Summary of Data Dissemination Working Group. 22Jan2016

Size: px
Start display at page:

Download "Summary of Data Dissemination Working Group. 22Jan2016"

Transcription

1 Summary of Data Dissemination Working Group 22Jan2016

2 Overview Review of Data Dissemination Working Group Strategy for data dissemination Testing of model and submission process Systems Biology Centers test submissions Current work converting IRD/ViPR to SysBio v2.0

3 DDWG Background and objective DDWG started fall 2014 Tasked with developing a data dissemination strategy for all five systems biology centers. Key issues: What types of data should be disseminated? Where should the data go? How should the metadata be represented?

4 Projected data types for dissemination Original list order Experiment # of SysBio Type Analyte Methodology FluDyNeMo Flu-OMICS MaHPIC Omics-4TB OMICS-LHV Centers Currently supported? Data archives Dissemination priority 1 OMICS Type mrna (transcriptome) microarray No No No Yes Yes 2 Y GEO & BRC 1 2 OMICS Type mirna microarray No No No Yes Yes 2 Y GEO & BRC 1 3 OMICS Type mrna (transcriptome) RNA-seq Yes Yes Yes Yes Yes 5 N 1 4 OMICS Type mirna RNA-seq Yes No Yes 2 N 1 5 OMICS Type microbial RNA (metatranscriptome) RNA-seq Yes No No No 1 N 3 6 OMICS Type influenza metagenome RNA-seq Yes No No No 1 N 3 7 OMICS Type bacterial 16S profiling targeted sequencing Yes No No No 1 N 3 8 OMICS Type mrna (transcriptome) Microfluidic multiplex qrt-pcr No Yes Yes No 2 N 2 9 OMICS Type protein-dna interactions ChIP-seq No Yes No Yes Yes 3 N 2 10 OMICS Type open chromatin Faire-SEQ No No No No Yes 1 N 2 11 OMICS Type DNA methylation No Yes No No Yes 2 N 2 12 OMICS Type protein (proteome) mass spectrometry No Yes Yes Yes Yes 4 Y Peptide Atlas & BRC 1 13 OMICS Type phosphoproteins (phosphoproteome) mass spectrometry No Yes Yes Yes Yes 4 N 1 14 OMICS Type metabolites (metabolome) mass spectrometry No Yes Yes Yes Yes 4 Y Metabolites & BRC 1 15 OMICS Type lipids (lipidome) mass spectrometry No Yes Yes Yes Yes 4 Y BRC 1 16 OMICS Type protein-protein interactions yeast two hybrid No No No No No 0 N 4 17 OMICS Type protein-protein interactions co-immunoprecipitation No Yes No No Yes 2 N 2 18 Phenotypic Weight Yes Yes Yes No Yes 4 N 1 19 Phenotypic Body Temperature No No Yes No No 1 N 3 20 Phenotypic Virus Titers plaque assay Yes Yes No No Yes 3 N 2 21 Phenotypic Virus genomic RNA levels qpcr No No No No Yes 1 N 3 22 Phenotypic Virus mrna levels qpcr No No No No Yes 1 N 3 23 Phenotypic Hematology (??) CBC (manual & automated) No No Yes No No 1 N 3 24 Phenotypic Lung Function (??) No No No? No No 0 N 4 25 Phenotypic Clinical Score Direct Observation Yes No No? No Yes 2 N 2 26 Phenotypic tissue architecture histology with H&E stain Yes Yes? Yes? Yes Yes 5 N 1 27 Phenotypic protein tissue expression immunohistochemistry Yes No Yes? No Yes 3 N 2 28 Phenotypic serum antibody ELISA Yes No No Yes No 2 N 2 29 Phenotypic cellular cytotoxicity Cell Titer Go (Promega) No No No No Yes 1 N 3 30 Phenotypic cytokine protein levels cytokine bead arrays Yes No Yes Yes Yes 4 N 1 31 Phenotypic cytokine protein levels ELISA Yes No Yes? No Yes 3 N 2 32 Phenotypic cytokine protein levels Bioplex assay Yes No No No Yes 2 N 2 33 Phenotypic cytokine protein secretion ELISPOT Yes No No No 1 N 3 34 Phenotypic parasitemia 35 Phenotypic thin and thick smear slides No No Yes No No 1 N 3 (MPSS) Macaque Physiological Scoring System [numeric value 0-16] No No Yes No No 1 N 3 36 Phenotypic serum chemical levels istat chem profile No No Yes No No 1 N 3

5 Leveraging public archives to store raw and processed data Primary omics type data and unstructured metadata to public archives GEO / SRA / Array Express PeptideAtlas / Metabolites / massive Derived omics data and structured metadata to BRCs Phenotypic data If no archive exists, BRC will accept data where possible, SysBio metadata standards should be used

6 Derived data from SBCs to respective Bioinformatics Resource Centers (BRCs) Flu-Omics

7 Derived data in the form of biosets Biosets are interesting interpreted results from an experiment Biosets can be directly provided by the SBCs to BRCs or BRCs may choose to generate from processed data Bioset example genes/proteins that are differentially expressed in a: comparison of human mock infected and influenza infected cells after 7 HPI comparison of influenza infected wild-type mice and CXCR3 KO mice after 2 days of infection comparison of H5N1 infected wild-type mice to H1N1 infected wild-type mice comparison of H5N1 at 5 MOI to H5N1 at 1 MOI in human cells

8 Metadata representation Enhancements of SysBio v1.0 in SysBio v2.0 Added experimental time line using a Reference Time Zero (T0) to support multiple treatment, multiple sampling and complex study designs Added Analysis Workflows and Data Processing Events to capture data transformation and relationships between data Added Disease and Disease Course Stage objects to explicitly capture disease manifestation (previously associated with viral agent)

9 Data model and submission process testing

10 Getting started One-on-one calls between System Centers and BRCs identified use cases for initial test of metadata standard and submission process Testing results and potential issues to be presented later by individual centers Converting IRD/ViPR previous contract data from SysBio v1.0 to SysBio v2.0 underway

11 IRD/ViPR update Have begun implementing data model based on SysBio v2.0 at IRD/ViPR Converting data from previous SBC contracts Preparing loading and validation submission infrastructure Updates to UI pending

12 IRD/ViPR data model Study/Experiment Assay Data Analysis

13 Conclusion SysBio v2.0 adopted in summer 2015 Testing of new data types may require revisions Submissions to begin in 2016 Areas still under consideration Controlled vocabulary Data formatting Data archive selection Unified approach? Stable & unique entity identifiers (post-translational modifications, metabolites, etc.)

