MISSION: understanding the mechanisms of therapeutic strategies

Size: px
Start display at page:

Download "MISSION: understanding the mechanisms of therapeutic strategies"

Transcription

1

2 Telethon Institute of Genetics and Medicine MISSION: understanding the mechanisms of genetic diseases to develop preventive and therapeutic strategies

3 G E N O T Y P E

4 G E Researcher N O T Y P E

5 G E Researcher N 1 2 Molecular lar 3 4 Protein 5 O T Y P E 11 analysis function/ dysfunction 10 9 Metabolic8 7 pathway involved 6 Mechanisms of cell damage Tissue/ organ dysfunction

6 Lysosomal Storage Diseases (LSDs) A group of approximately 50 inherited diseases characterized by progressive intracellular storage caused by a defect in the lysosomes, the organelles that are responsible for cellular clearance Frequency as a group: 1: :10.000

7 A normal human cell Golgi apparatus Primary lysosomes Autophagy Secondary lysosomes Phagocytosis Early endosome Endocytosis Late endosome Exocytosis

8 A cell from a patient with a Lysosomal Storage Disease Golgi apparatus Primary lysosomes Autophagy Secondary lysosomes Phagocytosis Early endosome Endocytosis Late endosome Exocytosis

9 LYSOSOMAL STORAGE Lysosomal storage in hepatocytes and macrophages from a patient with Multiple Sulfatase Deficiency

10

11 Mental retardation Haematological abnormalities Facial dysmorphisms Visceromegaly Bone dysplasia Ocular abnormalities

12 Molecules accumulating in LSDs ceramide G m1 ganglioside galactocerebroside Heparan sulfate glucocerebroside sfingomyelin S glycogen Sulfogalactosylceramide (sulfatide)

13 30 years of research on Lysosomal Storage Diseases (LSDs)

14 G E Researcher N 1 2 Molecular lar 3 4 Protein 5 O T Y P E 11 analysis function/ dysfunction 10 9 Metabolic8 7 pathway involved 6 Mechanisms of cell damage Tissue/ organ dysfunction

15 The lysosome: the cell waste basket"

16 THE LYSOSOMES Most cells of our body contain hundreds of lysosomes, the core stations for the degradation and recycling of cellular waste ( cellular incinerators ) Nuclei Lysosomes Incinerator in Vienna

17 THE LYSOSOME The lysosome is made of several elements: Membrane Hydrolases Cellular waste Membrane: it separates the lysosome from the rest of the cell Hydrolases: these are enzymes that degrade specific molecules Protonic pump: the machinery for the acidification of the organelle Transport proteins: they handle the trafficking of material across the lysosomal membrane

18 TRANSPORT OF CELLULAR WASTE TO LYSOSOMES

19 TRANSPORT OF CELLULAR WASTE TO LYSOSOMES Molecules l to be degraded d d and recycled are carried to the lysosomes through different processes Nucleus Lysosomes Endocytosis Autophagy Phagocytosis Endocytosis: molecules coming from other cells Phagocytosis: microorganisms (pathogens) or cellular debris Autophagy: material deriving from cellular metabolism

20 THE LYSOSOMES AND DISEASES Disease Storage material Lysosomal storage diseases Mucopolysaccharidoses mucopolysaccharides Lipidoses lipids Glycogenoses glycogen Lipofuscinoses proteins Neurodegenerative disease Alzheimer β-amyloid, tau Parkinson α-synucleinl i Huntington huntingtin Others Prion disease, parasitic infections,.aging

21 Studying lysosome biology using a genomic approach: LYSOSOMICS Marco Sardiello

22 OUR HYPOTHESIS Is there a genetic program coordinating the activity of lysosomes (i.e. regulating cellular clearance)? Lysosomal enzymes COORDINATION Lysosomal acidification Lysosomal biogenesis i

23 Is there a lysosomal l gene network?

24 Why do A we GENE need NETWORK to look at more than one gene? TRANSCRIPTION FACTOR QuickTime and a TIFF (Uncompressed) decompressor are needed to see this picture.

25 The p63 NETWORK (from Diego Di Bernardo, TIGEM) Co-expression

26 How can we identify gene networks? The Systems Biology approach Conditions i Measure response Co-expression Gene network

27 A MASTER GENE FOR LYSOSOMAL FUNCTION The TFEB gene coordinates lysosomal activity Lysosomal enzymes TFEB Lysosomal acidification Lysosomal biogenesis

28 TFEB: A REMOTE CONTROL TFEB

29 TFEB: A REMOTE CONTROL TFEB

30 Do promoters of lysosomal genes share regulatory elements?

31 Most lysosomal promoters share a E-box type regulatory motif Promoter analysis PWM (position weight matrix) a c g t consensus GGGTCACGTGACCC logo

