Cardiac Stem Cells Differentiate into Sinus Node-Like Cells
|
|
- Sherman Willis
- 5 years ago
- Views:
Transcription
1 Tohoku J. Exp. Med., 2010, 222, Differentiation of Cardiac Stem Cells 113 Cardiac Stem Cells Differentiate into Sinus Node-Like Cells Jun Zhang, 1 Congxin Huang, 1 Pan Wu, 1 Jing Yang, 1 Tao Song, 1 Yongjun Chen, 1 Xinrong Fan 1 and Ten Wang 1 1 Department of Cardiology, Renmin Hospital of Wuhan University, Wuhan, Cardiovascular Research Institute, Wuhan University, Wuhan, PR China The advent of stem cell therapy brings about the hope to restore the loss of cardiac pacemaker cells. However, it is largely unknown whether cardiac stem cells are able to differentiate into pacemaker cells. The purpose of this study was to determine whether the heart of large juvenile mammals contains cardiac stem cells (CSCs), which are suitable as seed cells for restoration of cardiac pacemaker cell. The c-kit + CSCs were isolated from one-month-old mongrel dogs. CSCs that we sorted were self-renewing, and they could proliferate by clonal expansion. CSCs could differentiate into cardiac muscle, smooth muscle and endothelial cells at rates of 10.5 ± 4.2%, 13.5 ± 5.1% and 12.9 ± 3.5%, respectively, at week 4, as judged by the expression of respective differentiation markers: cardiac troponin I, smooth muscle actin, and CD31. At week 8, the differentiation rates were further increased to 23.2 ± 3.6%, 25.9 ± 6.6% and 28.3 ± 6.1% (P < 0.05 for each marker). Some of cells derived from CSCs could express cardiac transcription factor GATA-4 after week 2 and express pacing-related genes, including hyperpolarization-activated cyclic nucleotide-gated 2 (HCN2) and HCN4 after week 4. Importantly, a fraction of CSCs demonstrated the presence of inward currents that indicate the expression of inward current channels. In conclusion, c-kit + CSCs may differentiate into cardiac muscle cell and sinus node-like cells, suggesting that CSCs would be useful as seed cells in treating sinus bradycardiac disorders or exploring the mechanism of pacemaker activity. Keywords: cardiac stem cell; expansion; differentiation; c-kit; dog Tohoku J. Exp. Med., 2010, 222 (2), Tohoku University Medical Press In the past a few years, research evidence has suggested that the cardiac tissue has resident stem cells with regenerative potential (Messina et al. 2004; Wang et al. 2006; Smith et al. 2007). This discovery has dramatically changed the traditional view of all heart cells as terminally differentiated cells (Beltrami et al. 2001; Bearzi et al. 2007). It is greatly hoped that an improved understanding of the physiological function of CSCs will promote the development of novel therapeutic strategies (stem cell therapy) for treating heart disease and perhaps even for preventing cardiac senescence (Bearzi et al. 2007; Gonzalez et al. 2008; Rota et al. 2008). Meanwhile, many researchers now pay great attention to biological re-establishment of cardiac pacemaker cells so as to replace electronic pacemaker for treating patients suffering from loss of cardiac pacemaker cells that results in sinus bradycardiac disorders (Miake et al. 2002; Plotnikov et al. 2004). So, the CSCs therapy of sinus bradycardiac disorders, which aims to restore pacemaker cells, would be promising. Although some investigations suggested that CSCs had the potential to reconstitute dead myocardium (Beltrami et al. 2003; Leri et al. 2005; Smith et al. 2007), detailed exploration of CSCs characteristics related to pacemaker cell is rare and a number of fundamental issues need to be elucidated before this reconstruction approach could be considered for biological pacemaker studies. Finding a way to get more, purified CSCs with fine function is significant to both study now and clinical treatment in the future. In the past several years, population of CSCs (c-kit +, Sca-1 + ) were isolated from hearts by cell sorting from enzymatically digested