SVIM: Structural variant identification with long reads DAVID HELLER MAX PLANCK INSTITUTE FOR MOLECULAR GENETICS, BERLIN JUNE 2O18, SMRT LEIDEN

Size: px
Start display at page:

Download "SVIM: Structural variant identification with long reads DAVID HELLER MAX PLANCK INSTITUTE FOR MOLECULAR GENETICS, BERLIN JUNE 2O18, SMRT LEIDEN"

Transcription

1 SVIM: Structural variant identification with long reads DAVID HELLER MAX PLANCK INSTITUTE FOR MOLECULAR GENETICS, BERLIN JUNE 2O18, SMRT LEIDEN

2 Structural variation (SV) Variants larger than 50bps Affect more base pairs than SNVs and Indels Large influence on phenotype and disease 2

3 Long read alignments (.bam) SVIM Structural Variant caller for PacBio reads Detects six different classes of SVs with high precision and sensitivity Deletions (1) Collect SV evidences Evidences in read alignments (DEL, INS) SV evidences Evidences between split alignments (DEL, INS, INV, BRK, DUP) (2) Cluster SV evidences by their genomic location and span SV evidence clusters (3) Confirm / Genotype evidence clusters: Count local reads supporting ref/alt allele Analyze read alignments SV evidence clusters + support Dotplot analysis (4) Merge and classify SV evidence clusters Interspersed Duplications Cut&Paste Insertions Novel Insertions Inversions Tandem duplications COLLECT CONFIRM COMBINE 3

4 1. Collect SV evidences (1) Collect SV evidences Evidences in read alignments (DEL, INS) Long read alignments (.bam) SV evidences Evidences between split alignments (DEL, INS, INV, BRK, DUP) (2) Cluster SV evidences by their genomic location and span COLLECT Collect evidences for SVs from each individual read Search.. in alignments for long gaps in reference or read (CIGAR string) between alignments for discordant positions and orientations that indicate deleted, inserted, inverted, chimeric or duplicated pieces Collected SV evidences are mere hints to SVs Multiple hints need to be combined to pinpoint exact type and location of the event è Clustering of SV evidences 4

5 Clustering of SVs Merges evidences from multiple reads Helps to distinguish correct evidences from errors (e.g. sequencing error, alignment error) Span-position distance consists of position distance (difference in location) and span distance (diff. in length) Genome Deletion evidences 5

6 2. Confirm SVs (3) Confirm / Genotype evidence clusters: Count local reads supporting ref/alt allele Analyze read alignments SV evidence clusters Dotplot analysis CONFIRM Count number of reads that support / contradict each SV for: Confirmation (many contradicting reads indicate false positive) Genotyping (~50% supporting reads indicates heterozygous event, ~100% indicate homozygous) Two orthogonal approaches Read alignment analysis (alignment-based) Dotplot analysis (k-mer based) 6

7 Combine SVs Deletions SV evidence clusters + support (4) Merge and classify SV evidence clusters Interspersed Duplications Cut&Paste Insertions Novel Insertions Inversions Tandem duplications COMBINE Combine multiple SVs to classify higher-order events Deletion of sequence S + Insertion of sequence S somewhere else è Cut&Paste Insertion Deletion of sequence S è Deletion Insertion of sequence S è Duplication Insertion of novel sequence N è Novel Insertion 7

8 Results 8

9 Results on 6x simulated dataset 1.00 Deletions Insertions 1.00 Deletions Insertions Homozygous Precision Inversions Tandem Duplications Tool PBHoney Spots PBHoney Tails SVIM Sniffles Precision Inversions Tandem Duplications Heterozygous Recall Recall 9

10 Results on public 53x real dataset Genome in a Bottle dataset for NA12878 individual 53x coverage PacBio data (SRR ) 2676 / 68 high-confidence deletion / insertion calls Parikh, Hemang, et al. "svclassify: a method to establish benchmark structural variant calls." BMC genomics 17.1 (2016): 64. Precision Deletions Insertions Recall 53x coverage 6x coverage Tool PBHoney Spots PBHoney Tails SVIM Sniffles 10

11 Results on public 53x real dataset Implant SVs into the reference genome Align reads to this altered reference genome This simulates inverse of implanted SV: 100 deletions are simulated by inserting sequence into the reference genome. 100 inversions are simulated by inverting regions in the reference. 100 insertions are simulated by moving regions in the reference. Precision Deletions Inversions Cut&Paste Insertions Recall 53x coverage 6x coverage Tool PBHoney Spots PBHoney Tails SVIM Sniffles 11

12 Conclusion SVIM is a tool for SV detection from PacBio reads It detects and distinguishes six different SV classes Determines genomic origin and destination of insertions and duplications Improved recall and precision compared to competing methods Large improvement on low-coverage datasets github.com/eldariont/svim 12

13 Acknowledgements Martin Vingron NGMLR : Fritz Sedlazeck and Philipp Rescheneder Thanks for your attention! Questions?!" heller_d@molgen.mpg.de github.com/eldariont/svim 13

14 Runtime comparison Tool Threads CPU time (min) Wall clock time (min) PBHoney-Spots PBHoney-Spots PBHoney-Tails Sniffles Sniffles SVIM

