The value of Omics to chemical risk assessment
|
|
|
- Tabitha Cameron
- 5 years ago
- Views:
Transcription
1 The value of Omics to chemical risk assessment Timothy W Gant There is a focus on transcriptomics in this talk but for example only. All omics are useful in risk assessment
2 Outline What are we aiming to achieve? Hazard and read across v Biomarkers Outcomes The challenge of bioinformatics v v v What is omics and systems toxicology? Modes of Action and critical points Exposure A Personal risk assessment 2 EFSA April 24 th 2018
3 What do we want to achieve? 3 EFSA April 24 th 2018
4 What is omics? A collection of tools characterised by their ability to measure many constituents of a biological family in concurrently Genomics: large scale study of the genome including transcription, translation and DNA changes such as mutations, amplifications, deletions, and epigenetic changes. Proteomics: large scale analysis of protein expression, in particular differential protein expression resulting from biochemical, physiological or pathological change. Metabolomics: The discernment of chemical footprints in tissues or body fluids resulting from biochemical, physiological or pathological change. 4 EFSA April 24 th 2018
5 Omics application in the cell 5 EFSA April 24 th 2018
6 Financial Times; January 12, EFSA April 24 th 2018
7 Systems toxicology Systems biology is the integration of genomics, transcriptomics, proteomics, and metabolomics together with computer technology. Systems toxicology is all of this applied to understanding toxicity particularly pathways from exposure to outcome. 7 EFSA April 24 th 2018
8 Application to Toxicology dc dt Bioinformatics 8 EFSA April 24 th 2018
9 Hazards and Read Across - Using pathways for Grouping and Hazard identification Agonists Antagonists Zhang and Gant BMC Bioinformatics (2008) 9 EFSA April 24 th 2018
10 UVCBs Oil products are identified by their CAS number manufacturing stream, and physico-chemical parameters such as energy density, boiling and freezing points. 10 EFSA April 24 th 2018
11 Connection strength (%) Read Across Gossypol Rottlerin Gossypol /Rottlerin Gossypol Rottlerin Ivermectin Ivermectin Ivermectin Mefloquine Thapsigargin Rottlerin Gossypol Ivermectin, mefloquine and thapsigargin are all insecticides or antiparasitics. Mefloquine and Thapsigargin are used in malaria treatment Pyrvinium Gossypol Benzamil Fluphenazine Niclosamide Dequlinium Chloirde 11 EFSA April 24 th 2018
12 Hazard new end points Chemical New high throughput technologies give the opportunity to measure more end points; the challenge is that it is not always clear what constitutes adversity and what is homeostasic response 12 EFSA April 24 th 2018
13 Understanding pathways to discern risk Epidemiology/Toxicity Testing Exposure Outcome Pathway Toxicology Exposure Toxicology Model toxicology Toxicodynamics Adverse outcome toxicology Adapted from thoughts of Dan Costa US EPA/ORD 13 EFSA April 24 th 2018
14 Hazard Critical points? 14 EFSA April 24 th 2018
15 MOAs and AOPs MOAs and AOPs are conceptually similar AOP and MOAs are very similar but have one molecular initiating event (MIE) in the pathway linked to one exposure type and outcome the same MIE can be reused for other outcomes. Both are a linear sequence of key events connecting one exposure to one outcome MOAs can take into account modifying factors; AOP don t AOPs are generic; MOAs are for one chemical. 15 EFSA April 24 th 2018
16 Biomarkers T Gant. E Marczylo, M Leonard : Discovery and Application of Novel Biomarkers, in Predictive Toxicology Vision to reality Eds. Pfannkuch F and Suter-Dick L. Wiley (2014) 16 EFSA April 24 th 2018
17 Release of mirnas from tissues Illustration credit: Cosmocyte/Ben Smith 17 EFSA April 24 th 2018
18 mirnas in plasma and smoking status 18 EFSA April 24 th 2018
19 Small RNA species in sperm 19 EFSA April 24 th 2018