14 Acknowledgement Data Dissemination Working Group EupathDB Brian Brunk Omar Harb Jessica Kissinger Flu-DyNeMo Elodie Ghedin Lauren Lashua Alan Twaddle Abhishek Pratap Flu-Omics Sumit Chandra Lars Pache Crystal Herndon Andre Gatarano MaHPIC Jessica Kissinger Mary Galinkski Suman Pakala Mustafa Veysi Nural Regina C Joice NIAID Vivian Dugan Alison Yao Megan Hoffmann Eric Choi Omics-4TB Serdar Turkasian Micheleen Harris Omics-LHV Michelle Craft Kelly Stratton Katrina Waters Amie Eisfeld Miron Livny Allison Thompson PATRIC Rebecca Will Tom Brettin Rebecca Wattam Maulik Shukla ViPR/IRD Richard Scheuermann Brian Aevermann

Innovations in nucleic acid amplification technologies. Automated platforms for NAT. Microfluidics Digital PCR Innovations in nucleic acid microarrays

Innovations in nucleic acid amplification technologies. Automated platforms for NAT. Microfluidics Digital PCR Innovations in nucleic acid microarrays About the author Disclaimer EXECUTIVE SUMMARY Molecular diagnostic technologies Healthcare-associated infections Sexually transmitted HPVs HIV and hepatitis viruses Market outlook and forecasts Molecular

More information

Metabolomic and Proteomics Solutions for Integrated Biology. Christine Miller Omics Market Manager ASMS 2015

Metabolomic and Proteomics Solutions for Integrated Biology. Christine Miller Omics Market Manager ASMS 2015 Metabolomic and Proteomics Solutions for Integrated Biology Christine Miller Omics Market Manager ASMS 2015 Integrating Biological Analysis Using Pathways Protein A R HO R Protein B Protein X Identifies

More information

Systems Biology and Animal Models: STRIDE

Systems Biology and Animal Models: STRIDE Systems Biology and Animal Models: STRIDE Michael G Katze, Ph.D. presentation to Eighth Comparative Medicine Resource Directors Meeting May 10th, 2010 Questions What Pandemics Are We Currently Experiencing?

More information

Analysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers

Analysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers Analysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers Gordon Blackshields Senior Bioinformatician Source BioScience 1 To Cancer Genetics Studies

More information

Diagnosis of infectious diseases and confirmation of diagnosis. Molecular epidemiology of emerging/re-emerging pathogens

Diagnosis of infectious diseases and confirmation of diagnosis. Molecular epidemiology of emerging/re-emerging pathogens LA PREPARAZIONE E LA RISPOSTA ALLE EMERGENZE INFETTIVE Padova, 20 settembre 2012 Laboratory advanced technologies in the support of Public Health interventions in infectious disease emergencies Prof. Giorgio

More information

Complexity DNA. Genome RNA. Transcriptome. Protein. Proteome. Metabolites. Metabolome

Complexity DNA. Genome RNA. Transcriptome. Protein. Proteome. Metabolites. Metabolome DNA Genome Complexity RNA Transcriptome Systems Biology Linking all the components of a cell in a quantitative and temporal manner Protein Proteome Metabolites Metabolome Where are the functional elements?

More information

RESEARCHER S NAME: Làszlò Tora RESEARCHER S ORGANISATION: Institut de Génétique et de Biologie Moléculaire et Cellulaire (IGBMC)

RESEARCHER S NAME: Làszlò Tora RESEARCHER S ORGANISATION: Institut de Génétique et de Biologie Moléculaire et Cellulaire (IGBMC) Thursday 5 November EU-India PARTNERING EVENT Theme: Health RESEARCHER S NAME: Làszlò Tora RESEARCHER S ORGANISATION: Institut de Génétique et de Biologie Moléculaire et Cellulaire (IGBMC) CNRS, INSERM,

More information

Lectures 13: High throughput sequencing: Beyond the genome. Spring 2017 March 28, 2017

Lectures 13: High throughput sequencing: Beyond the genome. Spring 2017 March 28, 2017 Lectures 13: High throughput sequencing: Beyond the genome Spring 2017 March 28, 2017 h@p://www.fejes.ca/2009/06/science- cartoons- 5- rna- seq.html Omics Transcriptome - the set of all mrnas present in

More information

OMICS Journals are welcoming Submissions

OMICS Journals are welcoming Submissions OMICS Journals are welcoming Submissions OMICS International welcomes submissions that are original and technically so as to serve both the developing world and developed countries in the best possible

More information

microrna Presented for: Presented by: Date:

microrna Presented for: Presented by: Date: microrna Presented for: Presented by: Date: 2 micrornas Non protein coding, endogenous RNAs of 21-22nt length Evolutionarily conserved Regulate gene expression by binding complementary regions at 3 regions

More information

Supplemental Information. Aryl Hydrocarbon Receptor Controls. Monocyte Differentiation. into Dendritic Cells versus Macrophages

Supplemental Information. Aryl Hydrocarbon Receptor Controls. Monocyte Differentiation. into Dendritic Cells versus Macrophages Immunity, Volume 47 Supplemental Information Aryl Hydrocarbon Receptor Controls Monocyte Differentiation into Dendritic Cells versus Macrophages Christel Goudot, Alice Coillard, Alexandra-Chloé Villani,