15 Simulation protocol Simulated genome (chr21 and chr22 only) with 100 deletions, 100 insertions, 100 tandem duplications, 100 interspersed duplications, 100 inversions between 100bps and 10kbps in size (RSVSim) Simulated long reads to 6-fold coverage (SimLoRD) Run different SV callers on simulated reads Compare detected SVs with simulated (correct) SVs (require 90% reciprocal overlap) Bartenhagen, C., & Dugas, M. (2013). RSVSim: an R/Bioconductor package for the simulation of structural variations. Bioinformatics, 29(13), Stöcker, B. K., Köster, J., & Rahmann, S. (2016). Simlord: Simulation of long read data. Bioinformatics, 32(17),

16 Dotplot analysis Read Deletion Reference 16

Comprehensive Genome and Transcriptome Structural Analysis of a Breast Cancer Cell Line using PacBio Long Read Sequencing

Comprehensive Genome and Transcriptome Structural Analysis of a Breast Cancer Cell Line using PacBio Long Read Sequencing Comprehensive Genome and Transcriptome Structural Analysis of a Breast Cancer Cell Line using PacBio Long Read Sequencing Maria Nattestad Schatz + McCombie + Hicks at Cold Spring Harbor Laboratory McPherson

More information

CRISPR/Cas9 Enrichment and Long-read WGS for Structural Variant Discovery

CRISPR/Cas9 Enrichment and Long-read WGS for Structural Variant Discovery CRISPR/Cas9 Enrichment and Long-read WGS for Structural Variant Discovery PacBio CoLab Session October 20, 2017 For Research Use Only. Not for use in diagnostics procedures. Copyright 2017 by Pacific Biosciences

More information

Dr Rick Tearle Senior Applications Specialist, EMEA Complete Genomics Complete Genomics, Inc.

Dr Rick Tearle Senior Applications Specialist, EMEA Complete Genomics Complete Genomics, Inc. Dr Rick Tearle Senior Applications Specialist, EMEA Complete Genomics Topics Overview of Data Processing Pipeline Overview of Data Files 2 DNA Nano-Ball (DNB) Read Structure Genome : acgtacatgcattcacacatgcttagctatctctcgccag

More information

Illuminating the genetics of complex human diseases

Illuminating the genetics of complex human diseases Illuminating the genetics of complex human diseases Michael Schatz Sept 27, 2012 Beyond the Genome @mike_schatz / #BTG2012 Outline 1. De novo mutations in human diseases 1. Autism Spectrum Disorder 2.

More information

CITATION FILE CONTENT/FORMAT

CITATION FILE CONTENT/FORMAT CITATION For any resultant publications using please cite: Matthew A. Field, Vicky Cho, T. Daniel Andrews, and Chris C. Goodnow (2015). "Reliably detecting clinically important variants requires both combined

More information

Nature Biotechnology: doi: /nbt.1904

Nature Biotechnology: doi: /nbt.1904 Supplementary Information Comparison between assembly-based SV calls and array CGH results Genome-wide array assessment of copy number changes, such as array comparative genomic hybridization (acgh), is

More information

PSSV User Manual (V1.0)

PSSV User Manual (V1.0) PSSV User Manual (V1.0) 1. Introduction A novel pattern-based probabilistic approach, PSSV, is developed to identify somatic structural variations from WGS data. Specifically, discordant and concordant

More information

DNA-seq Bioinformatics Analysis: Copy Number Variation

DNA-seq Bioinformatics Analysis: Copy Number Variation DNA-seq Bioinformatics Analysis: Copy Number Variation Elodie Girard elodie.girard@curie.fr U900 institut Curie, INSERM, Mines ParisTech, PSL Research University Paris, France NGS Applications 5C HiC DNA-seq

More information

Structural Variation and Medical Genomics

Structural Variation and Medical Genomics Structural Variation and Medical Genomics Andrew King Department of Biomedical Informatics July 8, 2014 You already know about small scale genetic mutations Single nucleotide polymorphism (SNPs) Deletions,

More information

LEIDEN, THE NETHERLANDS

LEIDEN, THE NETHERLANDS Full-length CYP2D6 diplotyping for better drug dosage and response management Henk Buermans, PhD Leiden University Medical Center Human Genetics, LGTC LEIDEN, THE NETHERLANDS CYP2D6 Function Metabolism

More information

Supplementary Information. Supplementary Figures

Supplementary Information. Supplementary Figures Supplementary Information Supplementary Figures.8 57 essential gene density 2 1.5 LTR insert frequency diversity DEL.5 DUP.5 INV.5 TRA 1 2 3 4 5 1 2 3 4 1 2 Supplementary Figure 1. Locations and minor

More information

PSSV User Manual (V2.1)

PSSV User Manual (V2.1) PSSV User Manual (V2.1) 1. Introduction A novel pattern-based probabilistic approach, PSSV, is developed to identify somatic structural variations from WGS data. Specifically, discordant and concordant

More information

Variant Classification. Author: Mike Thiesen, Golden Helix, Inc.

Variant Classification. Author: Mike Thiesen, Golden Helix, Inc. Variant Classification Author: Mike Thiesen, Golden Helix, Inc. Overview Sequencing pipelines are able to identify rare variants not found in catalogs such as dbsnp. As a result, variants in these datasets

More information

Genome. Institute. GenomeVIP: A Genomics Analysis Pipeline for Cloud Computing with Germline and Somatic Calling on Amazon s Cloud. R. Jay Mashl.