20 Fold change mirna biomarkers in sperm Smoking induced changes in the mirna content of human sperm (28, top 5 ): mirna Fold Change p value mir mir mir mir mir mirna Fold Change p value mir-146b-5p mir mir-129-3p mir mir p mir-340 ** mir-365 ** mir-129-3p mir-634 * *** Spermatozoal RNA (Non-smoker) Spermatozoal RNA (Smoker) 20 EFSA April 24 th 2018
21 Exposure environmental microbiome 21 EFSA April 24 th 2018
22 Microbiome 16 S region is the ribosomal subunit region of bacteria Purify DNA from bacterial sample PCR amplify across the 16S region using a conserved primer set and tags Sequence PCR products Compare to database Identify bacterial species 22 EFSA April 24 th 2018
23 Exposure - Fingerprints in DNA I was here 23 EFSA April 24 th 2018
24 Methylation Repressive Non - Repressive 24 EFSA April 24 th 2018
25 Arsenic metabolism DMA MMA The metabolism of As can deplete the cells of S-adenosyl-Methioinine leading to methylation changes 25 EFSA April 24 th 2018
26 Arsenic effects on cell methylation 26 EFSA April 24 th 2018
27 27 EFSA April 24 th 2018
28 Outcomes - Fertilisation, methylation and early life 28 EFSA April 24 th 2018
29 Gamete formation 29 EFSA April 24 th 2018
30 WT_FH_HET WT_FH_HOM BALB Day 1 BALB Day 3 BALB Day 5 BALB Day 8 BALB Day 15 BALB Day 22 Day1_C57 Day3_C57 Day5_C57 Day8_C57 Day15_C57 Day22_C57 Anit day 2 Anit day 6 Et743_6hr Et743_1day Et743_2day Et743_3day Et743_6day Et743_24day Log 2 Ratio Outcomes - Phenotypic anchoring Col4a1 Col1a1 Col6a1 Col3a1 4X 2X Phenotypic anchoring increase expression of collagen genes can be associated with fibrosis in the liver. 30 EFSA April 24 th 2018
31 CTRL DE 0.5 DE 2 DE 20 CTRL DE 0.5 DE 2 DE 20 CTRL DE 0.5 DE 2 DE 20 mrna F.O.C. mrna F.O.C. RNA-SEQ Outcomes - Phenotype changes in diesel particulate exposure ST2L SERPINB2 CXCL10 IFIT Th2 / ILC2 Th Ministry of Public Health; Thailand 31 EFSA April 24 th 2018
32 Personal risk - ArrayCGH Control Genomic DNA DPN II Digested DNA Cy-3 dctp Labelled DNA Hybridise Sample Genomic DNA DPN II Digested DNA Cy-5 dctp Labelled DNA cdna Microarray 32 EFSA April 24 th 2018
33 Can also show where the mutation arose No indication of the same deletion in parents of affected individual 103 suggests the deletion is a de novo. Sharp AJ et al Nature Genetics 38(9), 1038 (2006) 33 EFSA April 24 th 2018
34 Factors affecting personal risk All addressable with Omics 34 EFSA April 24 th 2018
35 Omics is useful at all cellular response levels Biological inputs Chemical or radiation source Fate/Transport Exposure Tissue dose Biological Interaction Perturbation Adaptive responses A new state of normal Normal Physiology Homeostatic capacity Early Cell Changes Morbidity pathways Cell Injury 35 EFSA April 24 th 2018
36 The challenge of bioinformatics PND30-40 PND83 ADI LOAEL 36 EFSA April 24 th 2018
37 The data issue Plot first used in Lu et al; Nature (2005); 435, 834 (supplementary). 37 EFSA April 24 th 2018
38 The reference method Data (type) Log Normalisation within dataset only Mean of technical replicates Welch t-test between pairs for significance How to recognise outlier data sets? How to deal with low signal strength? Background subtraction? Type of normalisation and why not between data sets? Welch (deals with unequal variance better than Students t-test) A fold change of 1.5 and p value of p<0.05 should be used as a cut-off 38 EFSA April 24 th 2018
39 39 EFSA April 24 th 2018
40 21 Century Toxicology 40 EFSA April 24 th 2018
41 Does omics have value to chemical risk assessment? Yes; with care 41 EFSA April 24 th 2018
genomics for systems biology / ISB2020 RNA sequencing (RNA-seq)
RNA sequencing (RNA-seq) Module Outline MO 13-Mar-2017 RNA sequencing: Introduction 1 WE 15-Mar-2017 RNA sequencing: Introduction 2 MO 20-Mar-2017 Paper: PMID 25954002: Human genomics. The human transcriptome
Analysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers
Analysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers Gordon Blackshields Senior Bioinformatician Source BioScience 1 To Cancer Genetics Studies
Effects of UBL5 knockdown on cell cycle distribution and sister chromatid cohesion
Supplementary Figure S1. Effects of UBL5 knockdown on cell cycle distribution and sister chromatid cohesion A. Representative examples of flow cytometry profiles of HeLa cells transfected with indicated
Profiles of gene expression & diagnosis/prognosis of cancer. MCs in Advanced Genetics Ainoa Planas Riverola
Profiles of gene expression & diagnosis/prognosis of cancer MCs in Advanced Genetics Ainoa Planas Riverola Gene expression profiles Gene expression profiling Used in molecular biology, it measures the
Iso-Seq Method Updates and Target Enrichment Without Amplification for SMRT Sequencing
Iso-Seq Method Updates and Target Enrichment Without Amplification for SMRT Sequencing PacBio Americas User Group Meeting Sample Prep Workshop June.27.2017 Tyson Clark, Ph.D. For Research Use Only. Not
Deciphering multiple stressor effects of gamma radiation and uranium on Atlantic salmon (Salmo salar): Transcriptomics-based mixture modeling
Deciphering multiple stressor effects of gamma radiation and uranium on Atlantic salmon (Salmo salar): Transcriptomics-based mixture modeling Y. Song, J. Asselman, K.A.C. De Schamphelaere, B. Salbu, and
Computer Science, Biology, and Biomedical Informatics (CoSBBI) Outline. Molecular Biology of Cancer AND. Goals/Expectations. David Boone 7/1/2015
Goals/Expectations Computer Science, Biology, and Biomedical (CoSBBI) We want to excite you about the world of computer science, biology, and biomedical informatics. Experience what it is like to be a
HALLA KABAT * Outreach Program, mircore, 2929 Plymouth Rd. Ann Arbor, MI 48105, USA LEO TUNKLE *
CERNA SEARCH METHOD IDENTIFIED A MET-ACTIVATED SUBGROUP AMONG EGFR DNA AMPLIFIED LUNG ADENOCARCINOMA PATIENTS HALLA KABAT * Outreach Program, mircore, 2929 Plymouth Rd. Ann Arbor, MI 48105, USA Email:
Next-Generation Sequencing in Toxic Tort Litigation
Next-Generation Sequencing in Toxic Tort Litigation An ArrayXpress White Paper. 4 Dec 2014 A Primer Presented by ArrayXpress, Inc. ArrayXpress (AX) has produced a series of white papers on specific applications
Lentiviral Delivery of Combinatorial mirna Expression Constructs Provides Efficient Target Gene Repression.
Supplementary Figure 1 Lentiviral Delivery of Combinatorial mirna Expression Constructs Provides Efficient Target Gene Repression. a, Design for lentiviral combinatorial mirna expression and sensor constructs.
Generating Spontaneous Copy Number Variants (CNVs) Jennifer Freeman Assistant Professor of Toxicology School of Health Sciences Purdue University
Role of Chemical lexposure in Generating Spontaneous Copy Number Variants (CNVs) Jennifer Freeman Assistant Professor of Toxicology School of Health Sciences Purdue University CNV Discovery Reference Genetic
Breast cancer. Risk factors you cannot change include: Treatment Plan Selection. Inferring Transcriptional Module from Breast Cancer Profile Data
Breast cancer Inferring Transcriptional Module from Breast Cancer Profile Data Breast Cancer and Targeted Therapy Microarray Profile Data Inferring Transcriptional Module Methods CSC 177 Data Warehousing
A novel and universal method for microrna RT-qPCR data normalization
A novel and universal method for microrna RT-qPCR data normalization Jo Vandesompele professor, Ghent University co-founder and CEO, Biogazelle 4 th International qpcr Symposium Weihenstephan, March 1,
Nature Genetics: doi: /ng Supplementary Figure 1. Assessment of sample purity and quality.
Supplementary Figure 1 Assessment of sample purity and quality. (a) Hematoxylin and eosin staining of formaldehyde-fixed, paraffin-embedded sections from a human testis biopsy collected concurrently with
7SK ChIRP-seq is specifically RNA dependent and conserved between mice and humans.