32 Most lysosomal promoters share a E-box type regulatory motif Promoter analysis Example: LAMP1 TCAGACTTCTAAAATGCAGGAGCCAGGCGCCGTGGCTCAGGGCTGTAATCTCAGCACTTTGGGAGGCCGAGGCGGGTGGATTGCTTGAG GTCAGGAGTTCGAGACCAGCCTGGCCAACTGGTGAAACCCCGTCTCTACTCAACATACAAAATCAGCCGGGCGTGGTGGCGCACGCCTG TAATCCCAGCTACTTGGGAGGCTGAGGCAAGAGAATCGCTTGAACCCGGGAGGCGGAGGTTACAGCGAGCCGAGATCGCGCCACTGCAC TCCAGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAAAAAAAACAAAGTGCTCGACAGGAACTTTCTGTAAGCCAAAGAGTATCGCCA TCGCACCTTCACCTTCACCTTGGGCAGCCTGGTGCCGTCTTCCCTCAGCCCGCGATTAACGAGCGGAAGGCCGCACTGACCCATTTCAG ATCCCTTATTTCCTTCCTAAAACCACTCAAGAGTTTGGGCACAGTGGCCTCCCTGTGTGAGGAACTTGCTTCCCACTCACCAAAAGACA AACCCTTCGCCCATCCCTGGCCGCGCACCCGGCCGGTCACCCGCGCTGCCACCCACACCACCCTCCTGTCCATAAAGAGCCCGCGTTTG GGACGCCTCGCAGGCTGAAGGGAGGCCTGGGCGTCCGCGATCCGTCTGCCCTTTCTCCCCTCGCGGGCTTCCTCTTTCCTCACTTTCTC CCGCCACTACTCTTCCTCTTCCTTTTCCGCGAACCCAGCCCACTTCCCGTTTCAGGACCTCGGCTCGGCCCCAGTCCCCCGGACCAGGC CGGGTCACGTGGGTCCAGGGTCACGTGCCGCTGCGGGTCACGTGCCGCTGCGGGTCACGTGTCGGCCTGCATCACGCGTGAGGGGGCGC GCGGTGCTGGAAGCTGCCGCACCTGCGGGGAGCCGAGCCGCCGGCGCTCGACGCGCGCGCTCTCGCGAGACCCGCGGGATCACGTGACG CCCGGGCGCGGCGCAGCTCAC TSS

33 Most lysosomal promoters share a E-box type regulatory motif 5 UTR 5UTR coding introns flanking genes

34 A gene network regulating lysosomal biogenesis and function Coordinated Lysosomal Expression And Regulation (CLEAR)

35 TFEB modulates the expression of CLEAR genes Transient TFEB modulation in HeLa TFEB TFEB

36 TFEB induction is specific to lysosomal functions Categories of CLEAR genes upregulated by TFEB Lysosomal hydrolases Lysosomal membrane proteins Lysosomal accessory proteins Cytoplasmic proteins protecting from lysosomal hydrolases (e.g. cystatin B) Transporters of lysosomal proteins residing at the TGN (M6PRs) Proteins involved in lysosomal acidification (proton pump subunits) Proteins involved in autophagy (UVRAG, VPSs)

37 Can the CLEAR network be predictive for the identification of novel lysosomal proteins?

38 Discovery of novel lysosomal proteins by testing members of the CLEAR network C1orf85 has CLEAR sites in its promoter, is upregulated following TFEB overexpression and displays a lysosomal localization

39 How is TFEB activated?

40 TFEB is induced by lysosomal sucrose storage The addition of sucrose in cell s culture medium causes lysosomal enhancement LAMP1 Control Sucrose added d (2 weeks) 4.0 Fold activation Time (hrs) HEXA PSAP CTSD CTSF MCOLN1 ATP6V1H TFEB ALN

41 TFEB ACTIVATION TFEB is activated by storage of molecules inside the cells TFEB activation is associated to its nuclear translocation

42 Can we modulate lysosomal activity and cellular clearance by acting on TFEB?

43 TFEB OVEREXPRESSION INCREASES THE NUMBER OF LYSOSOMES IN THE CELL Endogenous levels of TFEB Overexpression of TFEB

44 TFEB OVEREXPRESSION INCREASES THE NUMBER OF LYSOSOMES IN THE CELL Endogenous levels of TFEB Overexpression of TFEB

45 Can we use the discovery of a lysosomal gene network to develop novel therapeutic strategies?

46 POSSIBLE THERAPEUTIC STRATEGIES FOR DISEASES DUE TO THE ACCUMULATION OF TOXIC MOLECULES 1) Inhibit the production 2) Increase the degradation

47 TFEB PROMOTES THE DEGRADATION OF THE PROTEIN RESPONSIBLE FOR HUNTINGTON DISEASE (HUNTINGTIN) TFEB

48 TFEB PROMOTES THE DEGRADATION OF THE PROTEIN RESPONSIBLE FOR HUNTINGTON DISEASE (HUNTINGTIN) GREEN = HUNTINGTIN

49 TFEB PROMOTES THE DEGRADATION OF THE PROTEIN RESPONSIBLE FOR HUNTINGTON DISEASE (HUNTINGTIN) TFEB

50 TFEB promotes the degradation of mutated HTT HD43 cells were electroporated with 3xFLAG-TFEB with a bicistronic vector containing GFP. Cells were sorted for GFP for WB analysis. HTT 3xFLAG-TFEB Empty TFEB/ TFEB/ vector GFP - GFP + HTT ACTIN DAPI HTT/ACTIN MERGE Empty vector TFEB/GFP - TFEB/GFP +

51 Glial cells derived from NPCs WT

52 Glial cells derived from MSD NPCs MSD

53 TFEB over-expression decreases GAGs accumulation and restores normal morphology in glial cells derived from MSD-NPCs MSD + TFEB

54 MSD MSD + TFEB cell 10 vacuoles per MSD MSD+TFEB

55

56 THE TFEB TEAM

57 This discovery is dedicated di d to the memory of Susanna Agnelli

Structure. Lysosomes are membrane-enclosed organelles. Hydrolytic enzymes. Variable in size & shape need

Structure. Lysosomes are membrane-enclosed organelles. Hydrolytic enzymes. Variable in size & shape need Lysosomes Structure Lysosomes are membrane-enclosed organelles Hydrolytic enzymes Variable in size & shape need Degrade material taken up from outside and inside the cell Variable in size and shape Lysosomal

More information

lysosomes Ingested materials Defective cell components Degrades macromolecules of all types:

lysosomes Ingested materials Defective cell components Degrades macromolecules of all types: lysosomes Digests Ingested materials Defective cell components Degrades macromolecules of all types: Proteins Nucleic acids Carbohydrates Lipids Single membrane bound vesicle, contains up to 50 digestive

More information

Lysosomes, Peroxisomes and Centrioles. Hüseyin Çağsın

Lysosomes, Peroxisomes and Centrioles. Hüseyin Çağsın Lysosomes, Peroxisomes and Centrioles Hüseyin Çağsın Lysosomes Outline Endosomes Molecule transport to the lysosomes Endocytosis Exocytosis Autophagy Vacuoles Peroxisomes Centrioles Lysosomes Lysosomes

More information

General information. Cell mediated immunity. 455 LSA, Tuesday 11 to noon. Anytime after class.