hearts based on cell surface markers (Beltrami et al. 2003; Oh et al. 2003; Tang et al. 2007). In order to make sure the integrity of important surface antigens of resident CSCs and avoid dysfunctional cells and fibroblasts contamination, we have developed a threestep procedure to isolate and expand pure CSCs. First, by expansion of endogenous CSCs through primary heart tissue explants, second, by isolation of CSCs from fibroblasts by cell sorting with stem cell marker (c-kit), and third, by expansion and differentiation of sorted CSCs after sorting. We intend to use CSCs as seed cells for biological pacemaker study. First and foremost, we need to identify the biological characteristics and function of CSCs, including electrophysiological properties of the cells. It is impor- Received May 24, 2010; revision accepted for publication August 31, doi: /tjem Correspondence: Congxin Huang, M.D., Department of Cardiology, Renmin Hospital of Wuhan University and Cardiovascular Research Institute of Wuhan University, 238 Jiefang Road, Wuchang, Wuhan, , People s Republic of China. huangcongxing@yahoo.com.cn 113
2 114 J. Zhang et al. tant to know whether CSCs can differentiate into sinus node like cells that express pacing-related genes. Stem cell related antigen c-kit, also called CD117, which is a cytokine receptor expressed on the surface of stem cells, is a marker of stem cell. The cells, which come from heart tissue and express c-kit, can be considered as CSCs (Beltrami et al. 2003; Gonzalez et al. 2008; Rota et al. 2008). Cardiac transcription factor GATA-4 is a zinc-finger transcription factor that acts as a critical regulator of the cardiac differentiation-specific gene program (Pu et al. 2004). Hyperpolarization-activated cyclic nucleotide-gated 2 (HCN2) and HCN4 are pacing-related genes (Ludwig et al. 2008). In this study, we investigated the differentiation of the CSCs by analyzing mrna expression of GATA-4, HCN2 and HCN4. We also measured inward currents of CSCs in order to make clear whether c-kit + CSCs have the potential of pacemaker cells. Materials and Methods Isolation and expansion of CSCs All experiments were approved by the Institutional Animal Care and Use Committee of Wuhan University. Four one-month-old mongrel dogs were obtained for the experiments. After anesthetization with sodium pentobarbital (30mg/Kg intraperitoneal injection), the heart tissues of the dog were excised and washed twice with cold Ca 2+ -Mg 2+ free phosphate-buffered solution (PBS) to remove the blood cells. According to previous reports with minor modification (Messina et al. 2004; Tang et al. 2007), the tissues from atrium, cardiac apex and middle of the heart were minced into 1 to 2 mm 3 pieces respectively. Then, the minced tissues were digested alternately three times for 5 min with 0.25% trypsin (HyClone, Logan, UT, USA) and two times for 5 min with 0.1% collagenase II (Sigma, St. Louis, Missouri, USA) at room temperature. After initial treatment, the remaining tissue fragments were cultured as explants in explant medium (IMDM with 10% fetal calf serum, 0.1 mmol/l 2-mercaptoethanol, 2 mmol/l L-glutamine, 100 U/mL penicillin G and 100 ug/ml streptomycin) (HyClone, Logan, UT, USA) at 37 C and 5% CO days later, we observed small, bright cells migrating from adherent explants. These phase-bright cells were collected repeatedly. To avoid damaging the integrity of cell surface antigen, we collected these phase-bright cells by washing with 0.05% trypsin and 0.53 mmol/l EDTA (HyClone, Logan, UT, USA) for 2 min at room temperature under visual control. After collecting the washed cells, we filtered the cells through a 40-µm cell strainer and counted the number of filtered single-cell under microscope. Fluorescence-activated cell sorter (FACS) analysis and cell sorting The single-cell suspensions were stained with the following antibodies: FITC-conjugated antibodies against c-kit, CD45, or CD34 