More information

QIAGEN's Growing Immuno-Oncology Testing Portfolio

QIAGEN's Growing Immuno-Oncology Testing Portfolio QIAGEN's Growing Immuno-Oncology Testing Portfolio QIAGEN Your Partner in Translational Medicine Current Biomarkers of Immuno-Oncology Focus: Immuno-Oncology Testing Portfolio Tumor mutation burden (TMB)

More information

EPIGENOMICS PROFILING SERVICES

EPIGENOMICS PROFILING SERVICES EPIGENOMICS PROFILING SERVICES Chromatin analysis DNA methylation analysis RNA-seq analysis Diagenode helps you uncover the mysteries of epigenetics PAGE 3 Integrative epigenomics analysis DNA methylation

More information

Biomarker development in the era of precision medicine. Bei Li, Interdisciplinary Technical Journal Club

Biomarker development in the era of precision medicine. Bei Li, Interdisciplinary Technical Journal Club Biomarker development in the era of precision medicine Bei Li, 23.08.2016 Interdisciplinary Technical Journal Club The top ten highest-grossing drugs in the United States help between 1 in 25 and 1 in

More information

Profili di espressione genica

Profili di espressione genica Profili di espressione genica Giampaolo Bianchini MD Ospedale San Raffaele, Milan - Italy Gene expression profiles Transcriptomics Gene DNA mrna mirnas Protein metilation Metabolite Genomics Transcriptomics

More information

The value of Omics to chemical risk assessment

The value of Omics to chemical risk assessment The value of Omics to chemical risk assessment Timothy W Gant There is a focus on transcriptomics in this talk but for example only. All omics are useful in risk assessment Outline What are we aiming to

More information

Experimental Design For Microarray Experiments. Robert Gentleman, Denise Scholtens Arden Miller, Sandrine Dudoit

Experimental Design For Microarray Experiments. Robert Gentleman, Denise Scholtens Arden Miller, Sandrine Dudoit Experimental Design For Microarray Experiments Robert Gentleman, Denise Scholtens Arden Miller, Sandrine Dudoit Copyright 2002 Complexity of Genomic data the functioning of cells is a complex and highly

More information

Microfluidic Devices for HIV Point-of-Care Diagnostics Xuanhong Cheng

Microfluidic Devices for HIV Point-of-Care Diagnostics Xuanhong Cheng Microfluidic Devices for HIV Point-of-Care Diagnostics Xuanhong Cheng Bioengineering Materials Science and Engineering Lehigh University November 30, 2018 POC Diagnostics Basic Water Supply Microdevices

More information

RNA-seq Introduction

RNA-seq Introduction RNA-seq Introduction DNA is the same in all cells but which RNAs that is present is different in all cells There is a wide variety of different functional RNAs Which RNAs (and sometimes then translated

More information

Introduction to Proteomics 1.0

Introduction to Proteomics 1.0 Introduction to Proteomics 1.0 CMSP Workshop Pratik Jagtap Managing Director, CMSP Objectives Why are we here? For participants: Learn basics of MS-based proteomics Learn what s necessary for success using

More information

Not IN Our Genes - A Different Kind of Inheritance.! Christopher Phiel, Ph.D. University of Colorado Denver Mini-STEM School February 4, 2014

Not IN Our Genes - A Different Kind of Inheritance.! Christopher Phiel, Ph.D. University of Colorado Denver Mini-STEM School February 4, 2014 Not IN Our Genes - A Different Kind of Inheritance! Christopher Phiel, Ph.D. University of Colorado Denver Mini-STEM School February 4, 2014 Epigenetics in Mainstream Media Epigenetics *Current definition:

More information

Supplemental Figure 1. Genes showing ectopic H3K9 dimethylation in this study are DNA hypermethylated in Lister et al. study.

Supplemental Figure 1. Genes showing ectopic H3K9 dimethylation in this study are DNA hypermethylated in Lister et al. study. mc mc mc mc SUP mc mc Supplemental Figure. Genes showing ectopic HK9 dimethylation in this study are DNA hypermethylated in Lister et al. study. Representative views of genes that gain HK9m marks in their

More information

Set the stage: Genomics technology. Jos Kleinjans Dept of Toxicogenomics Maastricht University, the Netherlands

Set the stage: Genomics technology. Jos Kleinjans Dept of Toxicogenomics Maastricht University, the Netherlands Set the stage: Genomics technology Jos Kleinjans Dept of Toxicogenomics Maastricht University, the Netherlands Amendment to the latest consolidated version of the REACH legislation REACH Regulation 1907/2006:

More information

Characterizing intra-host influenza virus populations to predict emergence

Characterizing intra-host influenza virus populations to predict emergence Characterizing intra-host influenza virus populations to predict emergence June 12, 2012 Forum on Microbial Threats Washington, DC Elodie Ghedin Center for Vaccine Research Dept. Computational & Systems

More information

Accessing and Using ENCODE Data Dr. Peggy J. Farnham

Accessing and Using ENCODE Data Dr. Peggy J. Farnham 1 William M Keck Professor of Biochemistry Keck School of Medicine University of Southern California How many human genes are encoded in our 3x10 9 bp? C. elegans (worm) 959 cells and 1x10 8 bp 20,000

More information

NIAID Oversight of Clinical Research and Funding Opportunities

NIAID Oversight of Clinical Research and Funding Opportunities NIAID Oversight of Clinical Research and Funding Opportunities The Fundamentals of International Clinical Research Workshop Dar es Salaam, Tanzania Polly R. Sager, Ph.D. Division of Microbiology and Infectious

More information

Session 4 Rebecca Poulos

Session 4 Rebecca Poulos The Cancer Genome Atlas (TCGA) & International Cancer Genome Consortium (ICGC) Session 4 Rebecca Poulos Prince of Wales Clinical School Introductory bioinformatics for human genomics workshop, UNSW 20

More information

Mass Spectrometry and Proteomics - Lecture 4 - Matthias Trost Newcastle University