Genome. Institute. GenomeVIP: A Genomics Analysis Pipeline for Cloud Computing with Germline and Somatic Calling on Amazon s Cloud. R. Jay Mashl. GenomeVIP: the Genome Institute at Washington University A Genomics Analysis Pipeline for Cloud Computing with Germline and Somatic Calling on Amazon s Cloud R. Jay Mashl October 20, 2014 Turnkey Variant

More information

Calling DNA variants SNVs, CNVs, and SVs. Steve Laurie Variant Effect Predictor Training Course Prague, 6 th November 2017

Calling DNA variants SNVs, CNVs, and SVs. Steve Laurie Variant Effect Predictor Training Course Prague, 6 th November 2017 1 Calling DNA variants SNVs, CNVs, and SVs Steve Laurie Variant Effect Predictor Training Course Prague, 6 th November 2017 Calling DNA variants SNVs, CNVs, SVs 2 1. What is a variant? 2. Paired End read

More information

BWA alignment to reference transcriptome and genome. Convert transcriptome mappings back to genome space

BWA alignment to reference transcriptome and genome. Convert transcriptome mappings back to genome space Whole genome sequencing Whole exome sequencing BWA alignment to reference transcriptome and genome Convert transcriptome mappings back to genome space genomes Filter on MQ, distance, Cigar string Annotate

More information

MEDICAL GENOMICS LABORATORY. Next-Gen Sequencing and Deletion/Duplication Analysis of NF1 Only (NF1-NG)

MEDICAL GENOMICS LABORATORY. Next-Gen Sequencing and Deletion/Duplication Analysis of NF1 Only (NF1-NG) Next-Gen Sequencing and Deletion/Duplication Analysis of NF1 Only (NF1-NG) Ordering Information Acceptable specimen types: Fresh blood sample (3-6 ml EDTA; no time limitations associated with receipt)

More information

Shape-based retrieval of CNV regions in read coverage data. Sangkyun Hong and Jeehee Yoon*

Shape-based retrieval of CNV regions in read coverage data. Sangkyun Hong and Jeehee Yoon* 254 Int. J. Data Mining and Bioinformatics, Vol. 9, No. 3, 2014 Shape-based retrieval of CNV regions in read coverage data Sangkyun Hong and Jeehee Yoon* Department of Computer Engineering, Hallym University

More information

Genomic structural variation

Genomic structural variation Genomic structural variation Mario Cáceres The new genomic variation DNA sequence differs across individuals much more than researchers had suspected through structural changes A huge amount of structural

More information

Introduction to LOH and Allele Specific Copy Number User Forum

Introduction to LOH and Allele Specific Copy Number User Forum Introduction to LOH and Allele Specific Copy Number User Forum Jonathan Gerstenhaber Introduction to LOH and ASCN User Forum Contents 1. Loss of heterozygosity Analysis procedure Types of baselines 2.

More information

COMPUTATIONAL OPTIMISATION OF TARGETED DNA SEQUENCING FOR CANCER DETECTION

COMPUTATIONAL OPTIMISATION OF TARGETED DNA SEQUENCING FOR CANCER DETECTION COMPUTATIONAL OPTIMISATION OF TARGETED DNA SEQUENCING FOR CANCER DETECTION Pierre Martinez, Nicholas McGranahan, Nicolai Juul Birkbak, Marco Gerlinger, Charles Swanton* SUPPLEMENTARY INFORMATION SUPPLEMENTARY

More information

Analysis with SureCall 2.1

Analysis with SureCall 2.1 Analysis with SureCall 2.1 Danielle Fletcher Field Application Scientist July 2014 1 Stages of NGS Analysis Primary analysis, base calling Control Software FASTQ file reads + quality 2 Stages of NGS Analysis

More information

Variations in Chromosome Structure & Function. Ch. 8

Variations in Chromosome Structure & Function. Ch. 8 Variations in Chromosome Structure & Function Ch. 8 1 INTRODUCTION! Genetic variation refers to differences between members of the same species or those of different species Allelic variations are due

More information

Global variation in copy number in the human genome

Global variation in copy number in the human genome Global variation in copy number in the human genome Redon et. al. Nature 444:444-454 (2006) 12.03.2007 Tarmo Puurand Study 270 individuals (HapMap collection) Affymetrix 500K Whole Genome TilePath (WGTP)

More information

DETECTION OF LOW FREQUENCY CXCR4-USING HIV-1 WITH ULTRA-DEEP PYROSEQUENCING. John Archer. Faculty of Life Sciences University of Manchester

DETECTION OF LOW FREQUENCY CXCR4-USING HIV-1 WITH ULTRA-DEEP PYROSEQUENCING. John Archer. Faculty of Life Sciences University of Manchester DETECTION OF LOW FREQUENCY CXCR4-USING HIV-1 WITH ULTRA-DEEP PYROSEQUENCING John Archer Faculty of Life Sciences University of Manchester HIV Dynamics and Evolution, 2008, Santa Fe, New Mexico. Overview

More information

Names: Period: Punnett Square for Sex Chromosomes:

Names: Period: Punnett Square for Sex Chromosomes: Names: Period: Human Variations Activity Background A large variety of traits exist in the human population. The large number of combinations of these traits causes individuals to look unique, or different,

More information

Supplementary note: Comparison of deletion variants identified in this study and four earlier studies

Supplementary note: Comparison of deletion variants identified in this study and four earlier studies Supplementary note: Comparison of deletion variants identified in this study and four earlier studies Here we compare the results of this study to potentially overlapping results from four earlier studies

More information

Global assessment of genomic variation in cattle by genome resequencing and high-throughput genotyping

Global assessment of genomic variation in cattle by genome resequencing and high-throughput genotyping RESEARCH ARTICLE Open Access Global assessment of genomic variation in cattle by genome resequencing and high-throughput genotyping Bujie Zhan 1, João Fadista 1, Bo Thomsen 1, Jakob Hedegaard 1,2, Frank

