EXPRESSION OF SOX 11 DURING TOOTH FORMATION. Reem Atout. Dr. Mary MacDougall, CHAIR Dr. Amjad Javed Dr. Firoz Rahemtulla Dr. Michael Reddy A THESIS

Transcription

1 EXPRESSION OF SOX 11 DURING TOOTH FORMATION by Reem Atout Dr. Mary MacDougall, CHAIR Dr. Amjad Javed Dr. Firoz Rahemtulla Dr. Michael Reddy A THESIS Submitted to the graduate faculty of The University of Alabama at Birmingham, in partial fulfillment of the requirements for the degree of Master of Science BIRMINGHAM, ALABAMA 2009

2 EXPRESSION OF SOX11 DURING TOOTH FORMATION REEM ATOUT MASTER S IN CLINICAL DENTISTRY ABSTRACT Our laboratory has shown that a human autosomal recessive (AR) form of radicular dentin dysplasia (RDD) is caused by an alteration in the transcription factor NFI-C. Gene array analysis of AR RDD versus normal periodontal ligament cells has revealed that Sox11 is dramatically down regulated associated with the disease. SOX11 is a member of the SRY-related high-mobility-group box (Sox) family of transcription factors. Although Sox11 expression has been previously reported, characterized associated with tooth or root formation has not been performed. Objectives: 1) To characterize the temporal spatial expression pattern of Sox11 during tooth formation; and 2) to determine if Sox11 is potentially regulated by NFI-C. Methods: Mouse maxillas & mandibles (Embryonic day 16 through post-natal day 28) were fixed, embedded, demineralized if necessary, sectioned and mounted on silane-treated slides. Sox11 expression was determined by by immunohistochemistry using a rabbit anti-sox11 polyclonal antibody. Levels of Sox11 transcripts in established dental cell lines are determined by quantitative real-time polymerase chain reaction analysis (QRT-PCR). Studies using a bioinformatics approach will determine the presence of potential NFIC binding sites contained within the Sox11 promoter that are conserved across various species. Results: In the early stages of tooth development (E-16) Sox11 is strongly expressed in both inner and outer enamel epithelium, as well as the dental papilla. Increased staining is seen with the cytodifferentiation of the ameloblasts and odontoblasts ii

3 with increase nuclear staining. Periodontal ligaments throughout root formation were also positive. Sox11 transcripts were detected in all cell lines tested with higher levels in ameloblasts. Conserved NIF-C cis-elements were contained in the Sox11 promoter region. Conclusion: These results suggest that Sox 11 plays a role in the tooth crown and root formation. These results will help to better understanding the function of downstream targets of NFI-C such as Sox11 related to root formation. As well as identify other candidate genes for RDD. iii

4 TABLE OF CONTENTS Page ABSTRACT... ii ACKNOWLEDGMENTS... vi LIST OF FIGURES... vii LIST OF ABBREVIATIONS... viii CHAPTER INTRODUCTION...1 Human Dentition.1 Over view of tooth development.2 Tooth Root Development Mouse models of altered root development.6 Human Genetic Diseases of the Dentition..9 OBJECTIVE...13 SPECIFIC AIMS...15 MATERIAL AND METHODS...17 Immunohistochemistry...17 Cell culture...18 RNA isolation and cdna synthesis from AK1 PDL cells and RDD PDL cells...18 Quantitative and qrt PCR...19 Quantitative Real time Polymerase Chain Reaction...20 Transient overexpression of NFIC Sox11 promoter analysis...21 RESULTS...22 Sox11 localization during tooth development...22 Expression of Sox11 in control versus RDD PDL cells...27 iv

5 Sox11 promoter analysis...27 Transient overexpression of NFI-C...31 DISCUSSION...33 CONLUSION...39 LIST OF REFERENCES...40 APPENDICES A B INSTITUTIONAL ANIMAL CARE AND USE COMMITTEE APPROVAL FORM...46 INSTITUTIONAL REVIEW BOARD FOR HUMAN USE APPROVAL FORM v

6 ACKNOWLEDGMENTS I would like to express the deepest appreciation to my mentor and committee chair, Dr. Mary MacDougall who has the attitude and the substance of a genius: she continually and convincingly conveyed a spirit of adventure in regard to research and an excitement in regard to teaching. Without her guidance and persistent help this dissertation would not have been possible. I sincerely thank my advisory committee members Dr. Amjad Javed, Dr. Firoz Rahemtulla and Dr. Michael Reddy for there valuable inputs in my thesis project. I would like to thank my program director, Dr. Nicholaas Geurs for giving me an opportunity to pursue Master s at a very prestigious university. I am very grateful to Dr. Olga Mamaeva for teaching me most lab techniques and her time and advice. I would also like to thank all my lab members for their valuable comments and critiques. vi

7 LIST OF FIGURES Figure Page 1 A) SOX11 genomic structure with no introns. B) Location of the Sox11 gene on the short arm (p) of human chromosome 2 at band Sox11 localization at E16, E19, Sox11 localization at PN days Sox11 localization at PN days 12, Sox11 localization at PN days Negative Control, Immunohistochemistry Sox11 Promoter (~2 kb) TESS database Sox11 promotor with NF-I binding sites GENOMATIX database Section of ALIBABA2 Database with NF-I binding site NF-I binding sites on SOX11 promoter using TESS database Consistent NF-I binding site across the three databases Fold changes of Sox11 expression, QRT PCR...32 vii

8 LIST OF ABBREVIATIONS AD AR BMP DPN DSPP E HERS HMG NFI PDL QRT-PCR RDD SRY TF Autosomal Dominant Autosomal Recessive Bone Morphogenic Protein Day post natal Dentin sialophosphoprotein Intrauterine Hertwig s epithelial root sheat High Motility Group Nuclear Factor I Periodontal ligament Quantitative real time polymerase chain reaction Radicular Dentin Dysplasia Sex-determining region Y Transcription factor viii