Mass Spectrometry and Proteomics - Lecture 4 - Matthias Trost Newcastle University Mass Spectrometry and Proteomics - Lecture 4 - Matthias Trost Newcastle University matthias.trost@ncl.ac.uk previously Peptide fragmentation Hybrid instruments 117 The Building Blocks of Life DNA RNA Proteins

More information

Computer Science, Biology, and Biomedical Informatics (CoSBBI) Outline. Molecular Biology of Cancer AND. Goals/Expectations. David Boone 7/1/2015

Computer Science, Biology, and Biomedical Informatics (CoSBBI) Outline. Molecular Biology of Cancer AND. Goals/Expectations. David Boone 7/1/2015 Goals/Expectations Computer Science, Biology, and Biomedical (CoSBBI) We want to excite you about the world of computer science, biology, and biomedical informatics. Experience what it is like to be a

More information

Hisanori Kato. Endowed Chair of Food for Life Organization for Interdisciplinary Research Projects The University of Tokyo

Hisanori Kato. Endowed Chair of Food for Life Organization for Interdisciplinary Research Projects The University of Tokyo Workshop Argentina-Japan Bioscience and Biotechnology for the Promotion of Agriculture and Food Production -August 3rd to 7th 2009- Hisanori Kato Endowed Chair of Food for Life Organization for Interdisciplinary

More information

BIMM 143. RNA sequencing overview. Genome Informatics II. Barry Grant. Lecture In vivo. In vitro.

BIMM 143. RNA sequencing overview. Genome Informatics II. Barry Grant. Lecture In vivo. In vitro. RNA sequencing overview BIMM 143 Genome Informatics II Lecture 14 Barry Grant http://thegrantlab.org/bimm143 In vivo In vitro In silico ( control) Goal: RNA quantification, transcript discovery, variant

More information

Molecular Markers. Marcie Riches, MD, MS Associate Professor University of North Carolina Scientific Director, Infection and Immune Reconstitution WC

Molecular Markers. Marcie Riches, MD, MS Associate Professor University of North Carolina Scientific Director, Infection and Immune Reconstitution WC Molecular Markers Marcie Riches, MD, MS Associate Professor University of North Carolina Scientific Director, Infection and Immune Reconstitution WC Overview Testing methods Rationale for molecular testing

More information

Supplementary Figure 1 (Related with Figure 4). Molecular consequences of Eed deletion. (a) ChIP analysis identifies 3925 genes that are associated

Supplementary Figure 1 (Related with Figure 4). Molecular consequences of Eed deletion. (a) ChIP analysis identifies 3925 genes that are associated Supplementary Figure 1 (Related with Figure 4). Molecular consequences of Eed deletion. (a) ChIP analysis identifies 3925 genes that are associated with the H3K27me3 mark in chondrocytes (see Table S1,

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 YAP negatively regulates IFN- signaling. (a) Immunoblot analysis of Yap knockdown efficiency with sh-yap (#1 to #4 independent constructs) in Raw264.7 cells. (b) IFN- -Luc and PRDs

More information

Telepathology 2/17/2011. and The Future of Pathology (or Why did we change our Practice Model) University Health Network IMAGINE3: 3 IMAGINE 2!

Telepathology 2/17/2011. and The Future of Pathology (or Why did we change our Practice Model) University Health Network IMAGINE3: 3 IMAGINE 2! Telepathology and The Future of Pathology (or Why did we change our Practice Model) Jagdish Butany, MBBS, MS, FRCPC (a)why did we implement telepathology (WSI) at UHN? Consultant Cardiovascular Pathologist/Director

More information

Recombinant Protein Expression Retroviral system

Recombinant Protein Expression Retroviral system Recombinant Protein Expression Retroviral system Viruses Contains genome DNA or RNA Genome encased in a protein coat or capsid. Some viruses have membrane covering protein coat enveloped virus Ø Essential

More information

Screening for novel oncology biomarker panels using both DNA and protein microarrays. John Anson, PhD VP Biomarker Discovery

Screening for novel oncology biomarker panels using both DNA and protein microarrays. John Anson, PhD VP Biomarker Discovery Screening for novel oncology biomarker panels using both DNA and protein microarrays John Anson, PhD VP Biomarker Discovery Outline of presentation Introduction to OGT and our approach to biomarker studies

More information

Supplementary Figure 1 IL-27 IL

Supplementary Figure 1 IL-27 IL Tim-3 Supplementary Figure 1 Tc0 49.5 0.6 Tc1 63.5 0.84 Un 49.8 0.16 35.5 0.16 10 4 61.2 5.53 10 3 64.5 5.66 10 2 10 1 10 0 31 2.22 10 0 10 1 10 2 10 3 10 4 IL-10 28.2 1.69 IL-27 Supplementary Figure 1.

More information

Session 4 Rebecca Poulos

Session 4 Rebecca Poulos The Cancer Genome Atlas (TCGA) & International Cancer Genome Consortium (ICGC) Session 4 Rebecca Poulos Prince of Wales Clinical School Introductory bioinformatics for human genomics workshop, UNSW 28

More information

Profiles of gene expression & diagnosis/prognosis of cancer. MCs in Advanced Genetics Ainoa Planas Riverola

Profiles of gene expression & diagnosis/prognosis of cancer. MCs in Advanced Genetics Ainoa Planas Riverola Profiles of gene expression & diagnosis/prognosis of cancer MCs in Advanced Genetics Ainoa Planas Riverola Gene expression profiles Gene expression profiling Used in molecular biology, it measures the

More information

Immunity & Metabolism Human Microbiome Systems Nutrition. Food Bioactives Asian Consumers

Immunity & Metabolism Human Microbiome Systems Nutrition. Food Bioactives Asian Consumers INFANT HEALTH Clare Wall, PhD, Assoc. Professor, The University of Auckland, and Martin Kussmann, PhD, Professor, The Liggins Institute, The University of Auckland. Chief Scientist HVN On behalf of the