Supplementary Figure 1 7SK ChIRP-seq is specifically RNA dependent and conserved between mice and humans. Regions targeted by the Even and Odd ChIRP probes mapped to a secondary structure model 56 of the
Set the stage: Genomics technology. Jos Kleinjans Dept of Toxicogenomics Maastricht University, the Netherlands
Set the stage: Genomics technology Jos Kleinjans Dept of Toxicogenomics Maastricht University, the Netherlands Amendment to the latest consolidated version of the REACH legislation REACH Regulation 1907/2006:
SUPPLEMENTARY FIGURES
SUPPLEMENTARY FIGURES Figure S1. Clinical significance of ZNF322A overexpression in Caucasian lung cancer patients. (A) Representative immunohistochemistry images of ZNF322A protein expression in tissue
Genome Editing Research for Translational Toxicology Solutions
Genome Editing Research for Translational Toxicology Solutions REBECCA FRY, PH.D. Carol Remmer Angle Distinguished Professor and Associate Chair Director, UNC Superfund Research Program Director, Graduate
Accessing and Using ENCODE Data Dr. Peggy J. Farnham
1 William M Keck Professor of Biochemistry Keck School of Medicine University of Southern California How many human genes are encoded in our 3x10 9 bp? C. elegans (worm) 959 cells and 1x10 8 bp 20,000
MicroRNA and Male Infertility: A Potential for Diagnosis
Review Article MicroRNA and Male Infertility: A Potential for Diagnosis * Abstract MicroRNAs (mirnas) are small non-coding single stranded RNA molecules that are physiologically produced in eukaryotic
Experimental Design For Microarray Experiments. Robert Gentleman, Denise Scholtens Arden Miller, Sandrine Dudoit
Experimental Design For Microarray Experiments Robert Gentleman, Denise Scholtens Arden Miller, Sandrine Dudoit Copyright 2002 Complexity of Genomic data the functioning of cells is a complex and highly
Supplemental Data. Integrating omics and alternative splicing i reveals insights i into grape response to high temperature
Supplemental Data Integrating omics and alternative splicing i reveals insights i into grape response to high temperature Jianfu Jiang 1, Xinna Liu 1, Guotian Liu, Chonghuih Liu*, Shaohuah Li*, and Lijun
Raymond Auerbach PhD Candidate, Yale University Gerstein and Snyder Labs August 30, 2012
Elucidating Transcriptional Regulation at Multiple Scales Using High-Throughput Sequencing, Data Integration, and Computational Methods Raymond Auerbach PhD Candidate, Yale University Gerstein and Snyder
A Practical Guide to Integrative Genomics by RNA-seq and ChIP-seq Analysis
A Practical Guide to Integrative Genomics by RNA-seq and ChIP-seq Analysis Jian Xu, Ph.D. Children s Research Institute, UTSW Introduction Outline Overview of genomic and next-gen sequencing technologies
Obstacles and challenges in the analysis of microrna sequencing data
Obstacles and challenges in the analysis of microrna sequencing data (mirna-seq) David Humphreys Genomics core Dr Victor Chang AC 1936-1991, Pioneering Cardiothoracic Surgeon and Humanitarian The ABCs
Simple, rapid, and reliable RNA sequencing
Simple, rapid, and reliable RNA sequencing RNA sequencing applications RNA sequencing provides fundamental insights into how genomes are organized and regulated, giving us valuable information about the
a) List of KMTs targeted in the shrna screen. The official symbol, KMT designation,
Supplementary Information Supplementary Figures Supplementary Figure 1. a) List of KMTs targeted in the shrna screen. The official symbol, KMT designation, gene ID and specifities are provided. Those highlighted
Session 2: Biomarkers of epigenetic changes and their applicability to genetic toxicology
Session 2: Biomarkers of epigenetic changes and their applicability to genetic toxicology Bhaskar Gollapudi, Ph.D The Dow Chemical Company Workshop: Genetic Toxicology: Opportunities to Integrate New Approaches
Biomarker development in the era of precision medicine. Bei Li, Interdisciplinary Technical Journal Club
Biomarker development in the era of precision medicine Bei Li, 23.08.2016 Interdisciplinary Technical Journal Club The top ten highest-grossing drugs in the United States help between 1 in 25 and 1 in
A Statistical Framework for Classification of Tumor Type from microrna Data
DEGREE PROJECT IN MATHEMATICS, SECOND CYCLE, 30 CREDITS STOCKHOLM, SWEDEN 2016 A Statistical Framework for Classification of Tumor Type from microrna Data JOSEFINE RÖHSS KTH ROYAL INSTITUTE OF TECHNOLOGY
Nature vs nurture: Epigenetics
Nature vs nurture: Epigenetics What is epigenetics? Epigenetic processes control whether a gene is switched on or off (gene expression), without altering the underlying DNA sequence They include modifications
Distinguishing between Mode and Mechanism of Action
Distinguishing between Mode and Mechanism of Action Michael Dourson Toxicology Excellence for Risk Assessment Center University of Cincinnati College of Medicine Conflict of Interest Statement The research