More information

Next Generation Sequencing as a tool for breakpoint analysis in rearrangements of the globin-gene clusters

Next Generation Sequencing as a tool for breakpoint analysis in rearrangements of the globin-gene clusters Next Generation Sequencing as a tool for breakpoint analysis in rearrangements of the globin-gene clusters XXXth International Symposium on Technical Innovations in Laboratory Hematology Honolulu, Hawaii

More information

De Novo Viral Quasispecies Assembly using Overlap Graphs

De Novo Viral Quasispecies Assembly using Overlap Graphs De Novo Viral Quasispecies Assembly using Overlap Graphs Alexander Schönhuth joint with Jasmijn Baaijens, Amal Zine El Aabidine, Eric Rivals Milano 18th of November 2016 Viral Quasispecies Assembly: HaploClique

More information

Towards Personalized Medicine: An Improved De Novo Assembly Procedure for Early Detection of Drug Resistant HIV Minor Quasispecies in Patient Samples

Towards Personalized Medicine: An Improved De Novo Assembly Procedure for Early Detection of Drug Resistant HIV Minor Quasispecies in Patient Samples www.bioinformation.net Volume 14(8) Software Model Towards Personalized Medicine: An Improved De Novo Assembly Procedure for Early Detection of Drug Resistant HIV Minor Quasispecies in Patient Samples

More information

UNIT 3 GENETICS LESSON #30: TRAITS, GENES, & ALLELES. Many things come in many forms. Give me an example of something that comes in many forms.

UNIT 3 GENETICS LESSON #30: TRAITS, GENES, & ALLELES. Many things come in many forms. Give me an example of something that comes in many forms. UNIT 3 GENETICS LESSON #30: TRAITS, GENES, & ALLELES Many things come in many forms. Give me an example of something that comes in many forms. Genes, too, come in many forms. Main Idea #1 The same gene

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature13908 Supplementary Tables Supplementary Table 1: Families in this study (.xlsx) All families included in the study are listed. For each family, we show: the genders of the probands and

More information

Abstract. Optimization strategy of Copy Number Variant calling using Multiplicom solutions APPLICATION NOTE. Introduction

Abstract. Optimization strategy of Copy Number Variant calling using Multiplicom solutions APPLICATION NOTE. Introduction Optimization strategy of Copy Number Variant calling using Multiplicom solutions Michael Vyverman, PhD; Laura Standaert, PhD and Wouter Bossuyt, PhD Abstract Copy number variations (CNVs) represent a significant

More information

Golden Helix s End-to-End Solution for Clinical Labs

Golden Helix s End-to-End Solution for Clinical Labs Golden Helix s End-to-End Solution for Clinical Labs Steven Hystad - Field Application Scientist Nathan Fortier Senior Software Engineer 20 most promising Biotech Technology Providers Top 10 Analytics

More information

DETECTING HIGHLY DIFFERENTIATED COPY-NUMBER VARIANTS FROM POOLED POPULATION SEQUENCING

DETECTING HIGHLY DIFFERENTIATED COPY-NUMBER VARIANTS FROM POOLED POPULATION SEQUENCING DETECTING HIGHLY DIFFERENTIATED COPY-NUMBER VARIANTS FROM POOLED POPULATION SEQUENCING DANIEL R. SCHRIDER * Department of Biology and School of Informatics and Computing, Indiana University, 1001 E Third

More information

Unit 5 Review Name: Period:

Unit 5 Review Name: Period: Unit 5 Review Name: Period: 1 4 5 6 7 & give an example of the following. Be able to apply their meanings: Homozygous Heterozygous Dominant Recessive Genotype Phenotype Haploid Diploid Sex chromosomes

More information

Review: Genome assembly Reads

Review: Genome assembly Reads Assembly validation Review: Genome assembly Reads Contigs Scaffolds Chromosome Review: Mate pair data Overlap-Layout-Consensus AMOS project: A Modular Open Source assembler Importing data to an AMOS bank

More information

Developmental Psychology 2017

Developmental Psychology 2017 Developmental Psychology 2017 Table of Contents Lecture Notes pp. 2-29 Theorists, Theories & Evaluation pp. 29 36 Revision Questions (for all lectures) pp. 36-54 Lecture Notes Intro to Development Development

More information

Colorspace & Matching

Colorspace & Matching Colorspace & Matching Outline Color space and 2-base-encoding Quality Values and filtering Mapping algorithm and considerations Estimate accuracy Coverage 2 2008 Applied Biosystems Color Space Properties

More information

Research Strategy: 1. Background and Significance

Research Strategy: 1. Background and Significance Research Strategy: 1. Background and Significance 1.1. Heterogeneity is a common feature of cancer. A better understanding of this heterogeneity may present therapeutic opportunities: Intratumor heterogeneity

More information

Multiple Copy Number Variations in a Patient with Developmental Delay ASCLS- March 31, 2016

Multiple Copy Number Variations in a Patient with Developmental Delay ASCLS- March 31, 2016 Multiple Copy Number Variations in a Patient with Developmental Delay ASCLS- March 31, 2016 Marwan Tayeh, PhD, FACMG Director, MMGL Molecular Genetics Assistant Professor of Pediatrics Department of Pediatrics

More information

Introduction to genetic variation. He Zhang Bioinformatics Core Facility 6/22/2016

