Calcium regulation Lipids in apoptosis Lipids as endogenous receptor agonists Lipids in inflammation Lipidomics: How to quantify several hundreds of lipid species in a couple of minutes? Stress lipidomics Neurolipidomics & imaging MS 1. Lipid biomarkers of cancer: imaging MS 2. & intelligent knife Lipid biomarkers of diabetes Membrane lipid therapy New directions: towards single cell lipidomics Lipids in Calcium regulation: IP3 DAG 15

17 Modern view of biological membranes The complex world of lipids Lipid metabolism The origin of lipid diversity The function of microdomains Lipids in Calcium regulation Lipids in apoptosis Lipids as endogenous receptor agonists Lipids in inflammation Lipidomics: How to quantify several hundreds of lipid species in a couple of minutes? Stress lipidomics Neurolipidomics & imaging MS 1. Lipid biomarkers of cancer: imaging MS 2. & intelligent knife Lipid biomarkers of diabetes Membrane lipid therapy New directions: towards single cell lipidomics Lipids in apoptosis: Ceramide Membrane asymmetry 16

18 Apoptotic cells stained with annexin V (green) to show phosphatidylserine exposed on the outer membrane leaflet Oxidative signaling of PS externalization during apoptosis Modern view of biological membranes The complex world of lipids Lipid metabolism The origin of lipid diversity The function of microdomains Lipids in Calcium regulation Lipids in apoptosis Lipids as endogenous receptor agonists Endocannabinoids Lipids in inflammation Lipidomics: How to quantify several hundreds of lipid species in a couple of minutes? Stress lipidomics Neurolipidomics & imaging MS 1. Lipid biomarkers of cancer: imaging MS 2. & intelligent knife Lipid biomarkers of diabetes Membrane lipid therapy New directions: towards single cell lipidomics 17

19 Endogenous Cannabinoids N-arachidonoyl-ethanolamine O-arachidonoylethanolamine 2-arachidonyl glyceryl ether Myocardial infarction (ischaemia-reperfusion injury) (R, P, H) Heart failure, cardiomyopathies (R, H) Atherosclerosis, restenosis (R, H) Stroke, spinal cord injury (R, H) Cirrhotic cardiomyopathy (R, H) Septic shock by live bacteria (R, H) Hepatic ischaemia-reperfusion injury (R, P, H) Obesity, non-alcoholic fatty liver disease, diabetic complications (R, H) Liver fibrosis, cirrhosis, alcohol-induced liver injury (R, H) Pancreatitis (R, H) Inflammatory bowel disease, colitis, diverticulitis (R, H) Nephropathy (R, H) Neurodegenerative/neuroinflammatory disorders (multiple sclerosis, Alzheimer's, Parkinson's and Huntington's disease, spinal cord injury) (R, H) Pain (R) Psychiatric disorders (anxiety and depression, schizophrenia) (R, H) Rheumatoid arthritis (H) Cancer (R, H) C, canine; H, human; P, pig; R, rodent. Modulating the endocannabinoid system in human health and disease successes and failures FEBS Journal pages , 22 APR

20 Modern view of biological membranes The complex world of lipids Lipid metabolism The origin of lipid diversity The function of microdomains Lipids in Calcium regulation Lipids in apoptosis Lipids as endogenous receptor agonists Lipids in inflammation Lipidomics: How to quantify several hundreds of lipid species in a couple of minutes? Stress lipidomics Neurolipidomics & imaging MS 1. Lipid biomarkers of cancer: imaging MS 2. & intelligent knife Lipid biomarkers of diabetes Membrane lipid therapy New directions: towards single cell lipidomics Lipids in inflammation: Eicosanoids and docosanoids Figure 1 Temporal changes in lipid mediators in the progression of acute inflammation. Yacoubian S and Serhan CN (2007) New endogenous anti-inflammatory and proresolving lipid mediators: implications for rheumatic diseases Nat Clin Pract Rheumatol 3: doi: /ncprheum

21 T M G. Balogh February 8, 2017 HETEs OH O OH O Prostaglandin s O OH 15(S)HETE Arachidonic Acid 15 LO HO O OH OH COX PGE 2 P450 Epoxyeicosatrienoids O OH H OH 5 LO Leukotrienes H OH O OH O 14,15-EET LTB 4 LIPID MAPS Modern view of biological membranes The complex world of lipids Lipid metabolism The origin of lipid diversity The function of microdomains Lipids in Calcium regulation Lipids in apoptosis Lipids as endogenous receptor agonists Lipids in inflammation Lipidomics: How to quantify several hundreds of lipid species in a couple of minutes? Stress lipidomics Neurolipidomics & imaging MS 1. Lipid biomarkers of cancer: imaging MS 2. & intelligent knife Lipid biomarkers of diabetes Membrane lipid therapy New directions: towards single cell lipidomics 20

22 Lipidome 21

23 Systems biology of lipids Technical development Lipid analysis in the 90s Large sample quantity TLC separation Fatty acid analysis Analysis time: days 22

24 Lipid analysis GC-MS Derivatisation FA composition (positional or cis/trans isomers) O O X FA1 FA2 (x10,000,000) Scan:TIC 1.50 SIM:TIC (1.19) MeO FA1 + MeO FA2 methyl esters 1.25 Positional isomers n-3 n :0 14:1 15:0 15:1 16:0 16:1 n-7 17:0 17:1 18:0 18:1 n-9 trans 18:1 n-9 18:2 n-6 trans 18:2 n-6 18:3 n-6 18:3 n-3 20:0 20:1 20:2 21:0 20:3 n-6 20:4 n-6 20:3 n-3 22:0 22:1 20:5 n-3 22:2 + 23:0 24:0 24: n ESI-MS lipidomics O 16:0 Ionisation Electrospray (ESI) O 20:4 lipid molecular species composition P Choline analysis time minutes high troughput PC(16:0/20:4) quantity low (hundreds of cells) (protein μg equivalent) Concentration nanomol (total) / picomol (species) Sample amount 5 µl Lipid(omic) analysis mass spectrometry Orbitrap Elite since Sept

25 Lipid diversity structure, concentration and function PC Sphingomyelin Ceramide Sphingosine S1P 300,000 30,000 3, P Lipidomics workflow Lipidomics workflow We need all of the lipids extracted sample extraction lipid extract 24

26 Lipidomics workflow Triglycerides Phospholipids Gangliosides hexane water We need all of the lipids extracted sample extraction small sample size lipid extract Lipidomics workflow Mass spectrometry We need IONS!!! Polarity + or - Proper solvent system, additives Lipidomics workflow Data analysis We need software LipidXplorer + In-House development 25

27 Lipidomics workflow Interpretation Statistics Bioinformatics Systems biology And again we need brain Shotgun lipidomics identification of lipid molecular species Intensity Survey scan (MS1) High mass accuracy & resolution e.g.: (PI 38:4) m/z Intensity Fragmentation (MS2, MSn) Fatty acyl chains e.g.: PI 18:0/20:4 PI 18:1/20:3 m/z Modern view of biological membranes The complex world of lipids Lipid metabolism The origin of lipid diversity The function of microdomains Lipids in Calcium regulation Lipids in apoptosis Lipids as endogenous receptor agonists Lipids in inflammation Lipidomics: How to quantify several hundreds of lipid species in a couple of minutes? Stress lipidomics Neurolipidomics & imaging MS 1. Lipid biomarkers of cancer: imaging MS 2. & intelligent knife Lipid biomarkers of diabetes Membrane lipid therapy New directions: towards single cell lipidomics 26