More information

Simple, rapid, and reliable RNA sequencing

Simple, rapid, and reliable RNA sequencing Simple, rapid, and reliable RNA sequencing RNA sequencing applications RNA sequencing provides fundamental insights into how genomes are organized and regulated, giving us valuable information about the

More information

Understanding mortality from pandemic and seasonal influenza

Understanding mortality from pandemic and seasonal influenza Understanding mortality from pandemic and seasonal influenza Jonathan A. McCullers Associate Member Department of Infectious Diseases St. Jude Children s Research Hospital H1 H2 H3 H4 H5 H6 H7 H8 H9 H10

More information

The Value of Omics in Cardiovascular Research: Getting More Comfortable, More Frustrated or More Curious

The Value of Omics in Cardiovascular Research: Getting More Comfortable, More Frustrated or More Curious The Value of Omics in Cardiovascular Research: Getting More Comfortable, More Frustrated or More Curious Daniel Levy, MD Framingham Heart Study Population Sciences Branch National Heart, Lung, and Blood

More information

The Cancer Genome Atlas & International Cancer Genome Consortium

The Cancer Genome Atlas & International Cancer Genome Consortium The Cancer Genome Atlas & International Cancer Genome Consortium Session 3 Dr Jason Wong Prince of Wales Clinical School Introductory bioinformatics for human genomics workshop, UNSW 31 st July 2014 1

More information

Computational Analysis of UHT Sequences Histone modifications, CAGE, RNA-Seq

Computational Analysis of UHT Sequences Histone modifications, CAGE, RNA-Seq Computational Analysis of UHT Sequences Histone modifications, CAGE, RNA-Seq Philipp Bucher Wednesday January 21, 2009 SIB graduate school course EPFL, Lausanne ChIP-seq against histone variants: Biological

More information

Gene Ontology and Functional Enrichment. Genome 559: Introduction to Statistical and Computational Genomics Elhanan Borenstein

Gene Ontology and Functional Enrichment. Genome 559: Introduction to Statistical and Computational Genomics Elhanan Borenstein Gene Ontology and Functional Enrichment Genome 559: Introduction to Statistical and Computational Genomics Elhanan Borenstein The parsimony principle: A quick review Find the tree that requires the fewest

More information

ChIPSeq. Technique and science. The genome wide dynamics of the binding of ldb1 complexes during erythroid differentiation

ChIPSeq. Technique and science. The genome wide dynamics of the binding of ldb1 complexes during erythroid differentiation Center for Biomics ChIPSeq Technique and science The genome wide dynamics of the binding of ldb1 complexes during erythroid differentiation Wilfred van IJcken EU Sequencing Seminar Illumina June 16 Genomics

More information

Standardization of Immune Biomarkers: Lessons From the HIV Field

Standardization of Immune Biomarkers: Lessons From the HIV Field Standardization of Immune Biomarkers: Lessons From the HIV Field Alan Landay, PhD Rush University Medical Center Thomas Denny, MSc Duke University Medical Center and Viral Load Standardization Immunology

More information

The omics approach in measuring the double burden of malnutrition

The omics approach in measuring the double burden of malnutrition IAEA Headquarter, Vienna, Austria, 3-5 October 2017 Joint IAEA-WHO-UNICEF workshop on analysis of biological pathways to better understand the double burden of malnutrition and to inform action planning

More information

MERS-CoV and H5N1 influenza virus antagonize antigen presentation by altering the epigenetic landscape

MERS-CoV and H5N1 influenza virus antagonize antigen presentation by altering the epigenetic landscape MERS-CoV and H5N1 influenza virus antagonize antigen presentation by altering the epigenetic landscape Vineet D. Menachery a,b,1, Alexandra Schäfer b,1, Kristin E. Burnum-Johnson c, Hugh D. Mitchell c,

More information

Supplementary methods:

Supplementary methods: Supplementary methods: Primers sequences used in real-time PCR analyses: β-actin F: GACCTCTATGCCAACACAGT β-actin [11] R: AGTACTTGCGCTCAGGAGGA MMP13 F: TTCTGGTCTTCTGGCACACGCTTT MMP13 R: CCAAGCTCATGGGCAGCAACAATA

More information

Experimental Design for Immunologists

Experimental Design for Immunologists Experimental Design for Immunologists Hulin Wu, Ph.D., Dean s Professor Department of Biostatistics & Computational Biology Co-Director: Center for Biodefense Immune Modeling School of Medicine and Dentistry

More information

The toll-like receptor 4 ligands Mrp8 and Mrp14 play a critical role in the development of autoreactive CD8 + T cells

The toll-like receptor 4 ligands Mrp8 and Mrp14 play a critical role in the development of autoreactive CD8 + T cells 1 SUPPLEMENTARY INFORMATION The toll-like receptor 4 ligands Mrp8 and Mrp14 play a critical role in the development of autoreactive CD8 + T cells Karin Loser 1,2,6, Thomas Vogl 2,3, Maik Voskort 1, Aloys

More information

Breast cancer. Risk factors you cannot change include: Treatment Plan Selection. Inferring Transcriptional Module from Breast Cancer Profile Data

Breast cancer. Risk factors you cannot change include: Treatment Plan Selection. Inferring Transcriptional Module from Breast Cancer Profile Data Breast cancer Inferring Transcriptional Module from Breast Cancer Profile Data Breast Cancer and Targeted Therapy Microarray Profile Data Inferring Transcriptional Module Methods CSC 177 Data Warehousing

More information

Understanding Poor Vaccine Responses: Transcriptomics of Vaccine Failure

Understanding Poor Vaccine Responses: Transcriptomics of Vaccine Failure Final Report - Summer Research Project 1 Introduction Understanding Poor Vaccine Responses: Transcriptomics of Vaccine Failure Katherine Miller, Year 3, Dalhousie University (Supervisor: Dr. Lisa Barrett,

More information

TITLE: Total RNA Sequencing Analysis of DCIS Progressing to Invasive Breast Cancer.