General information. Cell mediated immunity. 455 LSA, Tuesday 11 to noon. Anytime after class. General information Cell mediated immunity 455 LSA, Tuesday 11 to noon Anytime after class T-cell precursors Thymus Naive T-cells (CD8 or CD4) email: lcoscoy@berkeley.edu edu Use MCB150 as subject line

More information

Summary of Endomembrane-system

Summary of Endomembrane-system Summary of Endomembrane-system 1. Endomembrane System: The structural and functional relationship organelles including ER,Golgi complex, lysosome, endosomes, secretory vesicles. 2. Membrane-bound structures

More information

Cell Quality Control. Peter Takizawa Department of Cell Biology

Cell Quality Control. Peter Takizawa Department of Cell Biology Cell Quality Control Peter Takizawa Department of Cell Biology Cellular quality control reduces production of defective proteins. Cells have many quality control systems to ensure that cell does not build

More information

Vesicle Transport. Vesicle pathway: many compartments, interconnected by trafficking routes 3/17/14

Vesicle Transport. Vesicle pathway: many compartments, interconnected by trafficking routes 3/17/14 Vesicle Transport Vesicle Formation Curvature (Self Assembly of Coat complex) Sorting (Sorting Complex formation) Regulation (Sar1/Arf1 GTPases) Fission () Membrane Fusion SNARE combinations Tethers Regulation

More information

Molecular Cell Biology Problem Drill 16: Intracellular Compartment and Protein Sorting

Molecular Cell Biology Problem Drill 16: Intracellular Compartment and Protein Sorting Molecular Cell Biology Problem Drill 16: Intracellular Compartment and Protein Sorting Question No. 1 of 10 Question 1. Which of the following statements about the nucleus is correct? Question #01 A. The

More information

Lysosomes and endocytic pathways 9/27/2012 Phyllis Hanson

Lysosomes and endocytic pathways 9/27/2012 Phyllis Hanson Lysosomes and endocytic pathways 9/27/2012 Phyllis Hanson General principles Properties of lysosomes Delivery of enzymes to lysosomes Endocytic uptake clathrin, others Endocytic pathways recycling vs.

More information

Therapeutic approaches to Lysosomal Storage Disorders: the example of Pompe Disease

Therapeutic approaches to Lysosomal Storage Disorders: the example of Pompe Disease EUROPEAN SCHOOL OF MOLECULAR MEDICINE PhD in Molecular Medicine (Human Genetics) XXV Cycle Telethon Institute of Genetics and Medicine (TIGEM) Therapeutic approaches to Lysosomal Storage Disorders: the

More information

endomembrane system internal membranes origins transport of proteins chapter 15 endomembrane system

endomembrane system internal membranes origins transport of proteins chapter 15 endomembrane system endo system chapter 15 internal s endo system functions as a coordinated unit divide cytoplasm into distinct compartments controls exocytosis and endocytosis movement of molecules which cannot pass through

More information

The Cell Organelles. Eukaryotic cell. The plasma membrane separates the cell from the environment. Plasma membrane: a cell s boundary

The Cell Organelles. Eukaryotic cell. The plasma membrane separates the cell from the environment. Plasma membrane: a cell s boundary Eukaryotic cell The Cell Organelles Enclosed by plasma membrane Subdivided into membrane bound compartments - organelles One of the organelles is membrane bound nucleus Cytoplasm contains supporting matrix

More information

centriole cytoskeleton plays a role in cell division centriole protein fibers that provide a framework for the cell cytoskeleton

centriole cytoskeleton plays a role in cell division centriole protein fibers that provide a framework for the cell cytoskeleton centriole plays a role in cell division plays a role in cell division centriole cytoskeleton protein fibers that provide a framework for the cell protein fibers that provide a framework for the cell cytoskeleton

More information

1. Diagnosis of Lysosomal Storage Disorders in Australia. 2. Comparison of Incidence/prevalence of lysosomal storage diseases in different country

1. Diagnosis of Lysosomal Storage Disorders in Australia. 2. Comparison of Incidence/prevalence of lysosomal storage diseases in different country List of Tables: 1. Diagnosis of Lysosomal Storage Disorders in Australia 2. Comparison of Incidence/prevalence of lysosomal storage diseases in different country 3. Relative frequency of LSD in Portugal

More information

Gene Expression-Targeted Isoflavone Therapy: Facts, Questions and Further Possibilities

Gene Expression-Targeted Isoflavone Therapy: Facts, Questions and Further Possibilities Gene Expression-Targeted Isoflavone Therapy: Facts, Questions and Further Possibilities Grzegorz Wegrzyn Department of Molecular Biology University of Gdansk Gdansk, Poland Lysosomal storage diseases (LSD)

More information

Intracellular Vesicular Traffic Chapter 13, Alberts et al.

Intracellular Vesicular Traffic Chapter 13, Alberts et al. Intracellular Vesicular Traffic Chapter 13, Alberts et al. The endocytic and biosynthetic-secretory pathways The intracellular compartments of the eucaryotic ell involved in the biosynthetic-secretory

More information

Organelles Found in a Generalized Animal Cell

Organelles Found in a Generalized Animal Cell Organelles Found in a Generalized Animal Cell 1. Cell Membrane 2. Cytoplasm 3. Nucleus 4. Nuclear Membrane 5. Nucleoplasm 6. Nucleolus 7. Chromosomes 8. Vacuole 9. Ribosomes 10. Rough Endoplasmic Reticulum

More information

Protein Trafficking in the Secretory and Endocytic Pathways

Protein Trafficking in the Secretory and Endocytic Pathways Protein Trafficking in the Secretory and Endocytic Pathways The compartmentalization of eukaryotic cells has considerable functional advantages for the cell, but requires elaborate mechanisms to ensure