28 Stress Heat shock proteins Membranes, lipid droplets Stress sensor models Unfolded Protein Membrane perturbation Morimoto, GENES & DEVELOPMENT 1998 Morimoto et al., 12: Vigh et al., TIBS (1998) Genes and Development (1998) Membranes are stress sensors stress lipidomics Without stress there would be no life (Hans Selye) Heat shock response (HSR) Lipid-related changes Composition Microdomain reorganization Signal lipids 27

29 G. Balogh February 8, 2017 Stress-induced lipid remodelling PCA ESI-MS/MS ca. 160 species (>1% within its class) 4 different conditions 4 replicates Unsupervised method Principal component analysis 0.00 S1 S5 S9 S13 S17 S21 PC1, stress vs control PC2, BA vs heat PC3, mild vs severe heat Stress-induced lipid remodelling Lipid classes C 41C 43C Phospholipase action Raft forming lipids 25 BA 20 mol% of total * ** *** 5 ** 2 1 * * *** 0 PC PC PE PE PS PI PG Cl SPM LPC Cer Chol CE diac. alk. diac. pl. Balogh, et al. BB A : 1036 Proposed involvement of phospholipases 28

30 Evolution of fever and heat stress signalling Kluger et al. (1975) Hasday and Singh (2000) Hypothesis: HS sensor(s) evolved in parallel to the fever response in vertebrates Lipid signals (cellular stress response) Diabetes Neurodegenerative diseases Cancer Balogh et al. FEBS Lett (2013) Stress-induced lipid remodelling Microenvironmental changes cell culture conditions nutrition tumors insuline resistance Microenvironmental stress 29

31 Sequence of events during and after 1 h heat shock Balogh et al. FEBS Lett (2013) Stress Heat shock proteins Membranes, lipid droplets Lipid changes upon heat stress in fission yeast S. pombe 1h mild (40 C) heat stress Membrane stabilization Signal, Lipid synthesis,? Membrane stabilization Signal Signal, Lipid Membrane synthesis stabilization LD formation Regulation of protein translation, formation of mrna processing bodies during heat stress in budding yeast (Riezman group & Cowart Hannun) 30

32 DKO TG mutants in S. pombe Lipase activities FA synthase No FA uptake FA-CoA 14 30C_WT PA PE, PC DG DGA1 PLH1 PL TG mol % of membrane lipids C_DKO 4 2 WT DKO TG Specific lipid changes in the DKO TG mutant upon HS Membrane stabilization WT_30 WT_40 DKO_30 DKO_40 ESI-MS mol % of total Stress signalling 10 0 PC PE PI PS LPE pcer DG TG Dramatic increases in signal lipids at mol. spec. level 10 3 WT_30 WT_40 DKO_30 DKO_40 mol % of total 5 mol % of total 0 0 DG(34:1) DG(36:2) DG(36:1) pcer(38:1:2) pcer(38:0:2) pcer(38:0:3) pcer(44:0:3) pcer(44:0:4) Are they toxic? 31

33 DKO cells show cell cycle arrest due to mild HS WT 30 C 40 C DKO 30 C 40 C HS: 40 C growth: 1 day 30 C Are they dead? WT 30 C 40 C DKO 30 C 40 C growth: 4 day 30 C NO, only cell cycle arrest The engagement of lipid signals in survival or death is highly context-specific Protein denaturation Folded state Heat Unfolded state Attack against hydrophobic surfaces Putative role of lipid droplets in stress management WT 30 C HS: 50 C 50 C DKO 30 C (no TG) 50 C TG TG holdase function 32

34 Modern view of biological membranes The complex world of lipids Lipid metabolism The origin of lipid diversity The function of microdomains Lipids in Calcium regulation Lipids in apoptosis Lipids as endogenous receptor agonists Lipids in inflammation Lipidomics: How to quantify several hundreds of lipid species in a couple of minutes? Stress lipidomics Neurolipidomics & imaging MS 1. Lipid biomarkers of cancer: imaging MS 2. & intelligent knife Lipid biomarkers of diabetes Membrane lipid therapy New directions: towards single cell lipidomics Neurolipidomics Neurolipidomics: lipid specificity in brain cerebellum pref.cortex striatum hippocampus 33

35 Neurolipidomics: lipid specificity in brain: imaging mass spectrometry Colsch et al., 2011 Modern view of biological membranes The complex world of lipids Lipid metabolism The origin of lipid diversity The function of microdomains Lipids in Calcium regulation Lipids in apoptosis Lipids as endogenous receptor agonists Lipids in inflammation Lipidomics: How to quantify several hundreds of lipid species in a couple of minutes? Stress lipidomics Neurolipidomics & imaging MS 1. Lipid biomarkers of cancer: imaging MS 2. & intelligent knife Lipid biomarkers of diabetes Membrane lipid therapy New directions: towards single cell lipidomics Desorption electrospray ionization mass spectrometric imaging (colon carcinoma sample) Red m/z (PI 36:2) Blue (PI 38:4) Red (PE 36:2) Green ; Fatty acid dimer (40:6) Blue (Triacylglycerol fragment) Green (PS 36:1); Blue (PI 36:2) Zoltán Takáts 34

36 Lipidomics triumphant - Intelligent knife Zoltán Takáts Modern view of biological membranes The complex world of lipids Lipid metabolism The origin of lipid diversity The function of microdomains Lipids in Calcium regulation Lipids in apoptosis Lipids as endogenous receptor agonists Lipids in inflammation Lipidomics: How to quantify several hundreds of lipid species in a couple of minutes? Stress lipidomics Neurolipidomics & imaging MS 1. Lipid biomarkers of cancer: imaging MS 2. & intelligent knife Lipid biomarkers of diabetes Membrane lipid therapy New directions: towards single cell lipidomics Plasma biomarkers of obesity related diseases 200 lipid species 35

37 Prediction of obesity PLS-DA obesity plasmamarkers 30 samples learning 10 unknown sample: prediction Neuronal network Multilayer perceptron Modern view of biological membranes The complex world of lipids Lipid metabolism The origin of lipid diversity The function of microdomains Lipids in Calcium regulation Lipids in apoptosis Lipids as endogenous receptor agonists Lipids in inflammation Lipidomics: How to quantify several hundreds of lipid species in a couple of minutes? Stress lipidomics Neurolipidomics & imaging MS 1. Lipid biomarkers of cancer: imaging MS 2. & intelligent knife Lipid biomarkers of diabetes Membrane lipid therapy New directions: towards single cell lipidomics Allo-network-type drugs: membrane lipid therapy Vigh et al TIBS (2007). Balogh et al. FEBS Lett (2013) Escribá, Busquets, Inokuchi, Balogh, Török, Horváth, Harwood, Vígh. Prog Lipid Res (2015) 36