respectively and isotype control IgG. CD45 is hematopoietic cell lineage marker and CD34 is a marker of endotheliocyte lineage. At first, part of single-cell suspensions, which were stained with FITCconjugated antibodies against c-kit, were subjected to a flow cytometry three times to learn the positive rate of c-kit in the total detected cells. Under sterile condition, the other single-cells in filterted suspensions were sorted using the flow cytometry to get the purified c-kit + cell. Then, the sorted cells were seeded at about cells/ ml in multiwell plates (BD Bioscences, Milan, Italy) for further expansion. Meanwhile, some single-cell suspensions made from sorted c-kit + cell were stained with the FITC-conjugated antibodies against CD45 and CD34 respectively to detect the positive rate of CD45 and CD34 through FACS. To avoid the contamination of cells from hematopoietic system or endothelial system and get high purity of CSCs, we had to explore the expression of CD45 and CD34 and confirm the negative expression of the markers. Cells were subjected to flow cytometry using BD LSRII flow cytometer (BD Biosciences San Jose, CA, USA) and BD FACSDivaTM software. The following monoclonal antibodies and conjugated fluorochromes FITC (sc-2010, sc-2011 Santa Cruz Biotechnology, Santa Cruz, CA, USA) were used with corresponding isotype controls: c-kit (bsf-0672r 1:50 Biosynthesis Biotechnology Co. LTD., Beijing, China), CD34 (sc :100 Santa Cruz Biotechnology, Santa Cruz, CA, USA), CD45 (sc :100 Santa Cruz Biotechnology, Santa Cruz, CA, USA) Further expansion of CSCs after sorting We selected 12-well and 6-well plates in succession for the sorted cell culture. After cell sorting, the resultant cell suspensions were plated in 12-well plates with serum-free growth medium (35% IMDM/65% DMEM Ham F-12 mix containing 2% B27, 0.1 mmol/l 2-mercaptoethanol, 10 ng/ml epidermal growth factor [EGF], 20 ng/ ml basic fibroblast growth factor [bfgf], 0.1 U/mL thrombin, antibiotics, and L-Glu, as in explant medium). 1 day later, the still suspending cells and loosely adherent cells were moved to 6-well plates. The growth medium was replaced every 3 days. To identify the clonal growth pattern of CSCs, we employed an approach to culture CSCs by seeding the cells at a density of 1 cell per well in growth medium in 96-well plates. After single-cell deposition analysis was performed by the limiting dilution technique, each well was inspected for the presence of single cell by phase contrast microscope. The growth curves of c-kit + cells To compare the proliferation speed of the CSCs from atrium, cardiac apex and middle of the heart, the sorted cells were seeded in 6 cm (diameter) culture dishes at the seeding density of with cell growth medium. The medium was replaced every 3 days. The growth curves of sorted cells from different parts of the heart were constructed according to mean values measured by cell counting on day1, day 3, day 6, day 9, day 12, day 15 and day 18. The cell growth curves were drawn with the culture time as the abscissa and the cell number as the ordinate. Immunofluorescence Immunofluorescence staining was performed to explore differentiation lineages of the CSCs. Cardiac troponin I (ctni), smooth muscle actin (SMA), and CD31 are regarded as markers of cardiomyocyte, smooth muscle cell and endothelial cell, respectively. At week 4 and week 8 after cell sorting, immunofluorescent analyses on the cells cultured on slides were performed as previously described (Tang et al. 2007). At first, the cells were fixed with 4% paraformaldehyde for 30 min. After blockage with goat serum for 30 min and permeabilization with 0.2% Triton X-100 (Sigma, USA) for 10 min, the fixed cells were incubated with primary antibodies overnight at 4 C, then incubated with rhodamine-conjugated secondary antibodies for 1h at room temperature. Nuclei were counterstained with 4,6-diamidino-2 -phenylindole (DAPI) (Sigma, St. Louis, Missouri,