9 INTRODUCTION The Human Dentition We use them every day, clean them religiously and rely on them for eating, communication and physical appearance. We spend millions on educating and training people specifically to maintain them. Despite all this attention, the importance and uniqueness of teeth in development, disease and evolution is often not appreciated. Each species has an individual and unique set of teeth, known as the dentition. In humans, there are two sets of teeth that are formed during the lifespan of an individual. The first set of teeth is the called the deciduous dentition, also known as the primary, baby, milk or lacteal dentition. There are twenty deciduous teeth (ten maxillary and ten mandibular) that are classified into three classes: incisors, canines and molars. Calcification of deciduous teeth begins during the fourth month of fetal life. By the end of the sixth month, all of the deciduous teeth have begun calcification. In general, the root of a deciduous tooth is completely formed approximately one year after eruption of that tooth into the mouth. Although the deciduous teeth replaced by the succedaneous teeth, they play a very important role in the proper alignment, spacing, and occlusion of the permanent teeth. The deciduous incisor teeth are functional in the mouth for approximately five years, while the deciduous molars are functional for approximately nine years. The permanent teeth are the second set of teeth formed in humans. There are thirty-two permanent teeth, consisting of six maxillary and six mandibular molars, four maxillary and four mandibular premolars, two maxillary and two mandibular canines, 1

10 four maxillary and four mandibular incisors. The eruption of permanent teeth starts around the age of 6. From then until the child becomes twelve years old all the primary teeth loosen and come out while the permanent teeth come through in their place. Normally by the age of 13 years 28 out of 32 permanent teeth will have erupted. By the time the deciduous teeth have fully erupted (2 to 2.5 years of age) calcification of the crowns of the unerupted permanent teeth is under way while first permanent molars begun calcification at the time of birth. Overview of Tooth Development Teeth develop as ectodermal appendages in vertebrate embryos, and their early development resembles morphologically as well as molecularly other organs such as hair follicles, kidneys and mammary glands. Interactions between the ectoderm and underlying mesenchyme constitute a central mechanism regulating the morphogenesis of all these organs. Tooth morphogenesis is an advancing process that is regulated by sequential and reciprocal interactions between the oral epithelial and ectomesenchymal tissues such that the simple oral ectoderm thickens, buds, grows and folds to form the complex shape of the tooth crown [1]. The first sign of mammalian tooth development is seen as a thickening of the oral epithelium. This occurs at around the 10.5 days of embryonic development (E10.5) in mice and at approximately 7 weeks in humans. The thickening grows as the epithelium starts to invaginate into the underlying cranial neural crest derived mesenchyme. This ectomesenchyme subsequently condenses around the invaginating epithelium, leading to the formation of the tooth bud at around E13. The epithelium then starts to extend farther 2

11 into the mesenchyme, wrapping itself around the condensing mesenchyme to form a cap (at E14), and then a bell -stage tooth germ (at E16). This process is thought to be controlled by a signaling centre that develops at the tip of the late bud stage tooth, known as the enamel knot. Eventually, the condensing mesenchyme becomes completely enclosed in the invaginating epithelium by the late-bell stage (at E18). It is during the bell stages of tooth development that cytodifferentiation occurs, with the epithelial cells in contact with the dental mesenchyme differentiating into the enamel producing ameloblasts, and the adjacent mesenchyme cells differentiating into dentin-producing odontoblasts. [2] Signaling molecules of several conserved families mediate the reciprocal cell communication occurring during tooth development. Critical signaling pathways are the transforming growth factor beta (TGF- ), fibroblast growth factor (FGF), sonic hedgehog (SHH) and Wnt. Although the signals mostly regulate interactions between the ectoderm and mesenchyme, they also mediate communication within individual tissue layer. Ectodysplasin, a recently identified signal molecule in the tumor necrosis factor (TNF) family, and its receptor Edar mediate signaling between ectodermal compartments in tooth germs. The genes regulated by the different signaling pathways include transcription factors and receptors that regulate the competence of the cells to respond to additional downstream signals, as well as new signals that act reciprocally and thereby continue the communication between cells and tissues [3, 4]. An early signaling event in tooth development is the induction of the odontogenic mesenchyme by bone morphogenetic proteins (BMPs) and FGFs from the epithelium. Tissue recombination studies demonstrate that epithelial signals induce in the 3

12 mesenchyme the competence to instruct subsequent tooth morphogenesis. BMPs and FGFs induce the expression of several mesenchymal transcription factors, many of which are necessary for the continuation of tooth development [1]. The size of the tooth field and the resultant number of teeth that are formed is determined at an early stage of development. Teeth, therefore, develop different shapes depending on their exact position in the mouth and the combination of homeobox genes that is expressed in the neural crest into which they invaginate. The number of teeth that is formed relies on a fine balance of the level of ectodysplasin (EDA) signaling [2]. The primary enamel knot has a central role in the patterning of the molar crowns. It regulates tooth shape by inducing secondary enamel knots initiating cusp development In particular the size and signal activity of the primary enamel knot correlates with the size of the crown and patterning of the cusps [3, 5]. Signals from the enamel knot affect both epithelial and mesenchymal cells, and subsequent reciprocal interactions between the mesenchyme and epithelium are responsible for the maintenance of the enamel knot as well as for the subsequent morphogenesis of the epithelium. A SHH signal from the enamel knot is needed for the growth of the epithelial cervical loops flanking the enamel knots [6]. The enamel knot signals also regulate the patterning of the tooth crown by influencing the initiation of the secondary enamel knots that express most of the same signal molecules as the primary enamel knots. They form in an exact sequence and determine the sites where the epithelial sheet folds and cusp development starts. Their development is regulated by signals from earlier formed primary and secondary enamel knots together with mesenchymal signals conceivably this involves mechanisms of lateral inhibition and activators and inhibitors. Recently a gene network model was presented 4

13 that can reproduce both the reiteration of the epithelial signaling centers and their gene expression patterns as well as the resulting tooth morphologies of different mammalian species [6]. Tooth Root Development The exact nature of the regulatory mechanisms of the process of crown to root transition is unknown and the research on this topic has been more limited. During tooth development, after the completion of crown formation, the apical mesenchyme continues to proliferate to form the developing periodontium while the inner and outer enamel epithelia (devoid of stellate reticulum and stratum intermedium), fuse below the level of crown cervical enamel to produce a bilayered epithelial sheath termed the Hertwig s epithelial root sheath (HERS). The classic theory of root formation states that, as these cells divide, there is apical migration of HERS cells through the underlying dental ectomesenchymal tissues (dividing them into dental papilla and dental follicle). As the root develops, the first radicular mantle dentin is formed, the epithelial sheath fenestrate, and individual cells migrate away from the root into the region of the future periodontal ligament (PDL) to form the Rests of Malassez [7]. It is well accepted that HERS plays an important role in root development; however, the precise nature of this role remains unclear. Amongst the different functions attributed to these cells are that of inducers and regulators of root formation, including the size, shape, and number of roots [8]. It has also been suggested that HERS cells deposit chemotactic proteins into the basement membrane to direct the migration of precementoblast cells [9, 10, 11]. Another role 5