38 An example for membrane lipid therapy Modulation of lipid metabolism by a specific fatty acid treatment Anticancer therapy by radiosensitisation Lipidomic Analysis Reveals a Radiosensitizing Role of Gamma-Linolenic Acid in Glioma Cells Antal O, Péter M, Hackler L Jr, Mán I, Szebeni G, Ayaydin F, Hideghéty K, Vigh L, Kitajka K, Balogh G, Puskás L.BBA Molecular and Cell Biology of Lipids (2015) GLA supplementation reshapes the whole lipidome Distinct patterns of lipid molecular species for the non-treated and GLA-supplemented cells 37

39 Membrane modulation by GLA and/or radiation stress - HSP expression The susceptibility to oxidative stress overrides the protection by HSP expression Lipids Life Death Lipidomics Laboratory László Vígh Ibolya Horváth Mária Péter Zsolt Török Imre Gombos Begüm Peksel László Vígh Jr. Attila Glatz Lajos Németh Mónika Homolya Péter Gudmann Tim Crul Noémi Tóth Bálint Csoboz Burcin Güngör Ákos Hunya Ana-Maria Pilbat Erika Zukic Istvánné Bogdán Laboratory of Molecular Stress Biology 38

40 lipidlibrary.aocs.org CYBERLIPID CENTER lipidbank.jp

LABORATÓRIUMI GYAKORLAT SILLABUSZ SYLLABUS OF A PRACTICAL DEMONSTRATION. financed by the program

LABORATÓRIUMI GYAKORLAT SILLABUSZ SYLLABUS OF A PRACTICAL DEMONSTRATION. financed by the program TÁMOP-4.1.1.C-13/1/KONV-2014-0001 projekt Az élettudományi-klinikai felsőoktatás gyakorlatorientált és hallgatóbarát korszerűsítése a vidéki képzőhelyek nemzetközi versenyképességének erősítésére program

More information

LABORATÓRIUMI GYAKORLAT SILLABUSZ SYLLABUS OF A PRACTICAL DEMOSTRATION. financed by the program

LABORATÓRIUMI GYAKORLAT SILLABUSZ SYLLABUS OF A PRACTICAL DEMOSTRATION. financed by the program TÁMOP-4.1.1.C-13/1/KONV-2014-0001 projekt Az élettudományi-klinikai felsőoktatás gyakorlatorientált és hallgatóbarát korszerűsítése a vidéki képzőhelyek nemzetközi versenyképességének erősítésére program

More information

ELŐADÁS KIVONAT CLASSROOM LECTURE HANDOUT. financed by the program

ELŐADÁS KIVONAT CLASSROOM LECTURE HANDOUT. financed by the program TÁMOP-4.1.1.C-13/1/KONV-2014-0001 projekt Az élettudományi-klinikai felsőoktatás gyakorlatorientált és hallgatóbarát korszerűsítése a vidéki képzőhelyek nemzetközi versenyképességének erősítésére program

More information

Mass-Spectrometric Analysis of Lipids (Lipidomics)

Mass-Spectrometric Analysis of Lipids (Lipidomics) Mass-Spectrometric Analysis of Lipids (Lipidomics) 1. Identification 2. Quantification 3. Metabolism Why to do lipidomics? Biology: Functions of different lipids? Medicine: Diagnostics and Therapy Industry:

More information

The use of mass spectrometry in lipidomics. Outlines

The use of mass spectrometry in lipidomics. Outlines The use of mass spectrometry in lipidomics Jeevan Prasain jprasain@uab.edu 6-2612 utlines Brief introduction to lipidomics Analytical methodology: MS/MS structure elucidation of phospholipids Phospholipid

More information

Mass Spectrometry based metabolomics

Mass Spectrometry based metabolomics Mass Spectrometry based metabolomics Metabolomics- A realm of small molecules (

More information

Master class Biomolecular Sciences Molecular Cell Biology.

Master class Biomolecular Sciences Molecular Cell Biology. Master class Biomolecular Sciences Molecular Cell Biology. 04-09-08: Paul van Bergen en Henegouwen. Clathrin-indep Endocytosis 11-09-08: Willem Stoorvogel. Endocytosis and MHC classii 18-09-08: X-track

More information

MEMBRANE LIPIDS I and II: GLYCEROPHOSPHOLIPIDS AND SPHINGOLIPIDS

MEMBRANE LIPIDS I and II: GLYCEROPHOSPHOLIPIDS AND SPHINGOLIPIDS December 6, 2011 Lecturer: Eileen M. Lafer MEMBRANE LIPIDS I and II: GLYCEROPHOSPHOLIPIDS AND SPHINGOLIPIDS Reading: Stryer Edition 6: Chapter 26 Images: All images in these notes were taken from Lehninger,

More information

Phospholipids Metabolism

Phospholipids Metabolism Chapter VI: Phospholipids Metabolism Dr. Sameh Sarray Hlaoui Phospholipids Features: Amphipatic: - Hydrophobic head: fatty acids - Hydropholic head: P group+ alcohol Composed of alcohol attached by a phosphodiester

More information

By: Dr Hadi Mozafari 1

By: Dr Hadi Mozafari 1 Biological lipids are a chemically diverse group of compounds, the common and defining feature of which is their insolubility in water. By: Dr Hadi Mozafari 1 Fats and oils are the principal stored forms

More information

LC/MS Method for Comprehensive Analysis of Plasma Lipids

LC/MS Method for Comprehensive Analysis of Plasma Lipids Application Note omics LC/MS Method for Comprehensive Analysis of Plasma s Authors Tomas Cajka and Oliver Fiehn West Coast Metabolomics Center, University of California Davis, 451 Health Sciences Drive,

More information

CHAPTER 28 LIPIDS SOLUTIONS TO REVIEW QUESTIONS

CHAPTER 28 LIPIDS SOLUTIONS TO REVIEW QUESTIONS 28 09/16/2013 17:44:40 Page 415 APTER 28 LIPIDS SLUTINS T REVIEW QUESTINS 1. The lipids, which are dissimilar substances, are arbitrarily classified as a group on the basis of their solubility in fat solvents

More information

CHAPTER 28 LIPIDS SOLUTIONS TO REVIEW QUESTIONS

CHAPTER 28 LIPIDS SOLUTIONS TO REVIEW QUESTIONS HAPTER 28 LIPIDS SLUTINS T REVIEW QUESTINS 1. The lipids, which are dissimilar substances, are arbitrarily classified as a group on the basis of their solubility in fat solvents and their insolubility

More information

Definition: Water insoluble No common structure (though generally large R groups)

Definition: Water insoluble No common structure (though generally large R groups) Lipids Definition Definition: Water insoluble No common structure (though generally large R groups) Water Solubility (Hydrophilic) What makes molecules water soluble (hydrophilic)? Like dissolves like

More information

Biological role of lipids

Biological role of lipids Lipids Lipids Organic compounds present in living organisms, insoluble in water but able to be extracted by organic solvents such as: chloroform, acetone, benzene. Extraction = the action of taking out

More information

Classification, functions and structure

Classification, functions and structure Classification, functions and structure Elena Rivneac PhD, Associate Professor Department of Biochemistry and Clinical Biochemistry State University of Medicine and Pharmacy "Nicolae Testemitanu" Lipids