More information

A Closer Look at Cell Membranes. Chapter 5 Part 2

A Closer Look at Cell Membranes. Chapter 5 Part 2 A Closer Look at Cell Membranes Chapter 5 Part 2 5.5 Membrane Trafficking By processes of endocytosis and exocytosis, vesicles help cells take in and expel particles that are too big for transport proteins,

More information

PROTEIN TRAFFICKING. Dr. SARRAY Sameh, Ph.D

PROTEIN TRAFFICKING. Dr. SARRAY Sameh, Ph.D PROTEIN TRAFFICKING Dr. SARRAY Sameh, Ph.D Overview Proteins are synthesized either on free ribosomes or on ribosomes bound to endoplasmic reticulum (RER). The synthesis of nuclear, mitochondrial and peroxisomal

More information

Unit 2 Notes: Cells. What you need to know:

Unit 2 Notes: Cells. What you need to know: 1 Unit 2 Notes: Cells What you need to know: 1. MC.2.B.1: Construct a hierarchy of life from cells to ecosystems. (ex: cell, tissue, organ etc) 2. NS.12.B.4: Relate the development of the cell theory to

More information

Answer Key. Chapter Test A

Answer Key. Chapter Test A Answer Key Copyright by McDougal Littell, a division of Houghton Mifflin Company Chapter Test A Multiple Choice 1. c 2. b 3. d 4. a 5. c 6. b 7. c 8. c 9. d 10. a 11. b 12. a 13. d 14. b 15. c Short Answer

More information

Chapt. 10 Cell Biology and Biochemistry. The cell: Student Learning Outcomes: Describe basic features of typical human cell

Chapt. 10 Cell Biology and Biochemistry. The cell: Student Learning Outcomes: Describe basic features of typical human cell Chapt. 10 Cell Biology and Biochemistry Cell Chapt. 10 Cell Biology and Biochemistry The cell: Lipid bilayer membrane Student Learning Outcomes: Describe basic features of typical human cell Integral transport

More information

Renáta Schipp Gergely Berta Department of Medical Biology

Renáta Schipp Gergely Berta Department of Medical Biology The cell III. Renáta Schipp Gergely Berta Department of Medical Biology Size and Biology Biology is a visually rich subject many of the biological events and structures are smaller than the unaided human

More information

Microglia, Inflammation, and FTD

Microglia, Inflammation, and FTD FTD Minicourse April, 2009 Microglia, Inflammation, and FTD Li Gan, Ph.D Gladstone Institute of Neurological Disease University of California, San Francisco Outline Why study inflammation in neurodegeneration?

More information

Cells. Variation and Function of Cells

Cells. Variation and Function of Cells Cells Variation and Function of Cells Cell Theory states that: 1. All living things are made of cells 2. Cells are the basic unit of structure and function in living things 3. New cells are produced from

More information

2 kinds of secondary active transport Ion and solute move in the same direction = symport Example: Na + and glucose in the kidney 2 kinds of secondary

2 kinds of secondary active transport Ion and solute move in the same direction = symport Example: Na + and glucose in the kidney 2 kinds of secondary Chapter 4 The Cell: The Fundamental Unit of Life Transport Across Cell Membranes We ve talked about how cells move solutes across membranes Simple diffusion Channel-mediated diffusion Carrier-mediated

More information

The Cell. The smallest unit of life that can perform all life processes.

The Cell. The smallest unit of life that can perform all life processes. The Cell The smallest unit of life that can perform all life processes. Life is macromolecules that can perform unique functions because they are enclosed in a structural compartment that is separate from

More information

Lipids and Membranes

Lipids and Membranes Lipids and Membranes Presented by Dr. Mohammad Saadeh The requirements for the Pharmaceutical Biochemistry I Philadelphia University Faculty of pharmacy Membrane transport D. Endocytosis and Exocytosis

More information

Chapter 13: Vesicular Traffic

Chapter 13: Vesicular Traffic Chapter 13: Vesicular Traffic Know the terminology: ER, Golgi, vesicle, clathrin, COP-I, COP-II, BiP, glycosylation, KDEL, microtubule, SNAREs, dynamin, mannose-6-phosphate, M6P receptor, endocytosis,

More information

Module 3 Lecture 7 Endocytosis and Exocytosis

Module 3 Lecture 7 Endocytosis and Exocytosis Module 3 Lecture 7 Endocytosis and Exocytosis Endocytosis: Endocytosis is the process by which cells absorb larger molecules and particles from the surrounding by engulfing them. It is used by most of

More information

October 26, Lecture Readings. Vesicular Trafficking, Secretory Pathway, HIV Assembly and Exit from Cell

October 26, Lecture Readings. Vesicular Trafficking, Secretory Pathway, HIV Assembly and Exit from Cell October 26, 2006 Vesicular Trafficking, Secretory Pathway, HIV Assembly and Exit from Cell 1. Secretory pathway a. Formation of coated vesicles b. SNAREs and vesicle targeting 2. Membrane fusion a. SNAREs

More information

Cells & Cell Organelles. Doing Life s Work

Cells & Cell Organelles. Doing Life s Work Cells & Cell Organelles Doing Life s Work AP Biology 2009-2010 Types of cells bacteria cells Prokaryote - no organelles Eukaryotes - organelles animal cells plant cells Cell size comparison Animal cell

More information

Cell Structure & Function. Source:

Cell Structure & Function. Source: Cell Structure & Function Source: http://koning.ecsu.ctstateu.edu/cell/cell.html Definition of Cell A cell is the smallest unit that is capable of performing life functions. http://web.jjay.cuny.edu/~acarpi/nsc/images/cell.gif

More information

Cell Structure and Function

Cell Structure and Function Cell Structure and Function Agre and cells in the news Cells Smallest living unit Most are microscopic Discovery of Cells Robert Hooke (mid-1600s) Observed sliver of cork Saw row of empty boxes Coined