14 attributed to HERS cells is that of inducers of differentiation of radicular odontoblast to form root dentin [8, 12] or dental sac cells to differentiate into cementoblasts [13, 14]. Information related to signaling pathways critical for root formation is limited. SHH signaling is associated with root development [15]. Also BMP signaling could be of importance in root development as Bmp2, and Bmp4 are expressed in the mesenchyme of the root tip and Msx2 in HERS [16, 18]. Insulin like growth factor-1 has a proliferative effect on the cells of the root sheath [17]. It is obvious that several signaling pathways are active during root development but at present the genetic mechanisms of root growth are still poorly understood. It is also unclear at this point what the role is in root development of the various signaling antagonists that play such an important role during other developmental processes [18]. Mouse Models of Altered Root Development Examination of mutant and knockout phenotypes with altered phosphate/pyrophosphate distribution has demonstrated that cementum, the mineralized tissue that sheathes the tooth root, is very sensitive to local levels of phosphate and pyrophosphate [19]. Tissue non-specific alkaline phosphatase (TNAP) is richly present in developing teeth including the cells of the PDL. Tooth and root development was previously investigated in mice lacking the TNAP gene. The eruption of the incisors into the oral cavity is delayed for 2 to 3 days. Also, the onset of mineralization of the mantle dentin in the roots of the developing molars is delayed for 2 to 3 days. Dentin and enamel formation in the homozygous mutants shows a rather normal pattern, with the exception of localized enamel hypoplasias. The most conspicuous finding is the defective formation 6

15 of acellular cementum along the molar roots. Instead of a continuous layer, the cementum is deposited as very thin and irregularly shaped patches around the bases of the PDL fibers. Sharpey's fibers are short and poorly developed. In contrast, the development of the alveolar bone, the PDL, and the cellular cementum is seemingly unaffected. It is concluded that TNAP represents an essential factor in mantle dentin mineralization and in the formation of acellular cementum. A more dramatic model with altered root formation is found in mouse carrying a deletion of an Msx gene. The Msx homeobox gene family consists of three physically unlinked members in the mammalian genome [20, 21, 22]. During mid-gestation, Msx1 and Msx2 expression occurs at numerous sites of epithelial mesenchymal tissue interactions, including the eyes, salivary glands, hair follicles, mammary glands, nails, and the tooth (23, 24, 25, 26, 27, 28). Genetic studies in mice indicate that Msx genes are not only expressed in the developing tooth, but that mutations in them are also associated with specific tooth disorders. Msx1 mutant mice die at birth and exhibit a completely penetrant cleft of the secondary palate and an arrest in tooth development at the bud stage [29]. Like mutations in Msx1, mutations in the Msx2 gene also result in tooth defects. Msx2-deficient mice exhibit defects in the development of various ectodermal organs, including the hair follicle, mammary gland, and dentition [30]. In contrast to the early tooth phenotype of Msx1 mutant mice, Msx2 mutant teeth develop normally through the early stages of development but exhibit late defects in cusp morphogenesis and in the process of amelogenesis. In Msx2-deficient embryos, tooth development proceeds normally through the bud and cap stages of tooth development. However in the adult tooth, cusp shape abnormalities in the molars and an enamel deficiency in both molars 7

16 and incisors are observed. In addition, the roots of the molars are markedly truncated and malformed [31]. The most severely affected model of altered root formation is found in mice with a null mutation of the Nfic gene. The nuclear factor I (NFI) family of transcription proteins consists of four members: NFI-A, NFI-B, NFI-C and NFI-X. They are expressed by four highly conserved genes (Nfia, Nfib, Nfic, and Nfix) in mammals. All of the NFI proteins bind to the same DNA consensus sequence with similar apparent affinities [32]. NFI proteins have been shown to have unique cell-type specific transcriptional modulation properties, supporting unique functions for each gene during development. For example when the Nfic gene is disrupted in mice by removal of the second exon encoding the NFI-C/CTF DNA-binding and dimerization domain, mice teeth exhibited normal crown formation, but short and abnormal root formation [34]. Although heterozygous animals appear normal, Nfic -/- mice have unique tooth pathologies: molars lacking roots, thin and brittle mandibular incisors, and weakened abnormal maxillary incisors. Feeding in Nfic -/- mice is impaired, resulting in severe runting and premature death of mice reared on standard laboratory chow. However, a soft-dough diet mitigates these feeding impairments and maintains viability. Other tissues/organs in the body, including bone forming osteoblasts and enamel forming ameloblasts appeared to be normal. Nfic-deficient mice form morphologically normal HERS, but fail to differentiate normal odontoblasts in the early stage of root formation, resulting in the short and abnormal roots [35]. Although Nfic is expressed ubiquitously in nearly all organ systems, tooth root development defects are the prominent phenotype. Indeed, molar crown development is 8

17 normal and well-nourished Nfic -/- animals are fertile and can live as long as their wildtype littermates. The Nfic mutation is the first mutation described that affects primarily tooth root formation and should greatly aid our understanding of postnatal tooth development [36]. Nifc expression during tooth development in mice had been examined: during tooth bud development Nfic is expressed strongly in the mesenchymal cells of the dental papilla and weakly in the epithelial components [33]. At the early stages of mouse root formation (day 8 postnatal), Nfic is expressed strongly in most epithelial tissues of the tooth including: ameloblasts and stellate reticulum; odontoblasts; surrounding mesenchymal tissues; and the dental papilla of both molars and incisors. At fourteen days post natal development, when molar roots are elongating, Nfic expression appears more restricted being present within the preodontoblasts and odontoblasts of the molars, the PDL tissues and developing bone. Human Genetic Diseases of the Dentition Given the wealth of information that is now available on the genetics of mouse tooth development, it is interesting to try to establish parallels with human genetic diseases presenting with altered dentitions. Several human disorders show defects in primary tooth development (morphology and structure) and patterning. The most common dental genetic disease is selective tooth agenesis (hypodontia) or missing teeth. Deficiency of third molars, second premolars and lateral incisors are the most common missing teeth, whereas lack of first and second molars is relatively rare. The reported incidence of selective agenesis varies from 1.6% to 9.6%; these values do not include 9