More information

PHOSPHOLIPIDS METABOLISM. BY Dr. Walid Said Zaki Dr. Marwa Ali LECTURER OF BIOCHEMISTRY AND MOLECULAR BIOLOGY

PHOSPHOLIPIDS METABOLISM. BY Dr. Walid Said Zaki Dr. Marwa Ali LECTURER OF BIOCHEMISTRY AND MOLECULAR BIOLOGY PHOSPHOLIPIDS METABOLISM BY Dr. Walid Said Zaki Dr. Marwa Ali LECTURER OF BIOCHEMISTRY AND MOLECULAR BIOLOGY 1. State the definition and classification of Phospholipids. 2. Describe the general structure

More information

Chem 431A-L24-F 07 admin: Last time: We finished Chapt 7, started Chapt 10 FA s and TG s FA=fatty acid, TG=triglycerides or triacylglycerols

Chem 431A-L24-F 07 admin: Last time: We finished Chapt 7, started Chapt 10 FA s and TG s FA=fatty acid, TG=triglycerides or triacylglycerols Chem 431A-L24-F'07 page 1 of 5 Chem 431A-L24-F 07 admin: Last time: We finished Chapt 7, started Chapt 10 FA s and TG s FA=fatty acid, TG=triglycerides or triacylglycerols (0) REVIEW: FA s are very reduced

More information

Lipids Analysis. Lipids

Lipids Analysis. Lipids Lipids Analysis Stephen Barnes 3 5 15 Lipids Lipids are mostly very hydrophobic Most are conjugates of fatty acids of a variety of chain lengths, which have different degrees of unsaturation, cis trans

More information

ELŐADÁS KIVONAT CLASSROOM LECTURE HANDOUT. financed by the program

ELŐADÁS KIVONAT CLASSROOM LECTURE HANDOUT. financed by the program TÁMOP-4.1.1.C-13/1/KONV-2014-0001 projekt Az élettudományi-klinikai felsőoktatás gyakorlatorientált és hallgatóbarát korszerűsítése a vidéki képzőhelyek nemzetközi versenyképességének erősítésére program

More information

MASS SPECTROMETRY STRATEGIES FOR COMPREHENSIVE LIPIDOME ANALYSIS OF COLORECTAL CANCER CELLS AND THEIR SECRETED EXOSOMES. Cassie J.

MASS SPECTROMETRY STRATEGIES FOR COMPREHENSIVE LIPIDOME ANALYSIS OF COLORECTAL CANCER CELLS AND THEIR SECRETED EXOSOMES. Cassie J. MASS SPECTROMETRY STRATEGIES FOR COMPREHENSIVE LIPIDOME ANALYSIS OF COLORECTAL CANCER CELLS AND THEIR SECRETED EXOSOMES By Cassie J. Fhaner A DISSERTATION Submitted to Michigan State University in partial

More information

OBJECTIVE. Lipids are largely hydrocarbon derivatives and thus represent

OBJECTIVE. Lipids are largely hydrocarbon derivatives and thus represent Paper 4. Biomolecules and their interactions Module 20: Saturated and unsaturated fatty acids, Nomenclature of fatty acids and Essential and non-essential fatty acids OBJECTIVE The main aim of this module

More information

Principles of Shotgun Lipidomics

Principles of Shotgun Lipidomics Principles of Shotgun Lipidomics Xianlin Han Diabetes and Obesity Research Center Sanford-Burnham Medical Research Institute Lake Nona Orlando, FL 32827 What is shotgun lipidomics? Original definition

More information

Nafith Abu Tarboush DDS, MSc, PhD

Nafith Abu Tarboush DDS, MSc, PhD Nafith Abu Tarboush DDS, MSc, PhD natarboush@ju.edu.jo www.facebook.com/natarboush Lipids (cholesterol, cholesterol esters, phospholipids & triacylglycerols) combined with proteins (apolipoprotein) in

More information

MEMBRANE STRUCTURE. Lecture 8. Biology Department Concordia University. Dr. S. Azam BIOL 266/

MEMBRANE STRUCTURE. Lecture 8. Biology Department Concordia University. Dr. S. Azam BIOL 266/ 1 MEMBRANE STRUCTURE Lecture 8 BIOL 266/4 2014-15 Dr. S. Azam Biology Department Concordia University Plasma Membrane 2 Plasma membrane: The outer boundary of the cell that separates it from the world

More information

Lipids and Membranes

Lipids and Membranes Lipids and Membranes Presented by Dr. Mohammad Saadeh The requirements for the Pharmaceutical Biochemistry I Philadelphia University Faculty of pharmacy Lipids and Membranes I. overview Lipids are related

More information

Lipids Definition. Definition: Water insoluble No common structure (though generally large R groups)

Lipids Definition. Definition: Water insoluble No common structure (though generally large R groups) Lipids Definition Definition: Water insoluble No common structure (though generally large R groups) Water Solubility (Hydrophilic) What makes molecules water soluble (hydrophilic)? Like dissolves like

More information

ANSC (NUTR) 618 LIPIDS & LIPID METABOLISM Membrane Lipids and Sphingolipidsd

ANSC (NUTR) 618 LIPIDS & LIPID METABOLISM Membrane Lipids and Sphingolipidsd ANSC (NUTR) 618 LIPIDS & LIPID METABOLISM Membrane Lipids and Sphingolipidsd I. Classes of membrane lipids A. Glycerolipids (quantitatively the most important of the three membrane lipids) B. Shingolipids

More information

Chapter 8. Functions of Lipids. Structural Nature of Lipids. BCH 4053 Spring 2001 Chapter 8 Lecture Notes. Slide 1. Slide 2.

Chapter 8. Functions of Lipids. Structural Nature of Lipids. BCH 4053 Spring 2001 Chapter 8 Lecture Notes. Slide 1. Slide 2. BCH 4053 Spring 2001 Chapter 8 Lecture Notes 1 Chapter 8 Lipids 2 Functions of Lipids Energy Storage Thermal Insulation Structural Components of Membranes Protective Coatings of Plants and Insects Hormonal

More information

Contents 1 Metabolism and Roles of Eicosanoids in Brain

Contents 1 Metabolism and Roles of Eicosanoids in Brain Contents 1 Metabolism and Roles of Eicosanoids in Brain... 1 1.1 Introduction... 1 1.2 Multiplicity of Cyclooxygenases, Lipoxygenases, and Epoxygenases in the Brain... 4 1.2.1 Cyclooxygenases (COXs)...