Introduction to genetic variation. He Zhang Bioinformatics Core Facility 6/22/2016 Introduction to genetic variation He Zhang Bioinformatics Core Facility 6/22/2016 Outline Basic concepts of genetic variation Genetic variation in human populations Variation and genetic disorders Databases

More information

Andrew Parrish, Richard Caswell, Garan Jones, Christopher M. Watson, Laura A. Crinnion 3,4, Sian Ellard 1,2

Andrew Parrish, Richard Caswell, Garan Jones, Christopher M. Watson, Laura A. Crinnion 3,4, Sian Ellard 1,2 METHOD ARTICLE An enhanced method for targeted next generation sequencing copy number variant detection using ExomeDepth [version 1; referees: 1 approved, 1 approved with reservations] 1 2 1 3,4 Andrew

More information

Supplementary Figure 1. Estimation of tumour content

Supplementary Figure 1. Estimation of tumour content Supplementary Figure 1. Estimation of tumour content a, Approach used to estimate the tumour content in S13T1/T2, S6T1/T2, S3T1/T2 and S12T1/T2. Tissue and tumour areas were evaluated by two independent

More information

Spectrum of mutations in monogenic diabetes genes identified from high-throughput DNA sequencing of 6888 individuals

Spectrum of mutations in monogenic diabetes genes identified from high-throughput DNA sequencing of 6888 individuals Bansal et al. BMC Medicine (2017) 15:213 DOI 10.1186/s12916-017-0977-3 RESEARCH ARTICLE Spectrum of mutations in monogenic diabetes genes identified from high-throughput DNA sequencing of 6888 individuals

More information

Mutation Detection and CNV Analysis for Illumina Sequencing data from HaloPlex Target Enrichment Panels using NextGENe Software for Clinical Research

Mutation Detection and CNV Analysis for Illumina Sequencing data from HaloPlex Target Enrichment Panels using NextGENe Software for Clinical Research Mutation Detection and CNV Analysis for Illumina Sequencing data from HaloPlex Target Enrichment Panels using NextGENe Software for Clinical Research Application Note Authors John McGuigan, Megan Manion,

More information

CNV detection. Introduction and detection in NGS data. G. Demidov 1,2. NGSchool2016. Centre for Genomic Regulation. CNV detection. G.

CNV detection. Introduction and detection in NGS data. G. Demidov 1,2. NGSchool2016. Centre for Genomic Regulation. CNV detection. G. Introduction and detection in NGS data 1,2 1 Genomic and Epigenomic Variation in Disease group, Centre for Genomic Regulation 2 Universitat Pompeu Fabra NGSchool2016 methods: methods Outline methods: methods

More information

Assessing Laboratory Performance for Next Generation Sequencing Based Detection of Germline Variants through Proficiency Testing

Assessing Laboratory Performance for Next Generation Sequencing Based Detection of Germline Variants through Proficiency Testing Assessing Laboratory Performance for Next Generation Sequencing Based Detection of Germline Variants through Proficiency Testing Karl V. Voelkerding, MD Professor of Pathology University of Utah Medical

More information

Supplemental Tables and Figures

Supplemental Tables and Figures Supplemental Tables and Figures Post-zygotic de novo changes in glutamate and dopamine pathways may explain discordance of monozygotic twins for schizophrenia Castellani, CA., Melka, MG., Gui, JL., Gallo,

More information

Linked read sequencing resolves complex genomic rearrangements in gastric cancer metastases

Linked read sequencing resolves complex genomic rearrangements in gastric cancer metastases Greer et al. Genome Medicine (2017) 9:57 DOI 10.1186/s13073-017-0447-8 RESEARCH Linked read sequencing resolves complex genomic rearrangements in gastric cancer metastases Open Access Stephanie U. Greer

More information

Chapter 15: The Chromosomal Basis of Inheritance

Chapter 15: The Chromosomal Basis of Inheritance Name Period Chapter 15: The Chromosomal Basis of Inheritance Concept 15.1 Mendelian inheritance has its physical basis in the behavior of chromosomes 1. What is the chromosome theory of inheritance? 2.

More information

Chromosome Structure & Recombination

Chromosome Structure & Recombination Chromosome Structure & Recombination (CHAPTER 8- Brooker Text) April 4 & 9, 2007 BIO 184 Dr. Tom Peavy Genetic variation refers to differences between members of the same species or those of different

More information

6/12/2018. Disclosures. Clinical Genomics The CLIA Lab Perspective. Outline. COH HopeSeq Heme Panels

6/12/2018. Disclosures. Clinical Genomics The CLIA Lab Perspective. Outline. COH HopeSeq Heme Panels Clinical Genomics The CLIA Lab Perspective Disclosures Raju K. Pillai, M.D. Hematopathologist / Molecular Pathologist Director, Pathology Bioinformatics City of Hope National Medical Center, Duarte, CA

More information

CHR POS REF OBS ALLELE BUILD CLINICAL_SIGNIFICANCE

CHR POS REF OBS ALLELE BUILD CLINICAL_SIGNIFICANCE CHR POS REF OBS ALLELE BUILD CLINICAL_SIGNIFICANCE is_clinical dbsnp MITO GENE chr1 13273 G C heterozygous - - -. - DDX11L1 chr1 949654 A G Homozygous 52 - - rs8997 - ISG15 chr1 1021346 A G heterozygous

More information

TOWARDS ACCURATE GERMLINE AND SOMATIC INDEL DISCOVERY WITH MICRO-ASSEMBLY. Giuseppe Narzisi, PhD Bioinformatics Scientist

TOWARDS ACCURATE GERMLINE AND SOMATIC INDEL DISCOVERY WITH MICRO-ASSEMBLY. Giuseppe Narzisi, PhD Bioinformatics Scientist TOWARDS ACCURATE GERMLINE AND SOMATIC INDEL DISCOVERY WITH MICRO-ASSEMBLY Giuseppe Narzisi, PhD Bioinformatics Scientist July 29, 2014 Micro-Assembly Approach to detect INDELs 2 Outline 1 Detecting INDELs:

More information

Genetics 275 Examination February 10, 2003.