TITLE: Total RNA Sequencing Analysis of DCIS Progressing to Invasive Breast Cancer. AWARD NUMBER: W81XWH-14-1-0080 TITLE: Total RNA Sequencing Analysis of DCIS Progressing to Invasive Breast Cancer. PRINCIPAL INVESTIGATOR: Christopher B. Umbricht, MD, PhD CONTRACTING ORGANIZATION: Johns

More information

7.012 Quiz 3 Answers

7.012 Quiz 3 Answers MIT Biology Department 7.012: Introductory Biology - Fall 2004 Instructors: Professor Eric Lander, Professor Robert A. Weinberg, Dr. Claudette Gardel Friday 11/12/04 7.012 Quiz 3 Answers A > 85 B 72-84

More information

Supplementary Figure 1. SC35M polymerase activity in the presence of Bat or SC35M NP encoded from the phw2000 rescue plasmid.

Supplementary Figure 1. SC35M polymerase activity in the presence of Bat or SC35M NP encoded from the phw2000 rescue plasmid. 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 Supplementary Figure 1. SC35M polymerase activity in the presence of Bat or SC35M NP encoded from the phw2000 rescue plasmid. HEK293T

More information

BIOMARKERS IN SEPSIS: DO THEY REALLY GUIDE US? Asist. Prof. M.D. Mehmet Akif KARAMERCAN Gazi University School of Medicine Depertment of Emergency

BIOMARKERS IN SEPSIS: DO THEY REALLY GUIDE US? Asist. Prof. M.D. Mehmet Akif KARAMERCAN Gazi University School of Medicine Depertment of Emergency BIOMARKERS IN SEPSIS: DO THEY REALLY GUIDE US? Asist. Prof. M.D. Mehmet Akif KARAMERCAN Gazi University School of Medicine Depertment of Emergency Medicine 1 NO CONFLICT OF INTEREST 2 We do not fully understand

More information

Transcriptional control in Eukaryotes: (chapter 13 pp276) Chromatin structure affects gene expression. Chromatin Array of nuc

Transcriptional control in Eukaryotes: (chapter 13 pp276) Chromatin structure affects gene expression. Chromatin Array of nuc Transcriptional control in Eukaryotes: (chapter 13 pp276) Chromatin structure affects gene expression Chromatin Array of nuc 1 Transcriptional control in Eukaryotes: Chromatin undergoes structural changes

More information

Supplementary Information Titles Journal: Nature Medicine

Supplementary Information Titles Journal: Nature Medicine Supplementary Information Titles Journal: Nature Medicine Article Title: Corresponding Author: Supplementary Item & Number Supplementary Fig.1 Fig.2 Fig.3 Fig.4 Fig.5 Fig.6 Fig.7 Fig.8 Fig.9 Fig. Fig.11

More information

Lahore University of Management Sciences. BIO314 Virology and Microbiology (Spring 2015)

Lahore University of Management Sciences. BIO314 Virology and Microbiology (Spring 2015) BIO314 Virology and Microbiology (Spring 2015) Instructor Room. Office Hours Email Telephone Secretary/TA TA Office Hours Course URL (if any) Shaper Mirza and Sadia Hamera Shaper.Mirza@uth.tmc.edu Course

More information

University of Pittsburgh Cancer Institute UPMC CancerCenter. Uma Chandran, MSIS, PhD /21/13

University of Pittsburgh Cancer Institute UPMC CancerCenter. Uma Chandran, MSIS, PhD /21/13 University of Pittsburgh Cancer Institute UPMC CancerCenter Uma Chandran, MSIS, PhD chandran@pitt.edu 412-648-9326 2/21/13 University of Pittsburgh Cancer Institute Founded in 1985 Director Nancy Davidson,

More information

Nature Immunology: doi: /ni Supplementary Figure 1. Production of cytokines and chemokines after vaginal HSV-2 infection.

Nature Immunology: doi: /ni Supplementary Figure 1. Production of cytokines and chemokines after vaginal HSV-2 infection. Supplementary Figure 1 Production of cytokines and chemokines after vaginal HSV-2 infection. C57BL/6 mice were (a) treated intravaginally with 20 µl of PBS or infected with 6.7x10 4 pfu of HSV-2 in the

More information

The development and function of immune cells

The development and function of immune cells The development and function of immune cells Our research focusses on the development and function of immune cells. For cells to develop and carry out their jobs properly, instructions must be read and

More information

Clinical Development of ABX464, drug candidate for HIV Functional Cure. Chief Medical Officer ABIVAX

Clinical Development of ABX464, drug candidate for HIV Functional Cure. Chief Medical Officer ABIVAX Clinical Development of ABX464, drug candidate for HIV Functional Cure Jean-Marc Steens, MD Chief Medical Officer ABIVAX 1 DECLARATION OF CONFLICT OF INTEREST GSK ABIVAX 2 ABX464: Mechanism of Action ABX464

More information

Molecular Heterogeneity of High Gleason Prostate Cancer

Molecular Heterogeneity of High Gleason Prostate Cancer Molecular Heterogeneity of High Gleason Prostate Cancer Aliccia Bollig-Fischer, PhD Assistant Professor Department of Oncology Karmanos Cancer Institute Wayne State University Detroit, Michigan, USA Disclosure

More information

Supplementary Figure 1. Prevalence of U539C and G540A nucleotide and E172K amino acid substitutions among H9N2 viruses. Full-length H9N2 NS

Supplementary Figure 1. Prevalence of U539C and G540A nucleotide and E172K amino acid substitutions among H9N2 viruses. Full-length H9N2 NS Supplementary Figure 1. Prevalence of U539C and G540A nucleotide and E172K amino acid substitutions among H9N2 viruses. Full-length H9N2 NS nucleotide sequences (a, b) or amino acid sequences (c) from

More information

Bjoern Peters La Jolla Institute for Allergy and Immunology Buenos Aires, Oct 31, 2012