More information

A small, membrane-bound compartment capable of performing all the basic functions of life

A small, membrane-bound compartment capable of performing all the basic functions of life AP Biology The Cell The Cell Cell: A small, membrane-bound compartment capable of performing all the basic functions of life Discovery of Cells: - 17 th century - A Dutch clothing dealer named Antonie

More information

Membranous Organelles

Membranous Organelles Membranous Organelles 1. Membrane-limited organelles 2. Golgi apparatus 3. Lysosomes 4. Peroxisomes (microbodies) 5. Secretory vesicles (granules) 6. Coated vesicles Membrane-limited organelles Endoplasmic

More information

Cells & Cell Organelles

Cells & Cell Organelles Cells & Cell Organelles The Building Blocks of Life AP Biology 2008-2009 Types of cells bacteria cells Prokaryote - no organelles Eukaryotes - organelles animal cells plant cells Cell size comparison Animal

More information

THE ROLE OF ALTERED CALCIUM AND mtor SIGNALING IN THE PATHOGENESIS OF CYSTINOSIS

THE ROLE OF ALTERED CALCIUM AND mtor SIGNALING IN THE PATHOGENESIS OF CYSTINOSIS Research Foundation, 18 month progress report THE ROLE OF ALTERED CALCIUM AND mtor SIGNALING IN THE PATHOGENESIS OF CYSTINOSIS Ekaterina Ivanova, doctoral student Elena Levtchenko, MD, PhD, PI Antonella

More information

Clinical Cell Biology Organelles in Health and Disease

Clinical Cell Biology Organelles in Health and Disease Department of Ophthalmology University of Kiel, University Medical Center Director: Prof. Dr. Johann Roider Clinical Cell Biology Organelles in Health and Disease Prof. Dr. Alexa Klettner Clinical cell

More information

The most valuable lipid ever?

The most valuable lipid ever? The most valuable lipid ever? Spermaceti whale oil Used by sperm whales in a special organ in the huge head cavity Largely comprised of cetyl palmitate ww.thisrecording.com www.greenpeace.org Peer Instruction

More information

Membranous Organelles 2

Membranous Organelles 2 Membranous Organelles 2 1. Membrane-limited organelles 2. Golgi apparatus 3. Lysosomes 4. Peroxisomes (microbodies) 5. Secretory vesicles (granules) 6. Coated vesicles Membrane-limited organelles Endoplasmic

More information

Antigen presenting cells

Antigen presenting cells Antigen recognition by T and B cells - T and B cells exhibit fundamental differences in antigen recognition - B cells recognize antigen free in solution (native antigen). - T cells recognize antigen after

More information

17/01/2017. Protein trafficking between cell compartments. Lecture 3: The cytosol. The mitochondrion - the power plant of the cell

17/01/2017. Protein trafficking between cell compartments. Lecture 3: The cytosol. The mitochondrion - the power plant of the cell ell biology 2017 version 13/1 2017 ote endosome vs lysosome handout Lecture 3: Text book Alberts et al.: hapter 12-14 (Topics covered by the lecture) A lot of reading! Focus on principles ell Biology interactive

More information

Cell Category? Prokaryote

Cell Category? Prokaryote CELLS Cell Category? Prokaryote Prokaryote Eukaryote Cell Category? Cell Type? Cell Category? Cell Type? Endosymbiosis eukaryotic cells were formed from simpler prokaryotes Endo within Symbiosis together

More information

Part 1 Multiple Choice Shade the correct answer on the SCANTRON sheet provided.

Part 1 Multiple Choice Shade the correct answer on the SCANTRON sheet provided. Part 1 Multiple Choice Shade the correct answer on the SCANTRON sheet provided. 1. The type of electron microscope that gives 2 dimensional images. a) Scanning b) Condensing c) Transmission d) Multidimensional

More information

Biology 12 Cell Structure and Function. Typical Animal Cell

Biology 12 Cell Structure and Function. Typical Animal Cell Biology 12 Cell Structure and Function Typical Animal Cell Vacuoles: storage of materials and water Golgi body: a series of stacked disk shaped sacs. Repackaging centre stores, modifies, and packages proteins

More information

CELL BIOLOGY - CLUTCH CH INTRACELLULAR PROTEIN TRANSPORT.

CELL BIOLOGY - CLUTCH CH INTRACELLULAR PROTEIN TRANSPORT. !! www.clutchprep.com CONCEPT: MEMBRANE ENCLOSED ORGANELLES Table of eukaryotic organelles and their functions Organelle Function % volume of cell Cytosol Aqueous fluid where metabolic pathways and chemical

More information

Cytoskeleton. Provide shape and support for the cell. Other functions of the cytoskeleton. Nucleolus. Nucleus

Cytoskeleton. Provide shape and support for the cell. Other functions of the cytoskeleton. Nucleolus. Nucleus Chapter 4: Cell Structure and Function Cytoskeleton The cytoskeleton is a network of fibers that organizes structures and activities in the cell. Microtubules (the largest) Intermediate fibers Microfilaments

More information

By: Brooke Sheppard

By: Brooke Sheppard By: Brooke Sheppard What is a Cell? Cells are the basic structure of life for all organisms. Cells are microscopic, which means we can only view cells under a microscope. There are animal cells and plant

More information

Chapter13 Characterizing and Classifying Viruses, Viroids, and Prions

Chapter13 Characterizing and Classifying Viruses, Viroids, and Prions Chapter13 Characterizing and Classifying Viruses, Viroids, and Prions 11/20/2017 MDufilho 1 Characteristics of Viruses Viruses Minuscule, acellular, infectious agent having either DNA or RNA Cause infections

More information

Cell Theory. Eukaryote Cells. Prokaryote Cells 8/18/16

Cell Theory. Eukaryote Cells. Prokaryote Cells 8/18/16 Cell Theory http://www.beatricebiologist.com www.beatricebiologist.com 1) All living things are made up of cells 2) All cells come from pre-existing cells 3) The cell is the fundamental unit of structure