More information

Regulation of Lipid Homeostasis: Lipid Droplets

Regulation of Lipid Homeostasis: Lipid Droplets Regulation of Lipid Homeostasis: Lipid Droplets Bernd Helms Article Brand Recter Hendrik Mertens 1 The Basics I: FAs The Basics II: FA Activation 2 Basics III: TG-FA Interplay. Why? Adipocytes 3 Foam cells

More information

Lipids and Classification:

Lipids and Classification: Lipids and Classification: Lipids: Biological lipids are a chemically diverse group of organic compounds which are insoluble or only poorly soluble in water. They are readily soluble in non-polar solvents

More information

SelexION Technology for Lipid Analysis: Pushing the Boundaries of Lipidomics

SelexION Technology for Lipid Analysis: Pushing the Boundaries of Lipidomics ANSWERS FOR SCIENCE. KNOWLEDGE FOR LIFE. SelexION Technology for Lipid Analysis: Pushing the Boundaries of Lipidomics Baljit Ubhi, Ph.D ASMS Baltimore, June 2014 Lipidomics Profiling Needs and Deliverables

More information

GUTS Lecture Syllabus for Lipid Structure and Nomenclature

GUTS Lecture Syllabus for Lipid Structure and Nomenclature GUTS Lecture Syllabus for Lipid Structure and Nomenclature For Questions or Assistance contact: Dr. Gwen Sancar, gsancar@ad.unc.edu Learning bjectives After completing the GUTS lecture and associated self-

More information

Metabolomic fingerprinting of serum samples by direct infusion mass spectrometry

Metabolomic fingerprinting of serum samples by direct infusion mass spectrometry Metabolomic fingerprinting of serum samples by direct infusion mass spectrometry Raúl González-Domínguez * Department of Chemistry, Faculty of Experimental Sciences. University of Huelva, Spain. * Corresponding

More information

7/11/17. Cell Function & Chemistry. Molecular and Cellular Biology. 2. Bio-Chemical Foundations & Key Molecules of a Cell

7/11/17. Cell Function & Chemistry. Molecular and Cellular Biology. 2. Bio-Chemical Foundations & Key Molecules of a Cell Molecular and Cellular Biology Cell Function & Chemistry 2. Bio-Chemical Foundations & Key Molecules of a Cell Prof. Dr. Klaus Heese Interaction Molecular Bonds Define Cellular Functions Water H 2 O Interactions

More information

Chapter 26 Biochemistry 5th edition. phospholipids. Sphingolipids. Cholesterol. db=books&itool=toolbar

Chapter 26 Biochemistry 5th edition. phospholipids. Sphingolipids. Cholesterol.   db=books&itool=toolbar http://www.ncbi.nlm.nih.gov/sites/entrez? db=books&itool=toolbar 1 The surface of a soap bubble is a bilayer formed by detergent molecules 2 Chapter 26 Biochemistry 5th edition phospholipids Sphingolipids

More information

Molecular Organization of the Cell Membrane

Molecular Organization of the Cell Membrane Molecular Organization of the Cell Membrane A walk from molecules to a functional biostructure Cell Membrane Definition An ultrastructure separating connecting the cell to the environment 1 Coarse chemical

More information

Chapter 20 Lipids. Organic and Biochem

Chapter 20 Lipids. Organic and Biochem Chapter 20 Lipids rganic and Biochem 20.1 Introduction Found in living organisms Insoluble in water but Soluble in non-polar substances Example of Lipid Solvent: diethyl ether Polar groups in lipids are

More information

Lipids. Lipids. Jiří Jonák and Lenka Fialová Institute of Medical Biochemistry, 1st Medical Faculty of the Charles University, Prague

Lipids. Lipids. Jiří Jonák and Lenka Fialová Institute of Medical Biochemistry, 1st Medical Faculty of the Charles University, Prague Lipids Jiří Jonák and Lenka Fialová Institute of Medical Biochemistry, 1st Medical Faculty of the Charles University, Prague Lipids 1. General introduction 2. Nomenclature of fatty acids 3. Degradation

More information

Ahmad O. Olimat. Abdallah Al-Qawasmeh. Dr.Mamoun

Ahmad O. Olimat. Abdallah Al-Qawasmeh. Dr.Mamoun 10 Ahmad O. Olimat Abdallah Al-Qawasmeh Mohammed Yousef Dr.Mamoun A QUICK RECAP Eicosanoids They are derived from Arachidonic acid, a fatty acid that contains 20 carbon atoms and four double bonds. They

More information

LIPIDS Introduction - complex lipids. Marek Vecka

LIPIDS Introduction - complex lipids. Marek Vecka LIPIDS Introduction - complex lipids Marek Vecka CLASSIFICATION OF LIPIDS IV - biosynthetic route Lipid class Fatty acyls Glycerolipids Glycerophospholipids Sphingolipids Sterol lipids Prenol lipids Other

More information

Overview on the identification of different classes of. lipids by HPTLC (High Performance Thin Layer. Chromatography) and ITLC (Immuno Thin Layer

Overview on the identification of different classes of. lipids by HPTLC (High Performance Thin Layer. Chromatography) and ITLC (Immuno Thin Layer Overview on the identification of different classes of lipids by HPTLC (High Performance Thin Layer Chromatography) and ITLC (Immuno Thin Layer Chromatography) Iuliana Popa 1, Marie-Jeanne David 2, Daniel

More information

Lipids. Lipids: a Diverse group of chemicals. Storage Lipids: derivatives of fatty acids. 11/21/10

Lipids. Lipids: a Diverse group of chemicals. Storage Lipids: derivatives of fatty acids. 11/21/10 1 Lipids Lehninger 3 rd ed. Chapter 11 (For biosynthesis see Chapter 21) 2 Lipids: a Diverse group of chemicals Insolubility in water. Fats and oils: energy stores. Phospholipids and sterols: structural

More information

Lipid Analysis ISOLATION, SEPARATION, IDENTIFICATION AND. Bridgwater, England LIPIDOMIC ANALYSIS. Fourth Edition. Invergowrie, Dundee, Scotland

Lipid Analysis ISOLATION, SEPARATION, IDENTIFICATION AND. Bridgwater, England LIPIDOMIC ANALYSIS. Fourth Edition. Invergowrie, Dundee, Scotland Lipid Analysis ISOLATION, SEPARATION, IDENTIFICATION AND LIPIDOMIC ANALYSIS Fourth Edition WILLIAM W.CHRISTIE MRS Lipid Analysis Unit, Scottish Crop Research Institute, Dundee, Scotland Invergowrie, and

More information

TEST BANK FOR LEHNINGER PRINCIPLES OF BIOCHEMISTRY 6TH EDITION BY NELSON

TEST BANK FOR LEHNINGER PRINCIPLES OF BIOCHEMISTRY 6TH EDITION BY NELSON Link full download: https://testbankservice.com/download/testbank-for-lehninger-principles-of-biochemistry-6th-edition-bynelson TEST BANK FOR LEHNINGER PRINCIPLES OF BIOCHEMISTRY 6TH EDITION BY NELSON

More information

The main biological functions of the many varied types of lipids include: energy storage protection insulation regulation of physiological processes

The main biological functions of the many varied types of lipids include: energy storage protection insulation regulation of physiological processes Big Idea In the biological sciences, a dehydration synthesis (condensation reaction) is typically defined as a chemical reaction that involves the loss of water from the reacting molecules. This reaction

More information

Dr. Nafith Abu Tarboush

Dr. Nafith Abu Tarboush 4 Dr. Nafith Abu Tarboush June 24 th 2013 Ahmad Moayd 1 Definition and general properties refer to slide no. 2 Lipids: macromolecules made from Alcohol and Fatty acid bonded by ester linkage. Amphipathic