3 Differentiation of Cardiac Stem Cells 115 USA) for 30 min. Specimens were examined under a fluorescence microscope (Leica, Wetzlar, Germany). Finally, we counted the number of all cells (blue coloration) and the cells which were stained both red and blue at each specimen. The percentage of cells being stained both red and blue can be regarded as different lineage s differentiation rate. Primary antibodies contained anti-cardiac troponin I (sc-98830, 1:100, Santa Cruz Biotechnology, Santa Cruz, CA, USA), anti-smooth muscle actin (sc-53142, 1:100, Santa Cruz Biotechnology, Santa Cruz, CA, USA) and anti-cd31 (bs-0468r,1:100, Biosynthesis Bio technology, beijing, China). Isotype-matched antibodies were used as control. Rhodamine- conjugated second antibodies (sc-2091, sc-2092, 1:100, Santa Cruz Biotechnology, Santa Cruz, CA, USA) were used to detect the primary antibodies which aimed directly at ctni, SMA and CD31. Reverse transcription polymerase chain reaction (RT-PCR) RT-PCR was performed to study the expression of GATA-4, HCN2, HCN4 mrna. At week 2, week 4 and week 8 after cell sorting, the total mrna was extracted with Trizol Reagent (Invitrogen, San Francisco, CA., USA) from the cultured cells. Transcriptional expression of GATA-4, HCN2, HCN4 genes was determined by semiquantitative RT-PCR according to the manufacturer s instructions. Transcript levels were standardized to the corresponding dog β-actin level. The primers for RT-PCR were as follows: GATA-4, For: 5 -CAATGCGGAAAGAGGGGAT-3 ; Rev: 5 -GAG AGG ACT GGG TGGATGGA-3 (GenBank accession #NM_ ). HCN2, For: 5 -ATCGTGGAGAAGGGCATTGAC-3 ; Rev: 5 -TCCCAC TGG TGGATGTAGCG-3 (GenBank accession #XM_ ). HCN4, For: 5 -GAGTCAACAAATTATCCCAGAG-3 ; Rev: 5 -GAATGA TGATTAGGTTTCCAAC-3 (GenBank accession #XM_ ). β -actin, For: 5 -AGTTGCGTTACACCCTTTCTTG-3 ; Rev: 5 -TCCAACCCACTGCTGTCACCT-3 (GenBank accession #XM_ ). The cdna amplification products of GATA-4, HCN2, HCN4 and β-actin were 277 bp, 134 bp, 168 bp and 212 bp respectively. The thermal profile for PCR was 95 C for 5 min, followed by 30 cycles of 30 s at 95 C, with 1 min annealing intervals followed by 1 min extension at 72 C. An additional 10 min incubation at 72 C was included after completion of the last cycle. Following the PCR, 5 µl of the PCR product was electrophoresed on a 1% agarose gel and imaged using a gel imaging instrument. Electrophysiological recordings Membrane currents of cultured CSCs were measured in the whole-cell configuration of the patch clamp technique at C with the following different superfusion solution. For recording sodium inward current, patch pipette solution consisted of (in mm) CsCl 120, CaCl 2 1, MgCl 2 5, Na 2 ATP 5, EGTA 11, HEPES 10, Glucose 11 (ph 7.3 with CsOH) and the bath solution to measure ionic current consisted of (mm) NaCl 135, KCl 5.4, CaCl 2 1.8, NaH 2 PO , MgCl 2 1, HEPES 10, Glucose 10 (ph 7.2 with NaOH). For detecting calcium inward current, patch pipette solution consisted of (in mm) CsCl 120, CaCl 2 1, MgCl 2 5, Na 2 ATP 5, EGTA 11, HEPES 10, Glucose 11 (ph 7.3 with CsOH) and the bath solution consisted of (mm) Chloride Choline 120, CsCl 10, MgCl 2 1, BaCl 2 10, HEPES 10, and glucose 10 (ph 7.4 with CsOH) (Heubach et al. 2000, 2004). Statistical analysis Statistics were performed with the SPSS (version 11.0) (Chincago, Illinois, USA) and Graphpad Prism (version 5). P-value smaller than 0.05 was considered to be statistically significant. Values were given as mean ± s.d.. Results Isolation and expansion of c-kit + cells By 3-5 days after explanting of the minced dog heart tissue, we observed that a layer of fibroblast-like cells covered the culture dish, and round, phase-bright cells with different size migrated from the adherent explants (Fig. 1A). Successful outgrowth of the phase-bright cells was obtained in 5 of 10 culture dishes from atrium, 4 of 10 culture dishes from middle of the heart and 10 of 10 culture dishes from cardiac apex respectively. These cells were loosely attached to the fibroblast-like cell layer, and could be collected periodically by simply washing and centrifuging. After cell sorting, some c-kit + cells clustered and formed three-dimensional spheres (Fig. 1B). From our visual observation, each spherical cluster shown in figure 1 was a result of proliferation of one single CSC through many times division. 