More information

Human height. Length of some nerve and muscle cells. Chicken egg. Frog egg. Most plant and animal cells Nucleus Most bacteria Mitochondrion

Human height. Length of some nerve and muscle cells. Chicken egg. Frog egg. Most plant and animal cells Nucleus Most bacteria Mitochondrion 10 m 1 m 0.1 m 1 cm Human height Length of some nerve and muscle cells Chicken egg Unaided eye 1 mm Frog egg 100 µm 10 µm 1 µm 100 nm 10 nm Most plant and animal cells Nucleus Most bacteria Mitochondrion

More information

Cell Biology. a review! Cell Theory & Cell Structures

Cell Biology. a review! Cell Theory & Cell Structures Cell Biology Cell Theory & a review! Cell Structures Cell Theory refers to the idea that cells are the basic unit of structure and function of all living things. Cells are either prokaryotic or eukaryotic

More information

Eukaryotic Cell Structures

Eukaryotic Cell Structures Comparing the Cell to a Factory Eukaryotic Cell Structures Structures within a eukaryotic cell that perform important cellular functions are known as organelles. Cell biologists divide the eukaryotic cell

More information

Cellular compartments

Cellular compartments Cellular compartments 1. Cellular compartments and their function 2. Evolution of cellular compartments 3. How to make a 3D model of cellular compartment 4. Cell organelles in the fluorescent microscope

More information

Chapter 3 Part 2! Pages (10 th and 11 th eds.)! The Cellular Level of Organization! Cellular Organelles and Protein Synthesis!

Chapter 3 Part 2! Pages (10 th and 11 th eds.)! The Cellular Level of Organization! Cellular Organelles and Protein Synthesis! Chapter 3 Part 2! Pages 65 89 (10 th and 11 th eds.)! The Cellular Level of Organization! Cellular Organelles and Protein Synthesis! The Cell Theory! Living organisms are composed of one or more cells.!

More information

Looking Inside Cells

Looking Inside Cells Looking Inside Cells Inner Life of a Cell http://www.bing.com/videos/search?q=inside +cell+animation&form=hdrsc3#view=detail &mid=4ba834420ea307a061374ba834420ea 307A06137 Cell Defined Cells-Basic unit

More information

A. Major parts 1. Nucleus 2. Cytoplasm a. Contain organelles (see below) 3. Plasma membrane (To be discussed in Cellular Transport Lecture)

A. Major parts 1. Nucleus 2. Cytoplasm a. Contain organelles (see below) 3. Plasma membrane (To be discussed in Cellular Transport Lecture) Lecture 5: Cellular Biology I. Cell Theory Concepts: 1. Cells are the functional and structural units of living organisms 2. The activity of an organism is dependent on both the individual and collective

More information

Cell Biology. A discipline of biology: 1. Cell structure 2. Cellular processes 3. Cell division

Cell Biology. A discipline of biology: 1. Cell structure 2. Cellular processes 3. Cell division The Cell Cell Biology 1 A discipline of biology: 1. Cell structure 2. Cellular processes 3. Cell division Tight connection with 1. Molecular biology 2. Biochemistry Cell theory 2 1838, 1839 Theodor Schwann

More information

Look at the following images, what are some similarities and differences between the cells?

Look at the following images, what are some similarities and differences between the cells? Look at the following images, what are some similarities and differences between the cells? Name the two different types of cells 1. Prokaryotic Cells 2. Eukaryotic Cells Unit 3: Cells Objective: To

More information

Renata Schipp Medical Biology Department

Renata Schipp Medical Biology Department Renata Schipp Medical Biology Department Deffinition of cell The cell is the smallest structural and functional unit of all known living organisms The cell was discovered by Robert Hooke in 1665 and also

More information

HLA and antigen presentation. Department of Immunology Charles University, 2nd Medical School University Hospital Motol

HLA and antigen presentation. Department of Immunology Charles University, 2nd Medical School University Hospital Motol HLA and antigen presentation Department of Immunology Charles University, 2nd Medical School University Hospital Motol MHC in adaptive immunity Characteristics Specificity Innate For structures shared

More information

Antigen Presentation to T lymphocytes

Antigen Presentation to T lymphocytes Antigen Presentation to T lymphocytes Immunology 441 Lectures 6 & 7 Chapter 6 October 10 & 12, 2016 Jessica Hamerman jhamerman@benaroyaresearch.org Office hours by arrangement Antibodies and T cell receptors

More information

8/7/18. UNIT 2: Cells Chapter 3: Cell Structure and Function. I. Cell Theory (3.1) A. Early studies led to the development of the cell theory

8/7/18. UNIT 2: Cells Chapter 3: Cell Structure and Function. I. Cell Theory (3.1) A. Early studies led to the development of the cell theory 8/7/18 UNIT 2: Cells Chapter 3: Cell Structure and Function I. Cell Theory (3.1) A. Early studies led to the development of the cell theory 1. Discovery of Cells a. Robert Hooke (1665)-Used compound microscope

More information

Assembly of ribosomes begins here. Shapes, supports, and protects the cell

Assembly of ribosomes begins here. Shapes, supports, and protects the cell Semester Review Identify the kingdoms that are able to perform cellular respiration. Assembly of ribosomes begins here Shapes, supports, and protects the cell 1 Contrast passive & active transport Describe

More information

4. Lysosomes, Smooth Endoplasmic Reticulum, Mitochondria, and Inclusions

4. Lysosomes, Smooth Endoplasmic Reticulum, Mitochondria, and Inclusions 4. Lysosomes, Smooth Endoplasmic Reticulum, Mitochondria, and Inclusions Undergraduate Graduate Histology Lecture Series Larry Johnson, Professor Veterinary Integrative Biosciences Texas A&M University

More information

Cell Theory. Cells are the basic unit of life.