Genetics 275 Examination February 10, 2003. Genetics 275 Examination February 10, 2003. Do all questions in the spaces provided. The value for this examination is twenty marks (20% of the grade for the course). The value for individual questions

More information

BECAUSE all genetic variation on which natural selection

BECAUSE all genetic variation on which natural selection INVESTIGATION Rates and Genomic Consequences of Spontaneous Mutational Events in Drosophila melanogaster Daniel R. Schrider,*,,1 David Houle, Michael Lynch,* and Matthew W. Hahn*, *Department of Biology

More information

GENOME-WIDE ASSOCIATION STUDIES

GENOME-WIDE ASSOCIATION STUDIES GENOME-WIDE ASSOCIATION STUDIES SUCCESSES AND PITFALLS IBT 2012 Human Genetics & Molecular Medicine Zané Lombard IDENTIFYING DISEASE GENES??? Nature, 15 Feb 2001 Science, 16 Feb 2001 IDENTIFYING DISEASE

More information

InGen: Dino Genetics Lab Lab Related Activity: DNA and Genetics

InGen: Dino Genetics Lab Lab Related Activity: DNA and Genetics This activity is meant to extend your students knowledge of the topics covered in our DNA and Genetics lab. Through this activity, pairs of students will play with dominant and recessive alleles to create

More information

Chromosomal Mutations

Chromosomal Mutations Notes 2/17 Chromosomal Mutations A chromosome mutation is an unpredictable change that occurs in a chromosome. These changes are most often brought on by problems that occur during meiosis or by mutagens

More information

Reducing INDEL calling errors in whole genome and exome sequencing data.

Reducing INDEL calling errors in whole genome and exome sequencing data. Reducing INDEL calling errors in whole genome and exome sequencing data. Han Fang November 8, 2014 CSHL Biological Data Science Meeting Acknowledgments Lyon Lab Yiyang Wu Jason O Rawe Laura J Barron Max

More information

Advance Your Genomic Research Using Targeted Resequencing with SeqCap EZ Library

Advance Your Genomic Research Using Targeted Resequencing with SeqCap EZ Library Advance Your Genomic Research Using Targeted Resequencing with SeqCap EZ Library Marilou Wijdicks International Product Manager Research For Life Science Research Only. Not for Use in Diagnostic Procedures.

More information

Home Brewed Personalized Genomics

Home Brewed Personalized Genomics Home Brewed Personalized Genomics The Quest for Meaningful Analysis Results of a 23andMe Exome Pilot Trio of Myself, Wife, and Son February 22, 2013 Gabe Rudy, Vice President of Product Development Exome

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi: 1.138/nature8645 Physical coverage (x haploid genomes) 11 6.4 4.9 6.9 6.7 4.4 5.9 9.1 7.6 125 Neither end mapped One end mapped Chimaeras Correct Reads (million ns) 1 75 5 25 HCC1187 HCC1395 HCC1599

More information

Performance Characteristics BRCA MASTR Plus Dx

Performance Characteristics BRCA MASTR Plus Dx Performance Characteristics BRCA MASTR Plus Dx with drmid Dx for Illumina NGS systems Manufacturer Multiplicom N.V. Galileïlaan 18 2845 Niel Belgium Table of Contents 1. Workflow... 4 2. Performance Characteristics

More information

Below, we included the point-to-point response to the comments of both reviewers.

Below, we included the point-to-point response to the comments of both reviewers. To the Editor and Reviewers: We would like to thank the editor and reviewers for careful reading, and constructive suggestions for our manuscript. According to comments from both reviewers, we have comprehensively

More information

Modeling Chromosome Inheritance

Modeling Chromosome Inheritance Task 2 Modeling Chromosome Inheritance In this task, you will model chromosome inheritance from parent to offspring for the species you created in task 1. You will use the genotypes you developed for the

More information

Human Genetic Disorders

Human Genetic Disorders Human Genetic Disorders HOMOLOGOUS CHROMOSOMES Human somatic cells have 23 pairs of homologous chromosomes 23 are inherited from the mother and 23 from the father HOMOLOGOUS CHROMOSOMES Autosomes o Are

More information

Issues arising from UKNEQAS schemes. Ottie O Brien, Northern Genetics Service, Newcastle, UK 15 th May 2014

Issues arising from UKNEQAS schemes. Ottie O Brien, Northern Genetics Service, Newcastle, UK 15 th May 2014 Issues arising from UKNEQAS schemes Ottie O Brien, Northern Genetics Service, Newcastle, UK 15 th May 2014 2013 schemes There was great variation in the way HGVS nomenclature was applied Scheme would like

More information

Chapter 12 Multiple Choice

Chapter 12 Multiple Choice Chapter 12 Multiple Choice Identify the choice that best completes the statement or answers the question. 1. What did Gregor Mendel do to study different characteristics in his genetics experiments? a.