More information

Test Bank for Lehninger Principles of Biochemistry 5th Edition by Nelson

Test Bank for Lehninger Principles of Biochemistry 5th Edition by Nelson Test Bank for Lehninger Principles of Biochemistry 5th Edition by Nelson Link download full: http://testbankair.com/download/test-bank-forlehninger-principles-of-biochemistry-5th-edition-by-nelson/ Chapter

More information

Lipid Class Separation Using UPC 2 /MS

Lipid Class Separation Using UPC 2 /MS Michael D. Jones, 1,3 Giorgis Isaac, 1 Giuseppe Astarita, 1 Andrew Aubin, 1 John Shockcor, 1 Vladimir Shulaev, 2 Cristina Legido-Quigley, 3 and Norman Smith 3 1 Waters Corporation, Milford, MA, USA 2 Department

More information

Supporting information

Supporting information Supporting information A novel lipidomics workflow for improved human plasma identification and quantification using RPLC-MSn methods and isotope dilution strategies Evelyn Rampler 1,2,3, Angela Criscuolo

More information

Lipids and Membranes

Lipids and Membranes Lipids Lipids are hydrophobic or amphiphilic insoluble in water soluble in organic solvents soluble in lipids Lipids are used as energy storage molecules structural components of membranes protective molecules

More information

General Biochemistry-1 BCH 202

General Biochemistry-1 BCH 202 General Biochemistry-1 BCH 202 1 I would like to acknowledge Dr. Farid Ataya for his valuable input & help in this course. 2 Outline Lipids Definition, function, fatty acids, classification: simple lipids:

More information

TBI in the elderly. Andras Buki M.D., Ph.D.,D.Sc. Department of Neurosurgery, Medical Faculty of Pecs University, Pecs, Hungary, H-7624

TBI in the elderly. Andras Buki M.D., Ph.D.,D.Sc. Department of Neurosurgery, Medical Faculty of Pecs University, Pecs, Hungary, H-7624 TBI in the elderly Andras Buki M.D., Ph.D.,D.Sc. Department of Neurosurgery, Medical Faculty of Pecs University, Pecs, Hungary, H-7624 AZ ÉLETTUDOMÁNYI- KLINIKAI FELSŐOKTATÁS GYAKORLATORIENTÁLT ÉS HALLGATÓBARÁT

More information

Poly-unsaturated phospholipids WE (FA18:1) A B C D OAHFA 18:1/24:0 OAHFA 18:1/30:2 PS 38:4 C18:1C23:0 OAHFA 18:1/25:0 OAHFA 18:1/30:1

Poly-unsaturated phospholipids WE (FA18:1) A B C D OAHFA 18:1/24:0 OAHFA 18:1/30:2 PS 38:4 C18:1C23:0 OAHFA 18:1/25:0 OAHFA 18:1/30:1 Figure S1, related to Figure 1. Correlation scatter plots illustrating individual lipid species from various classes that exhibited statistically significant correlations to age. (A-B) Various species

More information

Impact of Chromatography on Lipid Profiling of Liver Tissue Extracts

Impact of Chromatography on Lipid Profiling of Liver Tissue Extracts Impact of Chromatography on Lipid Profiling of Liver Tissue Extracts Application Note Clinical Research Authors Mark Sartain and Theodore Sana Agilent Technologies, Inc. Santa Clara, California, USA Introduction

More information

: Overview of EFA metabolism

: Overview of EFA metabolism Figure 1 gives an overview of the metabolic fate of the EFAs when consumed in the diet. The n-6 and n-3 PUFAs when consumed in the form of dietary triglyceride from various food sources undergoes digestion

More information

Lecture 3 6/28/10. Membrane Lipids. Importance of Membranes. Categories of Lipids. Lipids: Chapter 20 Sections 4-7. ! Membranes are important in

Lecture 3 6/28/10. Membrane Lipids. Importance of Membranes. Categories of Lipids. Lipids: Chapter 20 Sections 4-7. ! Membranes are important in Lecture 3 Lipids: Chapter 20 Sections 4-7! The most polar lipids are found in the membranes of cells and organelles! Why?! These lipids are amphipathic! Membranes are complex and have many components Membrane

More information

CHM333 LECTURE 34: 11/30 12/2/09 FALL 2009 Professor Christine Hrycyna

CHM333 LECTURE 34: 11/30 12/2/09 FALL 2009 Professor Christine Hrycyna Lipid Metabolism β-oxidation FA Acetyl-CoA Triacylglycerols (TAGs) and glycogen are the two major forms of stored energy in vertebrates Glycogen can supply ATP for muscle contraction for less than an hour

More information

Chem Lecture 8 Lipids and Cell Membranes

Chem Lecture 8 Lipids and Cell Membranes Chem 452 - Lecture 8 Lipids and Cell Membranes 111114 Like carbohydrates, lipids are one of the four major classes of biomolecules, which also include the proteins, carbohydrates and nucleic acids. Lipids

More information

Chapter 11: Lipids. Voet & Voet: Pages

Chapter 11: Lipids. Voet & Voet: Pages Chapter 11: Lipids Voet & Voet: Pages 380-394 Slide 1 Lipids Lipids are distinguished by their high solubility in non polar solvents and low solubility in H2O Diverse group of compounds including Fats,

More information

Comprehensive Lipid Profiling of Human Liver Tissue Extracts of Non-Alcoholic Fatty Liver Disease

Comprehensive Lipid Profiling of Human Liver Tissue Extracts of Non-Alcoholic Fatty Liver Disease Comprehensive Lipid Profiling of Human Liver Tissue Extracts of Non-Alcoholic Fatty Liver Disease Multiplexed Precursor Ion Scanning and LipidView Software Brigitte Simons 1 and Bianca Arendt 2 1 AB SCIEX,

More information

Analysis of Lipid Metabolites. = Lipidomics

Analysis of Lipid Metabolites. = Lipidomics Analysis of Lipid Metabolites = Lipidomics Pentti Somerharju Transmed 11.10.2012 utline of the talk What is Lipidomics? Where is lipidomics needed? Lipid classes and their functions Why mass-spectrometric

More information

Suppl. Table 1: CV of pooled lipoprotein fractions analysed by ESI-MS/MS

Suppl. Table 1: CV of pooled lipoprotein fractions analysed by ESI-MS/MS Supplement VLDL LDL HDL PC 3.3 1.77 1.3 LPC 4.82 2.5.35 SM 3.1 4.6 1.92 CER 2.17 6.3 4.15 PE 3.18 1.93 2.79 PE-pl 13.18 1.9 2.32 CE 2.9.65.4 FC.36 3.5 2.54 Suppl. Table 1: CV of pooled lipoprotein fractions

More information

Fats and Lipids (Ans570)

Fats and Lipids (Ans570) Fats and Lipids (Ans570) Outlines Fats and Lipids Structure, nomenclature Phospholipids, Sterols, and Lipid Derivatives Lipid Oxidation Roles of fat in food processing and dietary fat Lipid and fat analysis:

More information

Physiology Unit 1 CELL SIGNALING: CHEMICAL MESSENGERS AND SIGNAL TRANSDUCTION PATHWAYS

Physiology Unit 1 CELL SIGNALING: CHEMICAL MESSENGERS AND SIGNAL TRANSDUCTION PATHWAYS Physiology Unit 1 CELL SIGNALING: CHEMICAL MESSENGERS AND SIGNAL TRANSDUCTION PATHWAYS In Physiology Today Cell Communication Homeostatic mechanisms maintain a normal balance of the body s internal environment

More information

Lipid Chemistry. Presented By. Ayman Elsamanoudy Salwa Abo El-khair

Lipid Chemistry. Presented By. Ayman Elsamanoudy Salwa Abo El-khair Lipid Chemistry Presented By Ayman Elsamanoudy Salwa Abo El-khair 4 Objectives: 1. By the end of this chapter the student should be able to: define lipids. describe the biological importance of lipids.