Cell Theory. Cells are the basic unit of life. 3.1 7.1 Cell Theory Cells are the basic unit of life. 3.1 7.1 Cell Theory The cell theory grew out of the work of many scientists Galileo (1610) made the first microscope Hooke (1665) made up the term

More information

SUPPLEMENTARY/SECOND OPPORTUNITY EXAMINATION QUESTION PAPER

SUPPLEMENTARY/SECOND OPPORTUNITY EXAMINATION QUESTION PAPER I nnmibin UNIVERSITY OF SCIENCE nno TECHNOLOGY FACULTY OF HEALTH AND APPLIED SCIENCES DEPARTMENT OF NATURAL AND APPLIED SCIENCES QUALIFICATION: BACHELOR OF SCIENCE QUALIFICATION CODE: O7BOSC LEVEL: 6 COURSE

More information

(impermeable; freely permeable; selectively permeable)

(impermeable; freely permeable; selectively permeable) BIOL 2457 CHAPTER 3 Part 1 SI 1 1. A is the basic structure of life. 2. The gelatinous inside of the cell is called the. 3. Name the structure that increases the cell s surface area? 4. Name the structure

More information

Mr. Powner Biology Cell Structure & Function Quiz Image Guide. Do NOT Write on this page. It is an Image guide for test questions.

Mr. Powner Biology Cell Structure & Function Quiz Image Guide. Do NOT Write on this page. It is an Image guide for test questions. Mr. Powner Biology Cell Structure & Function Quiz Prompts 1. The cell s managing structure; it contains most of the cell s genetic material (DNA, which stores information used to make proteins for cell

More information

BIOH111. o Cell Biology Module o Tissue Module o Integumentary system o Skeletal system o Muscle system o Nervous system o Endocrine system

BIOH111. o Cell Biology Module o Tissue Module o Integumentary system o Skeletal system o Muscle system o Nervous system o Endocrine system BIOH111 o Cell Biology Module o Tissue Module o Integumentary system o Skeletal system o Muscle system o Nervous system o Endocrine system Endeavour College of Natural Health endeavour.edu.au 1 Textbook

More information

First discovered in 1665 since then every organism observed with microscopes shows cells

First discovered in 1665 since then every organism observed with microscopes shows cells The Cell Cell theory (1838): 1. All organisms are composed of one or more cells, and the life processes of metabolism and heredity occur within these cells. 2. Cells are the smallest living things, the

More information

Organelles. copyright cmassengale 1

Organelles. copyright cmassengale 1 Organelles copyright cmassengale 1 Organelles Very small (Microscopic) Perform various functions for a cell Found in the cytoplasm May or may not be membrane-bound 2 Animal Cell Organelles Nucleolus Nucleus

More information

Molecular Cell Biology. Prof. D. Karunagaran. Department of Biotechnology. Indian Institute of Technology Madras

Molecular Cell Biology. Prof. D. Karunagaran. Department of Biotechnology. Indian Institute of Technology Madras Molecular Cell Biology Prof. D. Karunagaran Department of Biotechnology Indian Institute of Technology Madras Module- 4 Membrane Organization and Transport Across Membranes Lecture-3 Endoplasmic Reticulum,

More information

Chapter 2 Cell. Zhou Li Prof. Dept. of Histology and Embryology

Chapter 2 Cell. Zhou Li Prof. Dept. of Histology and Embryology Chapter 2 Cell Zhou Li Prof. Dept. of Histology and Embryology The inner life of the cell Ⅰ. Plasma membrane (Plasmalemma) 1.1 The structure Unit membrane: inner layer 3-layered structure outer layer mediat

More information

Cell morphology. Cell organelles structure and function. Chapter 1: UNIT 1. Dr. Charushila Rukadikar

Cell morphology. Cell organelles structure and function. Chapter 1: UNIT 1. Dr. Charushila Rukadikar UNIT 1 Cell morphology Cell organelles structure and function Chapter 1: Dr. Charushila Rukadikar Assistant Professor Department Of Physiology ZMCH, Dahod Physiology The science that is concerned with

More information

Cells. 1. Smallest living structures. 2. Basic structural and functional units of the body. 3. Derived from pre-existing cells. 4. Homeostasis.

Cells. 1. Smallest living structures. 2. Basic structural and functional units of the body. 3. Derived from pre-existing cells. 4. Homeostasis. Cells The Cell The human body has about 75 trillion cells All tissues and organs are made up of cells Smallest functional unit of life Cytology Histology Cytology Epithelial cells Fibroblasts Erythrocytes

More information

Cell Structure and Function. Biology 12 Unit 1 Cell Structure and Function Inquiry into Life pages and 68-69

Cell Structure and Function. Biology 12 Unit 1 Cell Structure and Function Inquiry into Life pages and 68-69 Cell Structure and Function Biology 12 Unit 1 Cell Structure and Function Inquiry into Life pages 45 59 and 68-69 Assignments for this Unit Pick up the notes/worksheet for this unit and the project There

More information

Chapter 7: Inside the Cell

Chapter 7: Inside the Cell Chapter 7: Inside the Cell 7.1 Bacterial and Archael Cell Structures and Their Functions - Eukaryotic cells have a membrane-bound compartment called a nucleus, while prokaryotic cells do not. - Morphology

More information

Cell Theory All living matter is composed of one or more The cell is the structural and functional unit of life All cells come from pre-existing cell

Cell Theory All living matter is composed of one or more The cell is the structural and functional unit of life All cells come from pre-existing cell Cell Theory All living matter is composed of one or more The cell is the structural and functional unit of life All cells come from pre-existing cell Prokeryotic Bacteria or archaea Cell wall, small circular

More information

Mechanism of Vesicular Transport

Mechanism of Vesicular Transport Mechanism of Vesicular Transport Transport vesicles play a central role in the traffic of molecules between different membrane-enclosed enclosed compartments. The selectivity of such transport is therefore

More information

Name Class Date. cell theory organelle eukaryotic cell. MAIN IDEA: Early studies led to the development of the cell theory.