18 agenesis of third molars, which occurs in approximately 20% of the world population [37, 38]. Least common human disorders of the dentition involve defects in root formation. Patients with Radicular Dental Dysplasia (RDD) (type I) demonstrated the clinical, radiographic, and histologic features of having dense sclerotic bone and skeletal anomalies of the wrists and hand bones. The association of these defects of teeth and bone was found to be transmitted as an autosomal dominant trait over four generations [39]. Dentin dysplasia Type I, a rare autosomal dominant disorder, is associated with short or blunted roots that are conical shaped. In the primary teeth pulp chambers and the root canals are obliterated with mineralized matrix. However, in the permanent teeth the pulp remains viable but crescent shaped with multiple true denticles [40]. RDD in general is characterized by the absence or short roots, pulpal obliterations, absent root canals, and premature exfoliation of the teeth. The prevalence of this autosomal dominant disorder is 1:100,000 and there is no known genetic cause to date [39, 41]. Autosomal recessive Radicular Dentin Dysplasia (AR RDD) is characterized by having small crowns, with normal enamel and coronal dentin, intrapulpal calcification, and irregular and incomplete root formation with the absence of cementum which leads to premature exfoliation of the roots [41]. The genetic basis of other human disorders that involve tooth development is known, and so, for these conditions mouse, models can provide important information about when and where the genes act during tooth development [5, 42]. Gene Array analysis of AR RDD dental periodontal cells compared to an age and sex matched control cells revealed that Sox11 is dramatically down regulated associated 10

19 with the NFI-C mutation. Interesting, Sox11 expression has not been previously identified or characterized associated with tooth or root formation. Sox11 is a member of the SRY-related high-mobility-group box (Sox) family of transcription factors, containing 20 genes in humans and mice that play diverse roles in vertebrate differentiation and development. Family members share a highly conserved high-mobility-group (HMG) box domain which allows sequence-specific binding to the minor groove of DNA [22]. This domain was originally identified in the sex-determining gene (SRY) located on the Y chromosome. Sox family members are clustered into nine groups based on sequence and gene structure identity. Members of a common group usually are not only related in sequence but also expressed in a strongly overlapping manner and tend to exhibit at least partially redundant functions at sites of co-expression [24]. Sox11 an intronless gene is located on human chromosome 2p25 (Figure 1). It is a member of the SoxC group and is mostly related according to structure and expression pattern to Sox 4 and 12. In addition to an N-terminal HMG box domain, Sox11 protein contains a number of highly conserved C-terminal motifs, which function in transcriptional regulation [43]. Expression of Sox11 in mouse embryos has been described prominent in the periventricular cells of the central nervous system, suggesting a role in neural maturation. However, expression has also observed in a wide range of tissues involved in epithelial-mesenchymal interactions, suggesting a broader role in tissue modeling during development [44]. 11

20 Figure 1. A) SOX11 genomic structure with no introns. B) Location of the Sox11 gene on the short arm (p) of human chromosome 2 at band

21 OBJECTIVE Recent results in our laboratory have shown that an AR form of human RDD is caused by a mutation in the transcription factor NFI-C. This mutation is associated with a dramatic decrease in the levels of NFI-C expressed in dental cells derived from the AR RDD patient. A gene array analysis was performed on PDL cells from the patient versus age- and sex-matched control cells and reveal alterations in a number of genes that are potentially regulated by NFI-C. These genes could have a function critical during tooth root formation. One of the genes expressed at much lower levels in AD RDD is Sox11. Sox 11 have not been previously characterized as being expressed during tooth or root formation. Sox proteins have been emerged as important players in regulating multiple aspects of development through their function as transcription factors [44]. Previous studies have shown that Sox11 is expressed in periventicular cells of the central nervous system, it was also observed in the cranial neural crest, peripheral nervous system and the pharyngeal arches [45, 46]. Mutations in Sox genes cause severe congenital diseases in humans, such as XY sex reversal (SRY), campomelic dysplasia (SOX9), Waardenburg Hirschsprung syndrome (SOX8) and anophthalmia esophageal genital syndrome (SOX2). Sox11 inactivation in the mouse was shown to cause heart arterial outflow tract malformation, lung hypoplasia, asplenia, cleft lip and palate, open eyelids and skeletal malformations [47]. Tooth formation in Sox11 null mice has not been studies since these animals die at or prior to birth. The purpose of this study is to characterize the temporal spatial expression pattern of Sox11 during tooth formation with special emphasis on root formation and determine if Sox11 is regulated by NFI-C. Our hypothesis Sox11 is expressed during 13

22 tooth formation especially in components of the forming root including the periodontal apparatus. Furthermore NFI-C positively regulates Sox11 expression in cell derived from the tooth. 14

23 SPECIFIC AIMS SPECIFIC AIM 1: To identify the spatial and temporal expression pattern and levels of Sox11 during tooth formation. The expression of Sox11 is very prominent during craniofacial and skeletal formation, especially at the sites of epithelialmesenchymal interactions. However, no studies have been performed localizing Sox11 in the developing teeth or root structures. Identification of the presence of Sox11 in developing teeth will be critical for determining its potential critical role during root formation. We analyzed the presence of Sox11 in mouse tooth organs at various stages of development by immunohistochemistry using a specific polyclonal peptide antibody. The levels of Sox11 transcripts in normal and AR RDD PDL cells were determined by quantitative real-time polymerase chain reaction analysis (QRT-PCR). Tissue was analyzed at critical stages of tooth and root formation: embryonic day 16, embryonic day 19, postnatal (PN) day 4, PN day 12, PN day 13 and PN day 28. SPECIFIC AIM 2: To identify potential NFI-C binding sites in the promoter region of Sox11 and determine if NFI-C is a transcriptional regulator of Sox11 (positive or negative). NFI-C is characterized by a highly conserved, sequence-specific DNA binding initial characterized as TTGGC (N5) GCCAA on duplex DNA. Later it was shown to tightly bind individual half sites TTGGC and GCCAA. Studies using a bioinformatics approach will determined the presence of potential NFIC binding sites contained within the Sox11 promoter that are conserved across various species. Based on this information, we performed transient transfection studies overexpressing NFI-C into dental cells to determine if this transcription factor regulations the expression levels of Sox11. These experiments provided preliminary data that NFI-C is an upstream regulator 15