More information

BIOB111_CHBIO - Tutorial activity for Session 12

BIOB111_CHBIO - Tutorial activity for Session 12 BIOB111_CHBIO - Tutorial activity for Session 12 General topic for week 6 Session 12 Lipids Useful Links: 1. Animations on Cholesterol (its synthesis, lifestyle factors, LDL) http://www.wiley.com/college/boyer/0470003790/animations/cholesterol/cholesterol.htm

More information

2013 W. H. Freeman and Company. 10 Lipids

2013 W. H. Freeman and Company. 10 Lipids 2013 W. H. Freeman and Company 10 Lipids CHAPTER 10 Lipids Key topics: Biological roles of lipids Structure and properties of storage lipids Structure and properties of membrane lipids Structure and properties

More information

I. Structure and Properties of Lipids

I. Structure and Properties of Lipids I. Structure and Properties of Lipids Lipids: A diverse group of compounds characterized by their low solubility in water and a high solubility in organic solvents such as chloroform and methanol. Nonpolar

More information

Lipids. Polar bears have a large reserve of lipids.

Lipids. Polar bears have a large reserve of lipids. Chapter 28 Lipids Polar bears have a large reserve of lipids. Introduction to General, Organic, and Biochemistry, 10e John Wiley & Sons, Inc Morris Hein, Scott Pattison, and Susan Arena Course 28.1 Lipids:

More information

Metabolomics and systems biology approaches to study health and disease. Matej Oreši

Metabolomics and systems biology approaches to study health and disease. Matej Oreši Metabolomics and systems biology approaches to study health and disease Matej Oreši 14.12.2011 1/19/2012 2 Biomarker concept in domain of human health [Wikipedia definition] A substance used as an indicator

More information

BBSG 501 Section 4 Metabolic Fuels, Energy and Order Fall 2003 Semester

BBSG 501 Section 4 Metabolic Fuels, Energy and Order Fall 2003 Semester BBSG 501 Section 4 Metabolic Fuels, Energy and Order Fall 2003 Semester Section Director: Dave Ford, Ph.D. Office: MS 141: ext. 8129: e-mail: fordda@slu.edu Lecturers: Michael Moxley, Ph.D. Office: MS

More information

3.1.3 Lipids. Source: AQA Spec

3.1.3 Lipids. Source: AQA Spec alevelbiology.co.uk SPECIFICATION Triglycerides and phospholipids are two groups of lipid. Triglycerides are formed by the condensation of one molecule of glycerol and three molecules of fatty acid. A

More information

BCM 221 LECTURES OJEMEKELE O.

BCM 221 LECTURES OJEMEKELE O. BCM 221 LECTURES BY OJEMEKELE O. OUTLINE INTRODUCTION TO LIPID CHEMISTRY STORAGE OF ENERGY IN ADIPOCYTES MOBILIZATION OF ENERGY STORES IN ADIPOCYTES KETONE BODIES AND KETOSIS PYRUVATE DEHYDROGENASE COMPLEX

More information

Supplemental Information for: Localization of anionic phospholipids in Escherichia coli cells

Supplemental Information for: Localization of anionic phospholipids in Escherichia coli cells Supplemental Information for: Localization of anionic phospholipids in Escherichia coli cells Piercen M. Oliver, a John A. Crooks, a Mathias Leidl, b Earl J. Yoon, a Alan Saghatelian, b and Douglas B.

More information

Dr. Mamoun. Loai Azar

Dr. Mamoun. Loai Azar 13 Dr. Mamoun Loai Azar Lipids (2) - To get the best of this sheet PLEASE study it side by side with the doctor s slides. - In this lecture the doctor continued talking about Eicosanoids. Derived Fatty

More information

Lipids, Biological Membranes and Cellular Transport. 阮雪芬 May/9/2004

Lipids, Biological Membranes and Cellular Transport. 阮雪芬 May/9/2004 Lipids, Biological Membranes and Cellular Transport 阮雪芬 May/9/2004 Outline Introduction Fatty Acids Triacylglycerols Polar lipids Steroids and other lipids Biological membranes Membrane transport Examples

More information

King Saud University College of Science Department of Biochemistry. General Biochemistry-II (BCH 302) Chapter 4. Lipids

King Saud University College of Science Department of Biochemistry. General Biochemistry-II (BCH 302) Chapter 4. Lipids King Saud University College of Science Department of Biochemistry General Biochemistry-II (BCH 302) Chapter 4 Lipids Prepared by Dr. Farid Ataya http://fac.ksu.edu.sa/fataya http://faculty.ksu.edu.sa/75112

More information

Annotation of potential isobaric and isomeric lipid species measured with the AbsoluteIDQ p180 Kit (and p150 Kit)

Annotation of potential isobaric and isomeric lipid species measured with the AbsoluteIDQ p180 Kit (and p150 Kit) We provide the Phenotype to the Genotype! DocNr. 35017 V 2 2017-02 Annotation of potential isobaric and isomeric lipid species measured with the (and p150 Kit) Introduction Lipidomics, a branch of metabolomics

More information

Screening of novel thalidomide analogues with label-free assays and appling in the in vivo model of hepatocellular carcinoma.

Screening of novel thalidomide analogues with label-free assays and appling in the in vivo model of hepatocellular carcinoma. Screening of novel thalidomide analogues with label-free assays and appling in the in vivo model of hepatocellular carcinoma Lajos István Nagy Ph.D thesis summary Supervisor: László Puskás, PhD, DSc Scientific

More information

Thermo Scientific LipidSearch Software for Lipidomics Workflows. Automated Identification and Relative. Quantitation of Lipids by LC/MS

Thermo Scientific LipidSearch Software for Lipidomics Workflows. Automated Identification and Relative. Quantitation of Lipids by LC/MS Thermo Scientific LipidSearch Software for Lipidomics Workflows Automated Identification and Relative of Lipids by LC/MS The promise of lipidomics Lipidomics is a new field of study crucial for understanding

More information

The phosphate group replaces the fatty acid on C number 3 of a triacylglycerol molecule O O CH 2 O C R CH 2 O P O X OH.