Name Class Date. cell theory organelle eukaryotic cell. MAIN IDEA: Early studies led to the development of the cell theory. Section 1: Cell Theory KEY CONCEPT Cells are the basic unit of life. VOCABULARY cell theory organelle eukaryotic cell cytoplasm prokaryotic cell MAIN IDEA: Early studies led to the development of the cell

More information

Cells & Cell Organelles

Cells & Cell Organelles Cells & Cell Organelles Doing Life s Work 2009 2010 1 Types of cells bacteria cells Prokaryote no organelles animal cells Eukaryotes organelles plant cells 2 Cell size comparison Animal cell Bacterial

More information

Cell Physiology Final Exam Fall 2009

Cell Physiology Final Exam Fall 2009 Cell Physiology Final Exam Fall 2009 1. I am sure that most of you are stressing now. Your heart rate is higher than normal, your breathing faster and your senses more acute. What phase of stress response

More information

Biology Study Guide Answers. Cells/Cell Transport

Biology Study Guide Answers. Cells/Cell Transport Biology Study Guide Answers Cells/Cell Transport 1 1.) All living things are made of cells. 2.) Cells are the most basic unit of structure and function in living things. 3.) Cells come from pre-existing

More information

Chapter Seven. A View of the Cell

Chapter Seven. A View of the Cell Chapter Seven A View of the Cell Cellular Organization Cell Tissue group of cells functioning together. Organ group of tissues functioning together. Organ System group of organs functioning together. Organism

More information

(a) TEM of a plasma. Fimbriae. Nucleoid. Ribosomes. Plasma membrane. Cell wall Capsule. Bacterial chromosome

(a) TEM of a plasma. Fimbriae. Nucleoid. Ribosomes. Plasma membrane. Cell wall Capsule. Bacterial chromosome 0 m m 0. m cm mm 00 µm 0 µm 00 nm 0 nm Human height Length of some nerve and muscle cells Chicken egg Frog egg Most plant and animal cells Most bacteria Smallest bacteria Viruses Proteins Unaided eye Light

More information

General aspects of this review - specific examples were addressed in class.

General aspects of this review - specific examples were addressed in class. General aspects of this review - specific examples were addressed in class. 1 Exam 1 Lecture 2: Discussed intracellular killing mechanisms Important maturation steps Rapid development into a microbicidal

More information

Keystone Biology Remediation A4: Homeostasis and Transport

Keystone Biology Remediation A4: Homeostasis and Transport Keystone Biology Remediation A4: Homeostasis and Transport Assessment Anchors: to describe how the structure of the plasma allows it to function as a regulatory structure and/or protective barrier for

More information

Chapter Seven. A View of the Cell

Chapter Seven. A View of the Cell Chapter Seven A View of the Cell Cellular Organization Cell Tissue group of cells functioning together. Organ group of tissues functioning together. Organ System group of organs functioning together. Organism

More information

5.6 Diffusion, Membranes, and Metabolism

5.6 Diffusion, Membranes, and Metabolism 5.6 Diffusion, Membranes, and Metabolism Concentration of a substance Number of atoms or molecules in a given volume Concentration gradient of a substance A difference in concentration between two regions

More information

Study Guide A. Answer Key. Cell Structure and Function

Study Guide A. Answer Key. Cell Structure and Function Cell Structure and Function Answer Key SECTION 1. CELL THEORY 1. b 2. e 3. d 4. a 5. c 6. i. cells; ii. living; iii. cell 7. biology 8. Surrounded by a cell membrane = Both; Contains cytoplasm = Both;

More information

Cell Structure and Function. The Basic Unit of Life

Cell Structure and Function. The Basic Unit of Life Cell Structure and Function The Basic Unit of Life The Discovery of the Cell Robert Hooke The word " cell was first used in late 1665 by Robert Hooke. He looked at thin slices of cork (plant cells) under

More information

Structures in Cells. Cytoplasm. Lecture 5, EH1008: Biology for Public Health, Biomolecules

Structures in Cells. Cytoplasm. Lecture 5, EH1008: Biology for Public Health, Biomolecules Structures in Cells Lecture 5, EH1008: Biology for Public Health, Biomolecules Limian.zheng@ucc.ie 1 Cytoplasm Nucleus Centrioles Cytoskeleton Cilia Microvilli 2 Cytoplasm Cellular material outside nucleus

More information

Intracellular Compartments and Protein Sorting

Intracellular Compartments and Protein Sorting Intracellular Compartments and Protein Sorting Intracellular Compartments A eukaryotic cell is elaborately subdivided into functionally distinct, membrane-enclosed compartments. Each compartment, or organelle,

More information

Review Quizzes Chapters 1-5

Review Quizzes Chapters 1-5 Review Quizzes Chapters 1-5 1.Which of the following constitutes the quarternary level of protein structure? a. bonding between side chains of amino acids b. sequence of amino acids joined by peptide bonds

More information

The Secret Power of the Cell s Waste Bin

The Secret Power of the Cell s Waste Bin The Secret Power of the Cell s Waste Bin Trash collectors in the cell moonlight at the controls of the genetic machinery. By Esther Landhuis Roberto Zoncu, Sabatini Lab, Whitehead Institute Glowing yellow

More information

Chapter 7 Notes. Section 1

Chapter 7 Notes. Section 1 Chapter 7 Notes Section 1 Cells Cells remained out of sight during most of human history until the invention of the first microscopes. It was not until the mid 1600s that scientists began to use microscopes

More information

The role of the laboratory in diagnosing lysosomal disorders

The role of the laboratory in diagnosing lysosomal disorders The role of the laboratory in diagnosing lysosomal disorders Dr Guy Besley, formerly Willink Biochemical Genetics Unit, Manchester Children s Hospital, Manchester M27 4HA, UK. Lysosomal disorders What

More information