Bjoern Peters La Jolla Institute for Allergy and Immunology Buenos Aires, Oct 31, 2012 www.iedb.org Bjoern Peters bpeters@liai.org La Jolla Institute for Allergy and Immunology Buenos Aires, Oct 31, 2012 Overview 1. Introduction to the IEDB 2. Application: 2009 Swine-origin influenza virus

More information

University of Pittsburgh Annual Progress Report: 2008 Formula Grant

University of Pittsburgh Annual Progress Report: 2008 Formula Grant University of Pittsburgh Annual Progress Report: 2008 Formula Grant Reporting Period July 1, 2011 June 30, 2012 Research Project 1: Project Title and Purpose Small Molecule Inhibitors of HIV Nef Signaling

More information

NGS in Cancer Pathology After the Microscope: From Nucleic Acid to Interpretation

NGS in Cancer Pathology After the Microscope: From Nucleic Acid to Interpretation NGS in Cancer Pathology After the Microscope: From Nucleic Acid to Interpretation Michael R. Rossi, PhD, FACMG Assistant Professor Division of Cancer Biology, Department of Radiation Oncology Department

More information

Index. Index 439. Aequorin, 84, 94 Affinity precipitation, 372, AP-1, 100 Asthma, 170, 305

Index. Index 439. Aequorin, 84, 94 Affinity precipitation, 372, AP-1, 100 Asthma, 170, 305 Index 439 Index A Aequorin, 84, 94 Affinity precipitation, 372, 376 381 AP-1, 100 Asthma, 170, 305 B Bioassay, 185, comparison with ELISA, 318 GM-CSF bioassay, 351 IL-2 bioassay, 185 192, 300 IL-3 IL-6

More information

Nationwide Children s Hospital Biospecimen Core Resource Training

Nationwide Children s Hospital Biospecimen Core Resource Training Nationwide Children s Hospital Biospecimen Core Resource Training Team Science: A Collaboration in Medical Genomics Sponsored by the National Cancer Institute, the National Institutes of Health Nationwide

More information

Influenza A Virus Environmental Contamination in Exhibition Swine Settings

Influenza A Virus Environmental Contamination in Exhibition Swine Settings Influenza A Virus Environmental Contamination in Exhibition Swine Settings Jacqueline M. Nolting, Sarah E. Lauterbach, Courtney Wright, Alison Martin, and Andrew S. Bowman Acknowledgements UNIT ID HERE

More information

Influenza Virus HA Subtype Numbering Conversion Tool and the Identification of Candidate Cross-Reactive Immune Epitopes

Influenza Virus HA Subtype Numbering Conversion Tool and the Identification of Candidate Cross-Reactive Immune Epitopes Influenza Virus HA Subtype Numbering Conversion Tool and the Identification of Candidate Cross-Reactive Immune Epitopes Brian J. Reardon, Ph.D. J. Craig Venter Institute breardon@jcvi.org Introduction:

More information

4. Th1-related gene expression in infected versus mock-infected controls from Fig. 2 with gene annotation.

4. Th1-related gene expression in infected versus mock-infected controls from Fig. 2 with gene annotation. List of supplemental information 1. Graph of mouse weight loss during course of infection- Line graphs showing mouse weight data during course of infection days 1 to 10 post-infections (p.i.). 2. Graph

More information

DNA-seq Bioinformatics Analysis: Copy Number Variation

DNA-seq Bioinformatics Analysis: Copy Number Variation DNA-seq Bioinformatics Analysis: Copy Number Variation Elodie Girard elodie.girard@curie.fr U900 institut Curie, INSERM, Mines ParisTech, PSL Research University Paris, France NGS Applications 5C HiC DNA-seq

More information

Viral Genetics. BIT 220 Chapter 16

Viral Genetics. BIT 220 Chapter 16 Viral Genetics BIT 220 Chapter 16 Details of the Virus Classified According to a. DNA or RNA b. Enveloped or Non-Enveloped c. Single-stranded or double-stranded Viruses contain only a few genes Reverse

More information

Lahore University of Management Sciences. BIO 314- Microbiology and Virology (Spring 2018)

Lahore University of Management Sciences. BIO 314- Microbiology and Virology (Spring 2018) BIO 314- Microbiology and Virology (Spring 2018) Instructor Shaper Mirza Room No. 9-318A Office Hours TBA Email Shaper.Mirza@uth.tmc.edu ; shaper.mirza@lums.edu.pk Telephone 8413 Secretary/TA No TA Office

More information

Laboratory Considerations

Laboratory Considerations Laboratory Considerations In Support of HPV Vaccine Programs Elizabeth R. Unger PhD, MD Team Leader HPV Laboratory Centers for Disease Prevention and Control Towards Comprehensive Cervical Cancer Control:

More information

Development and Application of an Enteric Pathogens Microarray

Development and Application of an Enteric Pathogens Microarray Development and Application of an Enteric Pathogens Microarray UC Berkeley School of Public Health Sona R. Saha, MPH Joseph Eisenberg, PhD Lee Riley, MD Alan Hubbard, PhD Jack Colford, MD PhD East Bay

More information

a) List of KMTs targeted in the shrna screen. The official symbol, KMT designation,

a) List of KMTs targeted in the shrna screen. The official symbol, KMT designation, Supplementary Information Supplementary Figures Supplementary Figure 1. a) List of KMTs targeted in the shrna screen. The official symbol, KMT designation, gene ID and specifities are provided. Those highlighted

More information

An epigenetic approach to understanding (and predicting?) environmental effects on gene expression

An epigenetic approach to understanding (and predicting?) environmental effects on gene expression www.collaslab.com An epigenetic approach to understanding (and predicting?) environmental effects on gene expression Philippe Collas University of Oslo Institute of Basic Medical Sciences Stem Cell Epigenetics