24 of Sox11. Understanding the relationship of NFI-C and Sox11 (direct or indirect) aids the determination of critical pathways association with root formation and the identification of other potential candidate genes for AR RDD. 16

25 MATERIAL AND METHODS Immunohistochemistry Mouse maxillas & mandibles (embryonic day 16 to PN day 28) were fixed in 4% formaldehyde, embedded in paraffin, sagittaly sectioned and mounted on silane-treated slides. Paraffin sections of 4-6 μm thickness on glass slides were placed on heating plates for 30 minutes prior to immunostaining. Tissue section slides were deparaffinized and rehydrated through a graded xylene-ethanol series and incubated for 15 min in 3% hydrogen peroxide in methanol to inhibit endogenous peroxidases, rinsed in PBS 3 times for 5 minutes each. Proteinase K (20 ug/ml) was used for antigen retrieval incubating for 10 min at room temperature, rinsed in PBS 2 times for 5 minutes each, followed by incubating samples in 10% BSA in PBS for 30 min for blocking non-specific binding. Immunohistochemistry technique was performed using a commercially available rabbit polyclonal Sox11 antibody (AbCam Ab ) directed against a specific Sox11 peptide. The antibody was used at a 1:450 dilution prepared with 2% BSA in PBS and incubated for 2 hours at room temperature. Incubation with no primary antibody only PBS served as the negative control. The sections were washed with a PBS 3 times for 5min followed by incubation with secondary horseradish peroxidase (HRP) polymer conjugate broad-spectrum antibody (DAB, Zymed, Carlsbad, CA) for 30 min at room temperature. The sections were washed 3 times for 5 min with PBS, incubate with chromogen/substrate solution for 2 min, the reaction was stopped by washing 3 times for 5 min using distilled H2O. The slides were then mounted using 1 drop/section of Immumount (Thermo Inc., City, State) and covered with glass cover slips. Samples were 17

26 photographed with a Nikon TE 200-E microscope (Nikon, Tokyo, Japan) using the NIS elements AR software. Cell Culture Normal (AK1) and AR RDD (ARRDD 001) PDL cells previously isolated from extracted teeth of patients with signed consent were used for these studies. Cells were plated in 6 well plated and incubated at 37 ºCC in -MEM media supplemented with 10% FCS, 200 units/ml penicillin/streptomycin, 50 mg/ml ascorbic acid under atmospheric conditions. Media will be changed every two days and the cells monitored by phase contrast microscopy. Samples were collected for qrt-pcr analysis after 4 days of culture. RNA Isolation and cdna Synthesis from AK1 and RDD PDL Cells Total cellular RNA was obtained from AK1 control and RDD PDL cells. RNA was extracted using RNA STAT-60 reagent (Tel-Test, Inc., TX). Briefly, cells were lysed by adding one ml RNA STAT-60 reagent of per well of six well plate and cells lysates were collected in the eppendorf tubes and were incubated for 5 min at room temperature. Then 0.2 ml of chloroform was added to the tubes, and samples were vigorously shaken for 15 seconds, and incubated for 2-3 min at room temperature. Samples were centrifuged at 12,000 x g for 15 min at 4 ºC to collect the aqueous phase. RNA precipitation was done by transferring the aqueous phase to a fresh tube by mixing the aqueous phase with 0.5 ml of isopropyl alcohol reagent and incubated at room temperature for 10 min. Tubes were centrifuged at 12,000 x g for 15 min at 4 ºC. Supernatant was removed and RNA 18

27 pellet was washed with on ml of 75% ethanol. Sample was vortexed for 10 seconds and centrifuged at 7,500 x g for 5 min at 4ºC. RNA was dissolved in μl of DEPC treated H2O. The RNA was used for cdna synthesis using the Reverse Transcriptase Reagent kit (Taq-Man Reverse Transcription Reagents) following the manufacturer s protocol (Applied Biosystems, Foster City, CA). A total of 2μg of RNA was used for the reaction. The master mix was prepared with the following: RNA, 10μl of 10X Buffer-, 22μl of 25 mm MgCl2, 20μl of dntps, 5μl of random primers, 2μl of RNA inhibitor, 2.5μl of reverse transcriptase enzyme and water to a final volume of 20 μl. Quantitative and Real Time Polymerase Chain Reaction (qrt-pcr) For RT PCR we used RedTag DNA polymerase from (Sigma) following manufacturer s protocol, master mix was prepared as follow: 5X Buffer, dntps-1μl, Template cdna-1μl, forward and Reverse Primer (100nm/μl) - 1μl, ddh2o 39.5 μl, redtag polymerase-2.5μl. PCR cycle condition used was 57 C 45 extension, 35 cycles. Sequence of both primers used for RT-PCR and the product sizes are as follow: GAPDH sequence: reverse- 5 - TGTAGACCATGTAGTTGAGGTCA-3 ; forward-5 -AGGT CGGTGTGAACGGATTTG-3. For analysis of amplified products, a 2% agarose gel containing 6μl of ethidium bromide was poured and allowed to set for 20 minutes. The PCR product (20 l) was added to the gel along with the 100 bp DNA ladder size marker. Gel was electrophoresed in TAE buffer run for 30 minutes. The gel was then removed and pictures were taken under UV light using Alpha Innotech software (Alpha Innotech, San Leandro, CA). 19