Cellecta Overview. Started Operations in 2007 Headquarters: Mountain View, CA
Cellecta Overview Started Operations in 2007 Headquarters: Mountain View, CA Focus: Development of flexible, scalable, and broadly parallel genetic screening assays to expedite the discovery and characterization
NGS in Cancer Pathology After the Microscope: From Nucleic Acid to Interpretation
NGS in Cancer Pathology After the Microscope: From Nucleic Acid to Interpretation Michael R. Rossi, PhD, FACMG Assistant Professor Division of Cancer Biology, Department of Radiation Oncology Department
RASA: Robust Alternative Splicing Analysis for Human Transcriptome Arrays
Supplementary Materials RASA: Robust Alternative Splicing Analysis for Human Transcriptome Arrays Junhee Seok 1*, Weihong Xu 2, Ronald W. Davis 2, Wenzhong Xiao 2,3* 1 School of Electrical Engineering,
RNA-seq Introduction
RNA-seq Introduction DNA is the same in all cells but which RNAs that is present is different in all cells There is a wide variety of different functional RNAs Which RNAs (and sometimes then translated
Genes, Aging and Skin. Helen Knaggs Vice President, Nu Skin Global R&D
Genes, Aging and Skin Helen Knaggs Vice President, Nu Skin Global R&D Presentation Overview Skin aging Genes and genomics How do genes influence skin appearance? Can the use of Genomic Technology enable
Screening for novel oncology biomarker panels using both DNA and protein microarrays. John Anson, PhD VP Biomarker Discovery
Screening for novel oncology biomarker panels using both DNA and protein microarrays John Anson, PhD VP Biomarker Discovery Outline of presentation Introduction to OGT and our approach to biomarker studies
Paternal exposure and effects on microrna and mrna expression in developing embryo. Department of Chemical and Radiation Nur Duale
Paternal exposure and effects on microrna and mrna expression in developing embryo Department of Chemical and Radiation Nur Duale Our research question Can paternal preconceptional exposure to environmental
Supplementary Figure 1
Supplementary Figure 1 Asymmetrical function of 5p and 3p arms of mir-181 and mir-30 families and mir-142 and mir-154. (a) Control experiments using mirna sensor vector and empty pri-mirna overexpression
Selective depletion of abundant RNAs to enable transcriptome analysis of lowinput and highly-degraded RNA from FFPE breast cancer samples
DNA CLONING DNA AMPLIFICATION & PCR EPIGENETICS RNA ANALYSIS Selective depletion of abundant RNAs to enable transcriptome analysis of lowinput and highly-degraded RNA from FFPE breast cancer samples LIBRARY
Molecular Biology (BIOL 4320) Exam #2 May 3, 2004
Molecular Biology (BIOL 4320) Exam #2 May 3, 2004 Name SS# This exam is worth a total of 100 points. The number of points each question is worth is shown in parentheses after the question number. Good
Refining Prognosis of Early Stage Lung Cancer by Molecular Features (Part 2): Early Steps in Molecularly Defined Prognosis
5/17/13 Refining Prognosis of Early Stage Lung Cancer by Molecular Features (Part 2): Early Steps in Molecularly Defined Prognosis Johannes Kratz, MD Post-doctoral Fellow, Thoracic Oncology Laboratory
Central Dogma. Central Dogma. Translation (mrna -> protein)
Central Dogma Central Dogma Translation (mrna -> protein) mrna code for amino acids 1. Codons as Triplet code 2. Redundancy 3. Open reading frames 4. Start and stop codons 5. Mistakes in translation 6.
Genetics/Genomics: role of genes in diagnosis and/risk and in personalised medicine
Genetics/Genomics: role of genes in diagnosis and/risk and in personalised medicine Lynn Greenhalgh, Macmillan Cancer and General Clinical Geneticist Cancer Genetics Service Cancer is common 1 in
The potential impact of toxicogenomics on modern chemical risk assessment 3-MCPD and 3-MCPD fatty acid esters as examples
BUNDESINSTITUT FÜR RISIKOBEWERTUNG The potential impact of toxicogenomics on modern chemical risk assessment 3-MCPD and 3-MCPD fatty acid esters as examples Prof. Dr. Dr. Alfonso Lampen Department of Food
Integration of high-throughput biological data
Integration of high-throughput biological data Jean Yang and Vivek Jayaswal School of Mathematics and Statistics University of Sydney Meeting the Challenges of High Dimension: Statistical Methodology,
Plant toxicology and risk assessment
Plant toxicology and risk assessment Anders Permin Head of Department, DVM, PhD ape@dhigroup.com Outline The black sheep Examples of plant toxicology What is toxicology? Risk assessment Tox studies Results
Supplementary Figure 1 IL-27 IL
Tim-3 Supplementary Figure 1 Tc0 49.5 0.6 Tc1 63.5 0.84 Un 49.8 0.16 35.5 0.16 10 4 61.2 5.53 10 3 64.5 5.66 10 2 10 1 10 0 31 2.22 10 0 10 1 10 2 10 3 10 4 IL-10 28.2 1.69 IL-27 Supplementary Figure 1.