More information

Supplementary Figure 1 IMQ-Induced Mouse Model of Psoriasis. IMQ cream was

Supplementary Figure 1 IMQ-Induced Mouse Model of Psoriasis. IMQ cream was Supplementary Figure 1 IMQ-Induced Mouse Model of Psoriasis. IMQ cream was painted on the shaved back skin of CBL/J and BALB/c mice for consecutive days. (a, b) Phenotypic presentation of mouse back skin

More information

Service and Collaboration

Service and Collaboration Summary Section 7 Introduction 68 Exosome and Microvesicle Isolation 69 EV protein quantification, sceening and profiling 69 Nanoparticle Tracking Analysis (NTA) 70 EV Nucleic Acid isolation 70 Nucleic

More information

Mass Spectrometry based metabolomics

Mass Spectrometry based metabolomics Mass Spectrometry based metabolomics Metabolomics- A realm of small molecules (

More information

Supplementary Figure 1. Using DNA barcode-labeled MHC multimers to generate TCR fingerprints

Supplementary Figure 1. Using DNA barcode-labeled MHC multimers to generate TCR fingerprints Supplementary Figure 1 Using DNA barcode-labeled MHC multimers to generate TCR fingerprints (a) Schematic overview of the workflow behind a TCR fingerprint. Each peptide position of the original peptide

More information

Overview: Chapter 19 Viruses: A Borrowed Life

Overview: Chapter 19 Viruses: A Borrowed Life Overview: Chapter 19 Viruses: A Borrowed Life Viruses called bacteriophages can infect and set in motion a genetic takeover of bacteria, such as Escherichia coli Viruses lead a kind of borrowed life between

More information

INDIVIDUALIZED MEDICINE

INDIVIDUALIZED MEDICINE CENTER FOR INDIVIDUALIZED MEDICINE Precision Oncology: Current Applications of omics ACP Arizona Chapter Scientific Meeting, 2014 Arizona State University in Tempe, Arizona Alan Bryce, MD 2012 MFMER slide-1

More information

Single-cell analysis tools for drug discovery and development

Single-cell analysis tools for drug discovery and development Single-cell analysis tools for drug discovery and development James R. Heath 1, Antoni Ribas 2 and Paul S. Mischel 3 Abstract The genetic, functional or compositional heterogeneity of healthy and diseased

More information

Weekly NIH Funding Opportunities and Notices NIH Guide for Grants and Contracts Table of Contents (TOC)

Weekly NIH Funding Opportunities and Notices NIH Guide for Grants and Contracts Table of Contents (TOC) Weekly NIH Funding Opportunities and Notices NIH Guide for Grants and Contracts 08-24-2018 Table of Contents (TOC) Notices Notice of Webinar for PAR 18 307 "Developing Interventions for Health Enhancing

More information

Neli Ulrich, MS, PhD Huntsman Cancer Institute, Salt Lake City Using Genetics and Metabolomics to Advance Precision Prevention

Neli Ulrich, MS, PhD Huntsman Cancer Institute, Salt Lake City Using Genetics and Metabolomics to Advance Precision Prevention Neli Ulrich, MS, PhD Huntsman Cancer Institute, Salt Lake City Using Genetics and Metabolomics to Advance Precision Prevention February 3-5, 2016 Lansdowne Resort, Leesburg, VA Three Highlights Aspirin

More information

The UK s National Collection of Type Cultures: Answers to 21 st century public health questions

The UK s National Collection of Type Cultures: Answers to 21 st century public health questions The UK s National Collection of Type Cultures: Answers to 21 st century public health questions Julie E. Russell Head of Culture Collections 28 th September 2016 Public Health England (PHE) Executive agency

More information

Comparison of open chromatin regions between dentate granule cells and other tissues and neural cell types.

Comparison of open chromatin regions between dentate granule cells and other tissues and neural cell types. Supplementary Figure 1 Comparison of open chromatin regions between dentate granule cells and other tissues and neural cell types. (a) Pearson correlation heatmap among open chromatin profiles of different

More information

Metabolomics: quantifying the phenotype

Metabolomics: quantifying the phenotype Metabolomics: quantifying the phenotype Metabolomics Promises Quantitative Phenotyping What can happen GENOME What appears to be happening Bioinformatics TRANSCRIPTOME What makes it happen PROTEOME Systems

More information

INDIVIDUALIZED MEDICINE

INDIVIDUALIZED MEDICINE Genomics in Oncology CENTER FOR INDIVIDUALIZED MEDICINE Alan Bryce, MD American College of Osteopathic Internists October 9-13, 2013 Renaissance Esmeralda Resort and Spa, Indian Wells, CA 2012 MFMER slide-1

More information

Nature Immunology: doi: /ni Supplementary Figure 1. Gene expression profile of CD4 + T cells and CTL responses in Bcl6-deficient mice.

Nature Immunology: doi: /ni Supplementary Figure 1. Gene expression profile of CD4 + T cells and CTL responses in Bcl6-deficient mice. Supplementary Figure 1 Gene expression profile of CD4 + T cells and CTL responses in Bcl6-deficient mice. (a) Gene expression profile in the resting CD4 + T cells were analyzed by an Affymetrix microarray

More information

Developing Understanding of CMI. Dr Tom Wilkinson Associate Professor of Respiratory Medicine Faculty of Medicine University of Southampton UK

Developing Understanding of CMI. Dr Tom Wilkinson Associate Professor of Respiratory Medicine Faculty of Medicine University of Southampton UK Pre-existing influenza-specific CD4+ T cells correlate with homologous and heterotypic response and disease protection against influenza challenge in humans Do At Risk Groups Rely more on CMI to Viruses?

More information

ChipSeq. Technique and science. The genome wide dynamics of the binding of ldb1 complexes during erythroid differentiation

ChipSeq. Technique and science. The genome wide dynamics of the binding of ldb1 complexes during erythroid differentiation Center for Biomics ChipSeq Technique and science The genome wide dynamics of the binding of ldb1 complexes during erythroid differentiation Wilfred van IJcken Sequencing Seminar Illumina September 8 Scheme

More information