28 Quantitative Real time Polymerase Chain Reaction (QRT-PCR) Quantitative Real Time-PCR (qrt-pcr) was performed using the ABI Prism 7000 Sequence Detection System in order to measure relative transcriptional levels. Specific oligonucleotide primer sets were purchased from (SABiosciences, Fredrick, MD) and used to detect the housekeeping gene GAPDH as compared to Sox11. Cycle threshold (C T ) values for transcription levels were obtained and normalized to GAPDH to determine the C T value. C T values for Sox11 groups were compared to control using the C T method, giving a fold change in relative gene expression. Transient Overexpression of NFIC In order to determine whether NFI-C can regulate the promoter activity of Sox11 expression, RDD cells were transfected with pcdna3.1 vector containing the full length NFIC gene (isoform NFIC4) or a control empty pcdna3.1 vector. Briefly, 48 hours before transfection RDD PDL cells were seed to the 6-well plate with seeding concentration 1x10 5 cells/ml in MEM-alpha medium supplemented with 10% of Bovine Fetal Serum (with no antibiotics added). As a transfection reagent we used Lipofectamine 2000 with ratio DNA: Lipofectamine :3; 4 ug of DNA and 6 ul of Lipofectamine 2000 were used for 1 well of 6-well plate. DNA and Lipofectamine were diluted in 250 ul of OPTI-MEM, incubated for 5 minutes in room temperature, combined, incubated additional 15 minutes at room temperature and then added to the cells. After transfection we incubated cells at 37 0 C, 5%CO 2 for 96 hours. After incubation cells were lysed with RNA STAT60 reagent for RNA isolation. cdna synthesis was performed and QPCR was done as previously outlined. 20

29 Sox11 Promoter Analysis Several computational programs have been developed to align noncoding DNA segment of the human Sox11 gene. For these analyses a kb segment of the human Sox11 promoter was used. The Sox 11 DNA sequence was retrieved from the NCBI database (NC_ ). Potential NFI sites were determined using the software programs using weight matrices as determined by the software programs Genomatix, TESS and Gene-Regulation (Ali BABA2) generating a consensus list of NF-I potential binding sites. 21

30 RESULTS Sox11 Localization during Tooth Development To assess the temporal-spatial expression pattern of Sox11 during tooth development, we performed immunohistochemistry with a commercially available peptide polyclonal antibody specific for Sox11. Tissue sections of mouse teeth at critical stages of tooth formation were prepared allowing investigation of cell differentiation, extracellular matrix deposition and root formation during odontogenesis. Immunohistochemistry was performed using a 1:450 dilution of the Sox11 antibody. Primary antibody replaced with PBS served as the negative control for the reaction specificity. At early stages, during tooth bud development at embryonic day 16 (E-16) high levels of Sox11 protein was detected in the dental mesenchymal cells with weaker expression seen in the epithelium. At E-19, Sox11 was highly expressed in inner and outer enamel epithelium as well as being maintained in dental pulp mesenchyme (DPM). Lower expression was seen the epithelial stellate reticulum (SR) cell layer. In all cells at this point there was strong nuclear staining (Figure 2). 22

31 Figure 2: Sox 11 localization at early stages of tooth development E-16 and E-19. Higher Sox11 expression is seen in mesenchymal cells with weaker expression in the epithelium initially. Sox11 expressed is upregulated at E-19 within the inner and outer enamel epithelium with sustained expression in the dental pulp. Abbreviation: DPM, dental pulp mesynchyme. At PN day 4, Sox11 was expressed in all the dental tissues with highest expression in the epithelial-derived enamel producing ameloblasts (AM) and cranial neural crestderived dentin producing odontoblasts (OD). Staining is also seen in the stellate reticulum (SR) and in dental papilla (DP) (Figure 3). 23

32 Figure 3: Sox 11 localization at postnatal day 4 of development. Sox11 is strongly expressed within most epithelial tissue of the tooth with higher levels in the ameloblasts (AM). The ectomesenchymal derived odontoblasts (OD) also express higher levels with lower levels in the DP. The extracellular matrix components of enamel (E) and dentin (D) are negative. At the early stages of root formation (PN day 8) Sox11 was expressed strongly in most of the epithelial tissues of the tooth, including the ameloblasts and stellate reticulum; in odontoblasts; in surrounding supportive mesenchymal tissues; and in the dental pulp (DP) of the molars. AT PN day 12 and 13, Sox11 expression was seen in the DP with higher levels in the odontoblasts (OD), the root pulp apex (RPA) and the reduced ameloblasts. Staining was also seen in the connective PDL and the developing alveolar bone. Higher levels of expression were also seen in the oral epithelium (Figure 4). 24

33 Figure 4: 12 Sox 11 localization at stages of root formation PN days 12 & 13. Localization of Sox11 was seen in the DP with higher levels in the differentiated odontoblasts (OD). In the formation root structures, the root pulp apex (RPA) cells were positive as well as the DP. The reduced ameloblasts were also highly positive for Sox 11. Staining was also seen in the PDL and the developing alveolar bone surrounding the forming teeth. Higher levels were seen in the oral epithelium. At the completion of root formation (PN day 28), Sox11 expressed remained high in the odontoblasts (OD) of both the crown and root (R) and within the PDL, DP and surrounding alveolar bone (Figure 5). No staining was seen in the negative controls using no primary antibody (Figure 6). 25

34 Figure 5: Sox 11 localization at the completion of root formation. At 28 day PN development, Sox11 expressed remained positive in the mature odontoblasts (OD) of crown and root, and within the PDL. Abbreviations: P, Pulp (P); R. root. Figure 6: Negative control of SOX staining using no primary antibody only PBS. A representative section at PN day 8 showing no staining within any structures of the tooth or mandible. 26

35 Therefore, Sox11 was found to be expressed at multiple stages of tooth development and strongly associated with the crown and root odontoblasts the produce the dentin extracellular matrix during root formation. Furthermore, the supportive tissues of the tooth, the PDL, as also positive throughout root formation. Expression of Sox11 in Control versus AR RDD PDL Cells Quantitative RT PCR using cdna from RDD PDL cells compared to cdna from PDL cells isolated from an age- and sex-matched control patient (AK-1) showed a severely decreased (4 fold) in Sox11 transcript levels as measured relative to the housekeeping gene GAPDH. Ct values (threshold cycles) were normalized to GAPDH by subtracting the target gene from the GAPDH control values. A ΔΔCt value was then calculated by subtracting the normalized experimental Ct from the normalized control condition with fold change reported as 2 ΔΔCt (data not shown). Sox11 Promoter Analysis Potential transcription factor binding sites were determined using the TESS, AliBABA2 and GENOMATIX databases. NF-I sites were documented within approximately 2 kb of the human SOX11 gene promoter upstream from the ATG start site. Different NF-I binding sites were recognized and differentially distributed in the human Sox11 promoter using the three databases. A total of 11 binding sites were identified using TESS database, 12 sites using AliBaba2 database and three using the GENOMATIX database. A single consistent NF-I binding site was located across the three databases (Figure 11). 27