More information

MEDICAL GENOMICS LABORATORY. Peripheral Nerve Sheath Tumor Panel by Next-Gen Sequencing (PNT-NG)

MEDICAL GENOMICS LABORATORY. Peripheral Nerve Sheath Tumor Panel by Next-Gen Sequencing (PNT-NG) Peripheral Nerve Sheath Tumor Panel by Next-Gen Sequencing (PNT-NG) Ordering Information Acceptable specimen types: Blood (3-6ml EDTA; no time limitations associated with receipt) Saliva (OGR-575 DNA Genotek;

More information

CNV Detection and Interpretation in Genomic Data

CNV Detection and Interpretation in Genomic Data CNV Detection and Interpretation in Genomic Data Benjamin W. Darbro, M.D., Ph.D. Assistant Professor of Pediatrics Director of the Shivanand R. Patil Cytogenetics and Molecular Laboratory Overview What

More information

5/2/18. After this class students should be able to: Stephanie Moon, Ph.D. - GWAS. How do we distinguish Mendelian from non-mendelian traits?

5/2/18. After this class students should be able to: Stephanie Moon, Ph.D. - GWAS. How do we distinguish Mendelian from non-mendelian traits? corebio II - genetics: WED 25 April 2018. 2018 Stephanie Moon, Ph.D. - GWAS After this class students should be able to: 1. Compare and contrast methods used to discover the genetic basis of traits or

More information

AVENIO ctdna Analysis Kits The complete NGS liquid biopsy solution EMPOWER YOUR LAB

AVENIO ctdna Analysis Kits The complete NGS liquid biopsy solution EMPOWER YOUR LAB Analysis Kits The complete NGS liquid biopsy solution EMPOWER YOUR LAB Analysis Kits Next-generation performance in liquid biopsies 2 Accelerating clinical research From liquid biopsy to next-generation

More information

Merging single gene-level CNV with sequence variant interpretation following the ACMGG/AMP sequence variant guidelines

Merging single gene-level CNV with sequence variant interpretation following the ACMGG/AMP sequence variant guidelines Merging single gene-level CNV with sequence variant interpretation following the ACMGG/AMP sequence variant guidelines Tracy Brandt, Ph.D., FACMG Disclosure I am an employee of GeneDx, Inc., a wholly-owned

More information

Supplementary Figures

Supplementary Figures Supplementary Figures Supplementary Figure 1. Heatmap of GO terms for differentially expressed genes. The terms were hierarchically clustered using the GO term enrichment beta. Darker red, higher positive

More information

Supplementary Figure 1. Schematic diagram of o2n-seq. Double-stranded DNA was sheared, end-repaired, and underwent A-tailing by standard protocols.

Supplementary Figure 1. Schematic diagram of o2n-seq. Double-stranded DNA was sheared, end-repaired, and underwent A-tailing by standard protocols. Supplementary Figure 1. Schematic diagram of o2n-seq. Double-stranded DNA was sheared, end-repaired, and underwent A-tailing by standard protocols. A-tailed DNA was ligated to T-tailed dutp adapters, circularized

More information

Mendelian Genetics. KEY CONCEPT Mendel s research showed that traits are inherited as discrete units.

Mendelian Genetics. KEY CONCEPT Mendel s research showed that traits are inherited as discrete units. KEY CONCEPT Mendel s research showed that traits are inherited as discrete units. Mendel laid the groundwork for genetics. Traits are distinguishing characteristics that are inherited. Genetics is the

More information

The Loss of Heterozygosity (LOH) Algorithm in Genotyping Console 2.0

The Loss of Heterozygosity (LOH) Algorithm in Genotyping Console 2.0 The Loss of Heterozygosity (LOH) Algorithm in Genotyping Console 2.0 Introduction Loss of erozygosity (LOH) represents the loss of allelic differences. The SNP markers on the SNP Array 6.0 can be used

More information

1) DNA unzips - hydrogen bonds between base pairs are broken by special enzymes.

1) DNA unzips - hydrogen bonds between base pairs are broken by special enzymes. Biology 12 Cell Cycle To divide, a cell must complete several important tasks: it must grow, during which it performs protein synthesis (G1 phase) replicate its genetic material /DNA (S phase), and physically

More information

CHROMOSOMAL THEORY OF INHERITANCE

CHROMOSOMAL THEORY OF INHERITANCE AP BIOLOGY EVOLUTION/HEREDITY UNIT Unit 1 Part 7 Chapter 15 ACTIVITY #10 NAME DATE PERIOD CHROMOSOMAL THEORY OF INHERITANCE The Theory: Genes are located on chromosomes Chromosomes segregate and independently

More information

Chapter 15: The Chromosomal Basis of Inheritance

Chapter 15: The Chromosomal Basis of Inheritance Name Chapter 15: The Chromosomal Basis of Inheritance 15.1 Mendelian inheritance has its physical basis in the behavior of chromosomes 1. What is the chromosome theory of inheritance? 2. Explain the law

More information

Ambient temperature regulated flowering time

Ambient temperature regulated flowering time Ambient temperature regulated flowering time Applications of RNAseq RNA- seq course: The power of RNA-seq June 7 th, 2013; Richard Immink Overview Introduction: Biological research question/hypothesis

More information

Lab Activity Report: Mendelian Genetics - Genetic Disorders

Lab Activity Report: Mendelian Genetics - Genetic Disorders Name Date Period Lab Activity Report: Mendelian Genetics - Genetic Disorders Background: Sometimes genetic disorders are caused by mutations to normal genes. When the mutation has been in the population

More information

Using the Bravo Liquid-Handling System for Next Generation Sequencing Sample Prep

Using the Bravo Liquid-Handling System for Next Generation Sequencing Sample Prep Using the Bravo Liquid-Handling System for Next Generation Sequencing Sample Prep Tom Walsh, PhD Division of Medical Genetics University of Washington Next generation sequencing Sanger sequencing gold

More information

Comprehensive Chromosome Screening Is NextGen Likely to be the Final Best Platform and What are its Advantages and Quirks?