3. What law of heredity explains that traits, like texture and color, are inherited independently of each other?
Section 2: Genetics Chapter 11 pg. 308-329 Part 1: Refer to the table of pea plant traits on the right. Then complete the table on the left by filling in the missing information for each cross. 6. What
From reference genes to global mean normalization
From reference genes to global mean normalization Jo Vandesompele professor, Ghent University co-founder and CEO, Biogazelle qpcr Symposium USA November 9, 2009 Millbrae, CA outline what is normalization
AbSeq on the BD Rhapsody system: Exploration of single-cell gene regulation by simultaneous digital mrna and protein quantification
BD AbSeq on the BD Rhapsody system: Exploration of single-cell gene regulation by simultaneous digital mrna and protein quantification Overview of BD AbSeq antibody-oligonucleotide conjugates. High-throughput
High AU content: a signature of upregulated mirna in cardiac diseases
https://helda.helsinki.fi High AU content: a signature of upregulated mirna in cardiac diseases Gupta, Richa 2010-09-20 Gupta, R, Soni, N, Patnaik, P, Sood, I, Singh, R, Rawal, K & Rani, V 2010, ' High
OMICS Journals are welcoming Submissions
OMICS Journals are welcoming Submissions OMICS International welcomes submissions that are original and technically so as to serve both the developing world and developed countries in the best possible
Research Framework for Evaluating the Potential Mode(s)
Research Framework for Evaluating the Potential Mode(s) of Action Underlying the Carcinogenicity of Hexavalent Chromium Following Exposure in Drinking Water Developed by Staff and Management at the The
Mechanisms of alternative splicing regulation
Mechanisms of alternative splicing regulation The number of mechanisms that are known to be involved in splicing regulation approximates the number of splicing decisions that have been analyzed in detail.
Explain that each trna molecule is recognised by a trna-activating enzyme that binds a specific amino acid to the trna, using ATP for energy
7.4 - Translation 7.4.1 - Explain that each trna molecule is recognised by a trna-activating enzyme that binds a specific amino acid to the trna, using ATP for energy Each amino acid has a specific trna-activating
Transcriptional control in Eukaryotes: (chapter 13 pp276) Chromatin structure affects gene expression. Chromatin Array of nuc
Transcriptional control in Eukaryotes: (chapter 13 pp276) Chromatin structure affects gene expression Chromatin Array of nuc 1 Transcriptional control in Eukaryotes: Chromatin undergoes structural changes
Deploying the full transcriptome using RNA sequencing. Jo Vandesompele, CSO and co-founder The Non-Coding Genome May 12, 2016, Leuven
Deploying the full transcriptome using RNA sequencing Jo Vandesompele, CSO and co-founder The Non-Coding Genome May 12, 2016, Leuven Roadmap Biogazelle the power of RNA reasons to study non-coding RNA
Genetic alterations of histone lysine methyltransferases and their significance in breast cancer
Genetic alterations of histone lysine methyltransferases and their significance in breast cancer Supplementary Materials and Methods Phylogenetic tree of the HMT superfamily The phylogeny outlined in the
Introduction to Systems Biology of Cancer Lecture 2
Introduction to Systems Biology of Cancer Lecture 2 Gustavo Stolovitzky IBM Research Icahn School of Medicine at Mt Sinai DREAM Challenges High throughput measurements: The age of omics Systems Biology
Gene Regulation Part 2
Michael Cummings Chapter 9 Gene Regulation Part 2 David Reisman University of South Carolina Other topics in Chp 9 Part 2 Protein folding diseases Most diseases are caused by mutations in the DNA that
Patnaik SK, et al. MicroRNAs to accurately histotype NSCLC biopsies
Patnaik SK, et al. MicroRNAs to accurately histotype NSCLC biopsies. 2014. Supplemental Digital Content 1. Appendix 1. External data-sets used for associating microrna expression with lung squamous cell
Comparison of open chromatin regions between dentate granule cells and other tissues and neural cell types.