36 2652 SOX11 promoter with NF-I Binding Sites TTTTCTCTAGCTAAGAAGTGATTAAGACAAACAAATCAGGATAATAGCCATGTTTTGAAGA AACCAGATTTGGCAAATTTTAAAATTGTGCTTTCAAAATTGACTATTCATTTCTTTTTATATT ACACTTCCAAACACACACATACACACTTAACAATCACACATTTGGAACCATACATGTCTTCT TGGGTGTATAAGACAAAGATACTGATAGAAAGGGAGCAATGTCTCCAGGAGACACTGGC CCCTCTCCCTTCATGTGTAGACTGCAACTCTAGGACTTGCTCTCCAGCACTGGTGCAGGCT CCGCCTCTGTCTTTGATTTAGATGGGAGAGGGCAGGAGCCATCTCCCCACCCCAGCCCCTA AAGCCCCCCACTCTCTTTTTTGGAGCTAAGAGAGCAGGCCACACTGGACGATAGTGCTGCT TGCTCAACAAAAAAAATAACTGTTTTGGGGGAAATTATTTAACTTCATTTAAAAATTCCCTG AGTTTTCTAGTTAAATGTCTTTTTTAGAGCATATTCCTCCCACTAAAAAATGGTTGAATAAA TATATTTTTAATAAAAATAAGGTTTGTTTAAACTGTAAAAGATAGGAAGTTCTAGCCAATG CCTGGTTAACAGGAACAGTGTGAACACGTGAAACAGTGTGATCTGAAACCACAGACATCC CTCTTGGTGTTAGCTCCAATGTTGCATGTGTATATTCTGTGTGTGTACATCTGTGTGTGTGT GTGTGTGTTCATTTGTGTGCTGGGTCATGATGTAAAAATCCATTTCATATGTCAGATCATA GTCAAAATAAGTTTGAAGCCCCTGCCCTGTGCTATCCTGCCCTGCTGATACTCTGTGTTTTC CTTAATTGTGACAAAGATGAAACTACAGAGGCAAAACGAGAAGAGTCATGCCTTGCTTGC ATTGCAAAGGGACGTGGATTTTGTCCTAATGGTGAAGGGCATCCTGAGCATGACGCTGGC AAGTCCCATGGTCCCTGTTGCATGTTGGAATGAATAGTCTGTCTGCAGAGTGGAAACAGG GACATCAGTTTGGTGTCCATTACTAAAAAATGTGTAAAGCCCAGAGGAAAACTGAAACAT ACACACTGATGGTCAAAACATGCAGGAGGAAGTGAACTCAGGAGTGACTCGGGTAGGAG AATTGACTGAGCTTACTGGGGTATGTGAGCAAATATGAAAATCCCTTCATAACTTACACAA TAGTTACGGTATGCCAGGAACCCTTTCAGGCACAGAAGAAGAAATATTAAAATAATAAAG ACTACATTTGTAAACGTTCTACTGTGCGCAGCACTGTTCTAAGCACTTCATATGTATTTAAT CATTATAGCAATTCTAACAAATCAAGCAGGACCTGGACTGTGTCTCTGCACACATGAGTGT GTGTGTGTGTGTGCGCGTGCACGCACATGATGGAATGGTTACTGGTATCCTATTTTATAGA CTGGAAAACGAAGGCACAGGATAAGTTAAATAACTTGTGTAAAAGACACTATCAAGAAAA TGAGAAAACAAGCCACAGACTAGGGGAAGTTATTTGCAAAAGACATGTCTGATAAAAGAC TGTTACCCAAAATATACAAAGAAGTCTTAAAGCTTCACAATAAGCACATGAAAAACCTGAT TTAAAAAAAATGGGCCAAAAACCTGAAGAGATATATCACTAAAGAAGATATACTGAGGGC AAGTAAATATTTGGAAAGACAGTCCATCTCATATGCCTAGGGAAATGTAAATTACAACAAA AATGAGATAGCACTTCAGACCGAGTAGAATGGCTACAATCTAAAATAGTGACAACAGCAA ATTCTGACGAAGATGTAGAATAGTAGAAACTCTCATTCGTTGCTGTTGGGAATGCAAAATG GGACAGCCACTTTGGAAGACAGTTTGAAAGTTTCTTATGAAATTATACAACCTCTTACCAC ACGATAGAGCAGTATCACTCTTTGATATTTACCCAAGCAAGTTGAACACTTACATCTACAC ACAAAGCTGCACAAGGATGCTTGTAACAGATTTTATTCATCATTGCCAAAACATGGAAGCA GCCATGATGTCCTTCTGTAGGAGGATGGATAAACTGTGGTATACTCAGACAATGGAATGT TATGTATTGCCAAAAAGAAATGAGCTATGAAGTCATAAAAAGACATGGAAGAACATAAAA TGCATATTGTTAAGTTAAGGAAGCCAATCTGAAAAAGCTACATACTGTATGATTCCATATA TTTGACATTCTGGAAAAGGCAAAACTATTGCCATAGTAAAATAATCAGTTGTTGCCAAGGG CTTGGAGGGGTGAAGGATGAATAGGTGGGTGGAGGCCAGATGATTAGGGCCATGAAAAT AATCTGCATGACACTATAATGATGGATACCTGCCATTATACATTTATCCAAATCCACAGAAT GTACAACACCAAGAGTGAGCCTAATGTGGACTACGCATGTTGGATGATTATGATGTGTCA TTGTGGATGCACTGATCGTAACACATGTACCACCGAGTGGGGGTGGTTGTGTATGTGTGG GGATAGACACTATGTGGAAGGCTCTGCATTTTCCATTCATG Figure 7: The DNA sequence of the human Sox11 Promoter (~2 kb) showing potential NF-I binding sites using TESS database. The eleven NF-I binding sites are 28