Comprehensive Chromosome Screening Is NextGen Likely to be the Final Best Platform and What are its Advantages and Quirks? Comprehensive Chromosome Screening Is NextGen Likely to be the Final Best Platform and What are its Advantages and Quirks? Embryo 1 Embryo 2 combine samples for a single sequencing chip Barcode 1 CTAAGGTAAC

More information

Nature Methods: doi: /nmeth.3115

Nature Methods: doi: /nmeth.3115 Supplementary Figure 1 Analysis of DNA methylation in a cancer cohort based on Infinium 450K data. RnBeads was used to rediscover a clinically distinct subgroup of glioblastoma patients characterized by

More information

Characterisation of structural variation in breast. cancer genomes using paired-end sequencing on. the Illumina Genome Analyser

Characterisation of structural variation in breast. cancer genomes using paired-end sequencing on. the Illumina Genome Analyser Characterisation of structural variation in breast cancer genomes using paired-end sequencing on the Illumina Genome Analyser Phil Stephens Cancer Genome Project Why is it important to study cancer? Why

More information

The Chromosomal Basis of Inheritance

The Chromosomal Basis of Inheritance The Chromosomal Basis of Inheritance Factors and Genes Mendel s model of inheritance was based on the idea of factors that were independently assorted and segregated into gametes We now know that these

More information

LTA Analysis of HapMap Genotype Data

LTA Analysis of HapMap Genotype Data LTA Analysis of HapMap Genotype Data Introduction. This supplement to Global variation in copy number in the human genome, by Redon et al., describes the details of the LTA analysis used to screen HapMap

More information

Analysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers

Analysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers Analysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers Gordon Blackshields Senior Bioinformatician Source BioScience 1 To Cancer Genetics Studies

More information

Understanding DNA Copy Number Data

Understanding DNA Copy Number Data Understanding DNA Copy Number Data Adam B. Olshen Department of Epidemiology and Biostatistics Helen Diller Family Comprehensive Cancer Center University of California, San Francisco http://cc.ucsf.edu/people/olshena_adam.php

More information

Molecular Characterization of Tumors Using Next-Generation Sequencing

Molecular Characterization of Tumors Using Next-Generation Sequencing Molecular Characterization of Tumors Using Next-Generation Sequencing Using BaseSpace to visualize molecular changes in cancer. Tumor-Normal Sequencing Data in BaseSpace To enable researchers new to next-generation

More information

Breast and ovarian cancer in Serbia: the importance of mutation detection in hereditary predisposition genes using NGS

Breast and ovarian cancer in Serbia: the importance of mutation detection in hereditary predisposition genes using NGS Breast and ovarian cancer in Serbia: the importance of mutation detection in hereditary predisposition genes using NGS dr sc. Ana Krivokuća Laboratory for molecular genetics Institute for Oncology and

More information

GENOME-WIDE DETECTION OF ALTERNATIVE SPLICING IN EXPRESSED SEQUENCES USING PARTIAL ORDER MULTIPLE SEQUENCE ALIGNMENT GRAPHS

GENOME-WIDE DETECTION OF ALTERNATIVE SPLICING IN EXPRESSED SEQUENCES USING PARTIAL ORDER MULTIPLE SEQUENCE ALIGNMENT GRAPHS GENOME-WIDE DETECTION OF ALTERNATIVE SPLICING IN EXPRESSED SEQUENCES USING PARTIAL ORDER MULTIPLE SEQUENCE ALIGNMENT GRAPHS C. GRASSO, B. MODREK, Y. XING, C. LEE Department of Chemistry and Biochemistry,

More information

Personalized Copy-Number and Segmental Duplication Maps using Next-Generation Sequencing

Personalized Copy-Number and Segmental Duplication Maps using Next-Generation Sequencing Supplementary Information Personalized Copy-Number and Segmental Duplication Maps using Next-Generation Sequencing Can Alkan 1,6, Jeffrey M. Kidd 1, Tomas Marques-Bonet 1,2, Gozde Aksay 1, Francesca 1

More information

Statistical Analysis of Single Nucleotide Polymorphism Microarrays in Cancer Studies

Statistical Analysis of Single Nucleotide Polymorphism Microarrays in Cancer Studies Statistical Analysis of Single Nucleotide Polymorphism Microarrays in Cancer Studies Stanford Biostatistics Workshop Pierre Neuvial with Henrik Bengtsson and Terry Speed Department of Statistics, UC Berkeley

More information

Detection of copy number variations in PCR-enriched targeted sequencing data

Detection of copy number variations in PCR-enriched targeted sequencing data Detection of copy number variations in PCR-enriched targeted sequencing data German Demidov Parseq Lab, Saint-Petersburg University of Russian Academy of Sciences, current: Center for Genomic Regulation

More information

No mutations were identified.

No mutations were identified. Hereditary High Cholesterol Test ORDERING PHYSICIAN PRIMARY CONTACT SPECIMEN Report date: Aug 1, 2017 Dr. Jenny Jones Sample Medical Group 123 Main St. Sample, CA Kelly Peters Sample Medical Group 123

More information