Supplementary Figure 1 Comparison of open chromatin regions between dentate granule cells and other tissues and neural cell types. (a) Pearson correlation heatmap among open chromatin profiles of different
EPIGENOMICS PROFILING SERVICES
EPIGENOMICS PROFILING SERVICES Chromatin analysis DNA methylation analysis RNA-seq analysis Diagenode helps you uncover the mysteries of epigenetics PAGE 3 Integrative epigenomics analysis DNA methylation
Conceptual Model of Epigenetic Influence on Obesity Risk
Andrea Baccarelli, MD, PhD, MPH Laboratory of Environmental Epigenetics Conceptual Model of Epigenetic Influence on Obesity Risk IOM Meeting, Washington, DC Feb 26 th 2015 A musical example DNA Phenotype
Personalised medicine: Past, present and future
Kathmandu, Bir Hospital visit, August 2018 Personalised medicine: Past, present and future Rodney J. Scott University of Newcastle, NSW, Australia & Hunter Area Pathology Service Current Medical Care Started
MRC Integrative Epidemiology Unit (IEU) at the University of Bristol. George Davey Smith
MRC Integrative Epidemiology Unit (IEU) at the University of Bristol George Davey Smith The making of a University Unit MRC Centre for Causal Analyses in Translational Epidemiology 2007 to 2013 Interdisciplinary
Gene transcript profiles to diagnose infectious diseases. ESCMID Conference on Diagnosing Infectious Diseases: Future and Innovation
Gene transcript profiles to diagnose infectious diseases ESCMID Conference on Diagnosing Infectious Diseases: Future and Innovation 24-26 October 2011, Venice, Italy Matthew Berry Consultant Respiratory
TITLE: The Role Of Alternative Splicing In Breast Cancer Progression
AD Award Number: W81XWH-06-1-0598 TITLE: The Role Of Alternative Splicing In Breast Cancer Progression PRINCIPAL INVESTIGATOR: Klemens J. Hertel, Ph.D. CONTRACTING ORGANIZATION: University of California,
Supplementary Information Titles Journal: Nature Medicine
Supplementary Information Titles Journal: Nature Medicine Article Title: Corresponding Author: Supplementary Item & Number Supplementary Fig.1 Fig.2 Fig.3 Fig.4 Fig.5 Fig.6 Fig.7 Fig.8 Fig.9 Fig. Fig.11
m 6 A mrna methylation regulates AKT activity to promote the proliferation and tumorigenicity of endometrial cancer
SUPPLEMENTARY INFORMATION Articles https://doi.org/10.1038/s41556-018-0174-4 In the format provided by the authors and unedited. m 6 A mrna methylation regulates AKT activity to promote the proliferation
Ambient temperature regulated flowering time
Ambient temperature regulated flowering time Applications of RNAseq RNA- seq course: The power of RNA-seq June 7 th, 2013; Richard Immink Overview Introduction: Biological research question/hypothesis
Supplementary Figures and Tables
Supplementary Figures and Tables Supplementary Figure 1. Study design and sample collection. S.japonicum were harvested from C57 mice at 8 time points after infection. Total number of samples for RNA-Seq:
Epigenetics and Toxicology
Epigenetics and Toxicology Aline.deconti@fda.hhs.gov Division of Biochemical Toxicology National Center for Toxicology Research U.S.-Food and Drug Administration The views expressed in this presentation
Summary of Data Dissemination Working Group. 22Jan2016
Summary of Data Dissemination Working Group 22Jan2016 Overview Review of Data Dissemination Working Group Strategy for data dissemination Testing of model and submission process Systems Biology Centers
Introduction to Genetics
Introduction to Genetics Table of contents Chromosome DNA Protein synthesis Mutation Genetic disorder Relationship between genes and cancer Genetic testing Technical concern 2 All living organisms consist
Morphogens: What are they and why should we care?
Morphogens: What are they and why should we care? Historic, Theoretical Mechanism of Action Nucleoprotein: the specific trophic cellular material extracted from the cell nucleus. DNA and RNA which regulates
Mutations. Any change in DNA sequence is called a mutation.
Mutations Mutations Any change in DNA sequence is called a mutation. Mutations can be caused by errors in replication, transcription, cell division, or by external agents. Mutations Mutations can be harmful.
chapter 1 - fig. 2 Mechanism of transcriptional control by ppar agonists.
chapter 1 - fig. 1 The -omics subdisciplines. chapter 1 - fig. 2 Mechanism of transcriptional control by ppar agonists. 201 figures chapter 1 chapter 2 - fig. 1 Schematic overview of the different steps
DNA codes for RNA, which guides protein synthesis.
Section 3: DNA codes for RNA, which guides protein synthesis. K What I Know W What I Want to Find Out L What I Learned Vocabulary Review synthesis New RNA messenger RNA ribosomal RNA transfer RNA transcription
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/8/375/ra41/dc1 Supplementary Materials for Actin cytoskeletal remodeling with protrusion formation is essential for heart regeneration in Hippo-deficient mice
AVENIO family of NGS oncology assays ctdna and Tumor Tissue Analysis Kits
AVENIO family of NGS oncology assays ctdna and Tumor Tissue Analysis Kits Accelerating clinical research Next-generation sequencing (NGS) has the ability to interrogate many different genes and detect
The Cancer Genome Atlas & International Cancer Genome Consortium
The Cancer Genome Atlas & International Cancer Genome Consortium Session 3 Dr Jason Wong Prince of Wales Clinical School Introductory bioinformatics for human genomics workshop, UNSW 31 st July 2014 1
Supplemental Figure S1. Expression of Cirbp mrna in mouse tissues and NIH3T3 cells.