1 month later, more and more c-kit + cells differentiated into fusiform shape or irregular shape. Nevertheless, some descendants of c-kit + cells still kept round and bright shape. In Fig.1E, growth curves of sorted cells from atrium, cardiac apex and middle of the heart were showed to evaluate the proliferation ability of the c-kit + cells from different tissues. From the curves, we could see that the proliferation speed of the c-kit + cell from cardiac apex was faster than those from atrium and middle of the heart. The proliferation speed of the cells from middle tissue of the heart was the lowest. To observe the clonal growth pattern of CSCs, we cultured CSCs by seeding the cells at a density of 1 cell per well in growth medium. Altogether, 200 single cells were deposited, and about 80% of the cells survived and expanded within 7 days and about 50% of the cells formed spherical clusters. Characterization of c-kit + cell As shown in Fig. 2A, before cell sorting, 20.4 ± 7.5% of detected cells were c-kit positive by means of flow cytometry. After cell sorting based on c-kit + via FACS, we detected the positive rate of CD34 and CD45 respectively in purified c-kit + cells. Marker expression analysis indicated that the c-kit + cell hardly expressed CD34 (0.7%, Fig. 2D) and CD45 (0.5%, Fig. 2C). Immunophenotype characterization of c-kit + cells To characterize the differentiation of the c-kit + cells, at week 4 and week 8 after cell sorting, we examined the expression of ctni, SMA and CD31 by immunostaining. In Fig. 3, the representative images and frequencies of ctni, SMA and CD31 were shown. Fluorescence microscopy analysis revealed that the CSCs differentiated into cardiac muscle cell (ctni), smooth muscle cell (SMA) and endothelial cell (CD31) at rates of 10.5 ± 4.2%, 13.5 ± 5.1% and
4 116 J. Zhang et al. Fig. 1. CSCs proliferation. (A) Round and bright cells(white arrow) generated from heart explant. (B) Cardiosphere formed and bore new round and bright cells. (C-D) The sorted CSCs were c-kit positive. (E) Cell growth curves of sorted cells with c-kit positive. The cells were obtained from atrium, middle heart and cardiac apex respectively. Bars, 20 µm ± 3.5% respectively at week 4. Subsequently, the differentiation rates were 23.2 ± 3.6%, 25.9 ± 6.6% and 28.3 ± 6.1%, respectively at week 8. The difference of each lineage s differentiation rate between week 4 and week 8 was of significance (P < 0.05 for each marker). The mrna expression of GATA-4, HCN2 and HCN4 in CSCs We investigated the mrna expression of GATA-4, HCN2 and HCN4 in the cultured cells generated from CSCs at week 2, week 4 and week 8 respectively. There was clear mrna expression for GATA-4, HCN2 and HCN4 at week 4 and week 8. The expression of each gene at week 8 was stronger than that at week 4 respectively, P < In addition, we detected no mrna for HCN2 and HCN4 in the cultured cells at week 2. The reason why the expression of HCN2 and HCN4 could not be explored perspicuously at week 2 might be the slow growth and differentiation speed of CSCs at early stage after cell sorting under our culture condition. Inward currents of CSCs At first, we tried to detect sodium inward currents in undifferentiated CSCs. The results were that sodium inward current was small in CSCs being tested (11 out of 60 cells). Then, we tested for the presence of functional Ca 2+ channels. At 2 mm external CaCl 2, it was hard to identify clearly inward current and the recorded current was very low.