37 shown in green. The Sox11 5 non-coding segment is shown in blue and the start ATG is shown in red Figure 8: Sox11 promoter 2.5 kb segment showing location of the NF-I binding sites using the Genomatix database. A total of three sites were identified shown as pink bars in the figure. 29

38 Seq ( ) aaaccagatttggcaaattttaaaattgtgctttcaaaattgactatcatttctttta Class lbp rbp Segments: ====NF1== ======================================================================= Seq ( ) gttctagccaatgcctggttaacaggaacagtgtgaacacgtgaaacagtgtgatctgaa Class lbp rbp Segments: ====NF-1== ==== NF-1== ======================================================================= Seq ( ) gagtcatgccttgcttgcattgcaaagggacgtggattttgtcctaatggtgaagggcat Class lbp rbp Segments: ====NF- 1== ======================================================================= Seq ( ) gtaaaagacactatcaagaaaatgagaaaacaagccacagactaggggaagttatttgca Class lbp rbp Segments: ====NF-1== ======================================================================= Figure 9: A portions of the ALIBABA2 (TRANSFAC) database showing location of NF-I potential binding sites on human SOX11 promoter segment analyzed. Factor Model Beg Len Sequence T00535 NF-1 Q00112 (-) GCCAAA T00535 NF-1 Q00112 (-) GCCAAA _00000 NF1 I00296 (NF1) GGCAAG _00000 NF1 I00296 (NF1) CTTGGA T00535 NF-1 Q00112 (-) GCCAAT T00535 NF-1 Q00112 (-) GCCAGA T00535 NF-1 Q00112 (-) GCCAAA T00539 NF-1 R00802 () GGAAAG T00535 NF-1 Q00112 (-) GCCAAA Figure 10: NF-I potential binding sites location and sequence on human SOX11 promoter region using the TESS database. 30

39 Figure 11: Summary of the three computational approaches for identifying the location of potential NF-I binding motifs on human SOX11 promoter. TESS, AliBABA2 and GENOMATIX databases were used and potential sites (red) recognized are differentially distributed in the human Sox11 promoter. One binding site was unanimously shown in the three various databases (blue) indicating that this site may be functional. Transient Over-expression of NFI-C In order to determine whether NFI-C can regulate the promoter activity of Sox11 expression, a plasmid containing the full length NFI-C transcript was transfected into PDL RDD cells. The negative control for these experiments was transfection with the empty vector. Cells were transfected using Lipofectamine 2000 according to the 31

40 manufactures protocol. Cells were harvest after 96 hours post-transfection and qrt PCR analysis performed for determination of the levels of Sox11 transcripts. Quantitative RT PCR shows a 4.5 fold increase in Sox11 gene expression in the NFIC transfected RDD PDL cells as compared to the non transfected RDD PDL cells. Ct values (threshold cycles) were normalized to GAPDH by subtracting the target gene from the GAPDH control. A ΔΔCt value was then calculated by subtracting the normalized experimental Ct from the normalized control condition with fold change reported as 2 ΔΔCt. Figure 12: Quantitative RT-PCR analysis of Sox11 transcript levels resulting from the over-expression of NFI-C. Transfected AR RDD PDL cells showed an increase of 4.5 fold in the Sox11 transcripts as compared to the empty vector transfected RDD cells. 32

41 DISCUSSION It is well known that the crown is formed during the embryonic stage of tooth formation, whereas the root is formed postnatally. Tissue recombination studies [48] have demonstrated that teeth develop through the epithelial mesenchymal interaction between the dental epithelium and cranial neural ectomesenchym. Upon completion of crown formation, the inner and outer enamel epithelial cells proliferate apically and form HERS [49,50]. It is generally agreed that HERS has a key role in determining the shape of the root and in the induction of the differentiation into odontoblasts responsible for radicular dentin formation. As ectomesenchymal cells differentiate into preodontoblasts and eventually odontoblasts, they become elongated and highly polarized. They have the nuclei at the base of cells, the Golgi complex at the supranuclear region, and rough endoplasmic reticulum at the periphery of cell bodies. As preodontoblasts differentiate into odontoblasts, they are joined and attached at their distal end of cell bodies by welldeveloped terminal webs of cytoskeletal actins [51-53] This junctional complex is responsible for the alignment of odontoblast as a single layer of cells functioning as a unit, maintaining a uniformly even dentin surface, and preventing their entrapment in the predentin [54,55]. Therefore, these junctional complexes seem to play a crucial role in the formation and maintenance of smooth-surfaced predentin and dentin. More importantly, unlike osteocytes and chondrocytes, odontoblasts are not usually trapped in mineralized tissue but located on the pulpal surface of the dentin. 33

42 As ectomesenchymal cells differentiate into preodontoblasts, they synthesize and secrete types I and III collagen, osteopontin, and dentin matrix protein-1 [56]. Further, when preodontoblasts differentiate into odontoblast, they actively synthesize and deposit dentin sialophosphoprotein (DSPP), the odontoblast /dentin marker protein [56].With the deposition of dentin matrix, the odontoblast cell bodies move away from the predentin/dentin, leaving the odontoblastis processes embedded within dentinal tubules in the predentin/dentin. Odontoblasts are responsible for the formation and maintenance of the predentin and dentin. In this study we showed that Sox11 at early stage of tooth formation (E-16) is expressed strongly in the inner and outer enamel epithelium as well in the ectomesenchymal cells of the DP. Increased staining is seen with the cytodifferentiation of extracellular matrix formation cells the enamel forming ameloblasts and dentin forming odontoblasts. This is correlated with increase nuclear staining of Sox11 within the cells. When root formation is beginning at PN day 8, Sox11 is expressed strongly in the dental epithelial tissues of the tooth, including the secretory ameloblasts. Within the pulpal tissues, strong levels of Sox11 protein are seen in the odontoblasts with lower levels in the DP. At PN dau 12 and 13, when molar root formation is in progress, Sox11 expression appears more restricted being present within the odontoblasts and preodontoblasts of the molars and within the periodontal ligament and developing bone and it is negative in the enamel space and ameloblasts. Thus, Sox11 is expressed at multiple stages of tooth development and strongly in odontoblasts and preodontoblasts during root formation. Periodontal ligaments throughout root formation were also positive. 34