SUPPLEMENTAL FIGURE AND TABLE LEGENDS Supplemental Figure S1. Expression of Cirbp mrna in mouse tissues and NIH3T3 cells. A) Cirbp mrna expression levels in various mouse tissues collected around the clock
Supplementary methods:
Supplementary methods: Primers sequences used in real-time PCR analyses: β-actin F: GACCTCTATGCCAACACAGT β-actin [11] R: AGTACTTGCGCTCAGGAGGA MMP13 F: TTCTGGTCTTCTGGCACACGCTTT MMP13 R: CCAAGCTCATGGGCAGCAACAATA
Supplementary Appendix
Supplementary Appendix This appendix has been provided by the authors to give readers additional information about their work. Supplement to: Bredel M, Scholtens DM, Yadav AK, et al. NFKBIA deletion in
RESEARCHER S NAME: Làszlò Tora RESEARCHER S ORGANISATION: Institut de Génétique et de Biologie Moléculaire et Cellulaire (IGBMC)
Thursday 5 November EU-India PARTNERING EVENT Theme: Health RESEARCHER S NAME: Làszlò Tora RESEARCHER S ORGANISATION: Institut de Génétique et de Biologie Moléculaire et Cellulaire (IGBMC) CNRS, INSERM,
mirna-guided regulation at the molecular level
molecular level Hervé Seitz IGH du CNRS, Montpellier, France March 3, 2016 microrna target prediction . microrna target prediction mirna: target: 2 7 5 N NNNNNNNNNNNNNN 3 NNNNNN the seed microrna target
ncounter TM Analysis System
ncounter TM Analysis System Molecules That Count TM www.nanostring.com Agenda NanoString Technologies History Introduction to the ncounter Analysis System CodeSet Design and Assay Principals System Performance
developing new tools for diagnostics Join forces with IMGM Laboratories to make your mirna project a success
micrornas developing new tools for diagnostics Join forces with IMGM Laboratories to make your mirna project a success Dr. Carola Wagner IMGM Laboratories GmbH Martinsried, Germany qpcr 2009 Symposium
Epigenetics. Jenny van Dongen Vrije Universiteit (VU) Amsterdam Boulder, Friday march 10, 2017
Epigenetics Jenny van Dongen Vrije Universiteit (VU) Amsterdam j.van.dongen@vu.nl Boulder, Friday march 10, 2017 Epigenetics Epigenetics= The study of molecular mechanisms that influence the activity of
Identification of mirnas in Eucalyptus globulus Plant by Computational Methods
International Journal of Pharmaceutical Science Invention ISSN (Online): 2319 6718, ISSN (Print): 2319 670X Volume 2 Issue 5 May 2013 PP.70-74 Identification of mirnas in Eucalyptus globulus Plant by Computational
DiffVar: a new method for detecting differential variability with application to methylation in cancer and aging
Genome Biology This Provisional PDF corresponds to the article as it appeared upon acceptance. Fully formatted PDF and full text (HTML) versions will be made available soon. DiffVar: a new method for detecting
High-Throughput Sequencing Course
High-Throughput Sequencing Course Introduction Biostatistics and Bioinformatics Summer 2017 From Raw Unaligned Reads To Aligned Reads To Counts Differential Expression Differential Expression 3 2 1 0 1
Application of human epidemiological studies to pesticide risk assessment
Workshop What does the future hold for harmonised human health risk assessment of plant protection products? Application of human epidemiological studies to pesticide risk assessment Antonio F. Hernández,
Data and Knowledge Fusion: Supporting Toxicology, Health Effects Endpoints Analysis & Human Health Risk Assessment
Data and Knowledge Fusion: Supporting Toxicology, Health Effects Endpoints Analysis & Human Health Risk Assessment OpenTox Asia May 17-18, 2017 Asish Mohapatra Health Canada Disclaimer This presentation
RNA-Seq profiling of circular RNAs in human colorectal Cancer liver metastasis and the potential biomarkers
Xu et al. Molecular Cancer (2019) 18:8 https://doi.org/10.1186/s12943-018-0932-8 LETTER TO THE EDITOR RNA-Seq profiling of circular RNAs in human colorectal Cancer liver metastasis and the potential biomarkers
Boosting lipid productivity of the oleaginous microalga N. gaditana via genome engineering
Boosting lipid productivity of the oleaginous microalga N. gaditana via genome engineering Imad Ajjawi, John Verruto, Moena Aqui, Eric Moellering and Robert Brown October 25th 216 Outline n Brief intro
Supplementary Figures
Supplementary Figures Supplementary Figure 1 Characterization of stable expression of GlucB and sshbira in the CT26 cell line (a) Live cell imaging of stable CT26 cells expressing green fluorescent protein