The phosphate group replaces the fatty acid on C number 3 of a triacylglycerol molecule O O CH 2 O C R CH 2 O P O X OH. Phosphoacylglycerols (Phospholipids) Phosphoacylglycerols are fatty acid esters of glycerol which also contain a phosphate group and other specific groups The phosphate group replaces the fatty acid on

More information

MCQS ON LIPIDS. Dr. RUCHIKA YADU

MCQS ON LIPIDS. Dr. RUCHIKA YADU MCQS ON LIPIDS Dr. RUCHIKA YADU Q1. THE FATS AND OILS ARE RESPECTIVELY RICH IN a) Unsaturated fatty acids b) Saturated fatty acids c) Saturated and unsaturated fatty acids d) None of these Q2. ESSENTIAL

More information

PHOSPHOLIPID MEMBRANE ABNORMALITIES AND REDUCED NIACIN SKIN FLUSH RESPONSE IN SCHIZOPHRENIA

PHOSPHOLIPID MEMBRANE ABNORMALITIES AND REDUCED NIACIN SKIN FLUSH RESPONSE IN SCHIZOPHRENIA PHOSPHOLIPID MEMBRANE ABNORMALITIES AND REDUCED NIACIN SKIN FLUSH RESPONSE IN SCHIZOPHRENIA Alena Buretić-Tomljanović 1, Jasminka Giacometti 1, Sergej Nadalin 1, Gordana Rubeša 2, Mirjana Vulin 3, Draško

More information

Synthesis and elongation of fatty acids

Synthesis and elongation of fatty acids Synthesis and elongation of fatty acids A molecular caliper mechanism for determining very long-chain fatty acid length Vladimir Denic and Jonathan S. Weissman (2007) Cell 130, 663-677 February 28, 2008

More information

Biology 4410 First Examination Version B

Biology 4410 First Examination Version B Biology 4410 Spring 2006 Name First Examination Version B This examination consists of two parts, a multiple-choice section and an essay section. Be sure to put your name on both the mark-sense sheet and

More information

Relative Quantitation of Human Polymorphonuclear Leukocyte Cell Membrane GPEtn Lipids

Relative Quantitation of Human Polymorphonuclear Leukocyte Cell Membrane GPEtn Lipids Relative Quantitation of Human Polymorphonuclear Leukocyte Cell Membrane GPEtn Lipids Using the QTRAP System with mtraq Reagents Karin A. Zemski-Berry 1, John M. Hevko 2, and Robert C. Murphy 1 1 Department

More information

Organic molecules highly hydrophobic and water insoluble.

Organic molecules highly hydrophobic and water insoluble. UNIT 5. LIPIDS OUTLINE 5.1. Introduction. 5.2. Fatty acids. 5.3. Eicosanoids. 5.4. Triacylglycerols = Triglycerides. 5.5. Waxes. 5.6. Membrane lipids: glycerophospholipids and sphingolipids. 5.7. Isoprenoids

More information

Models of the plasma membrane - from the fluid mosaic to the picket fence model. Mario Schelhaas Institute of Cellular Virology

Models of the plasma membrane - from the fluid mosaic to the picket fence model. Mario Schelhaas Institute of Cellular Virology Models of the plasma membrane - from the fluid mosaic to the picket fence model Mario Schelhaas Institute of Cellular Virology Today s lecture Central Question: How does the plasma membrane fulfil its

More information

2013 W. H. Freeman and Company. 10 Lipids

2013 W. H. Freeman and Company. 10 Lipids 2013 W. H. Freeman and Company 10 Lipids Storage lipids: TG lipid 의기능 : 1 Energy source 3 Electrical insulator 2 Thermal insulator 4 Membrane 의구성성분, 방수, 부력, cofactor, signaling 등 지방대사이상 : obesity, atherosclerosis,

More information

Biomolecules. Biomolecules. Carbohydrates. Biol 219 Lec 3 Fall Polysaccharides. Function: Glucose storage Fig. 2.2

Biomolecules. Biomolecules. Carbohydrates. Biol 219 Lec 3 Fall Polysaccharides. Function: Glucose storage Fig. 2.2 Biomolecules Biomolecules Monomers Polymers Carbohydrates monosaccharides polysaccharides fatty acids triglycerides Proteins amino acids polypeptides Nucleic Acids nucleotides DNA, RNA Carbohydrates Carbohydrates

More information

Hmgcoar AGCTTGCCCGAATTGTATGTG TCTGTTGTAACCATGTGACTTC. Cyp7α GGGATTGCTGTGGTAGTGAGC GGTATGGAATCAACCCGTTGTC

Hmgcoar AGCTTGCCCGAATTGTATGTG TCTGTTGTAACCATGTGACTTC. Cyp7α GGGATTGCTGTGGTAGTGAGC GGTATGGAATCAACCCGTTGTC Supplement Table I: primers for Real Time RT-PCR Gene Foward Reverse Hmgcoar AGCTTGCCCGAATTGTATGTG TCTGTTGTAACCATGTGACTTC Cyp7α GGGATTGCTGTGGTAGTGAGC GGTATGGAATCAACCCGTTGTC Cyp27a1 GTGGTCTTATTGGGTACTTGC

More information

Essential Lipidomics Experiments using the LTQ Orbitrap Hybrid Mass Spectrometer

Essential Lipidomics Experiments using the LTQ Orbitrap Hybrid Mass Spectrometer Application Note: 367 Essential Lipidomics Experiments using the LTQ rbitrap Hybrid Mass Spectrometer Thomas Moehring 1, Michaela Scigelova 2, Christer S. Ejsing 3, Dominik Schwudke 3, Andrej Shevchenko

More information

LIPIDS II: TRIACYLGLYCEROLS:

LIPIDS II: TRIACYLGLYCEROLS: LIPIDS II: TRIACYLGLYCEROLS: How are they broken down? o Hydrolyzed into 3 fatty acids and 1 glycerol o Physiologically in body: Enzyme called a LIPASE present in adipocytes and intestines o Saponification

More information

Microreview. A.-F. Miller, 2008, pg

Microreview. A.-F. Miller, 2008, pg Microreview Polysaccharides: a vast diversity based on stereochemistry. Stereochemical differences are associated with secondary and tertiary structural differences: nature s huge and plentiful polymers.

More information

9/11/18. Cell Function & Chemistry. Molecular and Cellular Biology. 2. Bio-Chemical Foundations & Key Molecules of a Cell

9/11/18. Cell Function & Chemistry. Molecular and Cellular Biology. 2. Bio-Chemical Foundations & Key Molecules of a Cell Molecular and Cellular Biology Cell Function & Chemistry 2. Bio-Chemical Foundations & Key Molecules of a Cell Prof. Dr. Klaus Heese Interaction Molecular Bonds Define Cellular Functions Water H 2 O Interactions

More information

Sphingolipids. Sphingolipids are an additional type of membrane lipids, after glycerophospholipids, galactolipids and sulfolipids

Sphingolipids. Sphingolipids are an additional type of membrane lipids, after glycerophospholipids, galactolipids and sulfolipids Lipids 2 Steven E. Massey, Ph.D. Assistant Professor of Bioinformatics Department of Biology and Environmental Sciences University of Puerto Rico Río Piedras Office & Lab: Bioinformatics Lab NCN#343B Tel:

More information

Fats, Cholesterol, and Hormones

Fats, Cholesterol, and Hormones Fats, Cholesterol, and Hormones 1 Types of Fats Lipids biological origin sparingly soluble in water Main classes of lipids Fatty Acids long hydrocarbon chains with a carboxylic acid on one end Triacylglycerols

More information