5 Differentiation of Cardiac Stem Cells 117 Fig. 2. Flow cytometric analysis of cell population. (A) Analysis of the positive rate of c-kit in cultured cells before cell sorting; (B-D) Analysis of the positive rate of CD45 and CD34 respectively after cell sorting. However, after switching to 10 mm BaCl 2, we could record inward higher currents (10 out of 50 cells). The currents were activated around 35 mv and the current peak was at 20 to 30 mv (Fig. 5), similar to Ba 2+ currents conducted by L-type Ca 2+ channels of other cell types (Heubach et al. 2000, 2004). The strongest current was 60.5 ± 4.8 pa at 30mV. These results verified the presence of functionally inward channels. Discussion The discovery that stem cells reside in the heart and constantly give rise to a cardiomyocyte progeny has changed dramatically our interpretation of heart tissue and offered novel therapeutic options for the management of heart disease (Linke et al. 2005; Smith et al. 2007). The c-kit + cells isolated from the heart behaved like stem cells since they were self-renewing, clonogenic, and multipotent (Beltrami et al. 2003). Study showed that after many doublings in culture, cardiac c-kit + cells retained differentiation competence (Beltrami et al. 2003). We conducted the study to know whether the CSCs were fit for biological pacemaker study as seed cells. The c-kit positive cells we isolated seemed to be a mixture of CSCs and cardiac progenitor cells. Although c-kit is a kind of non-special surface marker of stem cell, the results that purified c-kit + cells were negative for hematopoietic cell lineage marker (CD45) and endothelial cell lineage marker (CD34) confirmed that the c-kit + cells we sorted were not hematopoietic or endothelial progenitor cells. Meanwhile, the c-kit + cells came from heart and could differentiate into cardiac muscle, smooth muscle and endothelial cells. So, we could consider the c-kit + cells we sorted as CSCs. From the result of growth curves, we could see that the proliferation speed of the CSCs from cardiac apex is faster than those from atrium and middle of the heart. The c-kit + cells isolated from the dog heart via our three-step procedure were found to be self-renewing. The cells could proliferate by clonal expansion and differentiate spontaneously into cardiomyocytes in vitro but fail to contract automatically. The cardiac transcription factor GATA- 4, which is essential for normal heart morphogenesis and regulates the survival, growth and proliferation of cardiomyocytes (Armiñán et al. 2009; Zaglia et al. 2009; Singh et al. 2010), could be considered as early marker of differentiated cardiomyocyte. Hyperpolarization-activated nucleotide-gated (HCN) channel family genes, which figure prominently in physiological automaticity, are related to automatic pacing activity. The transfer of HCN genes into quiescent heart tissue had been explored as a way of creat-
6 118 J. Zhang et al. Fig. 3. Immunophenotype characterization of purified c-kit + cells grown on coated wells. Immunofluorescence staining of the cells with anti-ctni, SMA and CD31 (red A-D). The ctni staining colocalized with single cells (A). Cells were counterstained with DAPI (blue) staining the nucleus. Bars, 20 µm. Experiments were done in triplicate with similar results. Fig. 4. RT-PCR analysis of GATA-4, HCN2 and HCN4 for CSCs at different time. The picture (upper) was electrophoretogram of GATA-4, HCN2 and HCN4 PCR amplification product. The graph (lower) showed that quantitative densiometric analysis of the GATA-4, HCN2 and HCN4 mrna amount normalized β-actin mrna at different time. *P <0.05, # P < 0.01, vs. group at week 4.
7 119 Differentiation of Cardiac Stem Cells Fig. 5. Recording inward currents of CSCs. (A) The round cell was used for electrophysiological recordings (note the patch-electrode); (B) Original current traces of a representative cell were shown at 20 mv, 30 mv and 60 mv in the presence of 10 mm Ba2+; (C) Current traces were shown in the presence of 2 mm Ca2+; (D) Current-voltage relation curve of Ba2+ current; (E) The low Na+ current was recorded; (F) Current-voltage relation curve of Na+ current. ing a biopacemaker (Miake et al. 2002; Plotnikov et al. 2004). HCN2 and HCN4 channels are expressed in the sinus node, determine the pacemaker current If and regulate the heart rate (Ludwig et al. 2008; DiFrancescot D. 2010). So, the cells expressing HCN2 and HCN4 could be considered sinus node-like cells. Although low levels of HCN2 and HCN4 expression could be observed in cultured cells generated from the CSCs, the findings provide new insights into the endeavours for restoration of pacemaker cell using the CSCs. There were limited currents observed in undifferentiated CSCs. In spite of preliminary observation, the existence of inward current channels reinforced the feasibility of using the CSCs as seed cells for biological pacemaking study. We could suppose that the expression of current channels vary at different phases of the cell cycle. The modification of present current and/or the occurrence of new current could be suitable markers of CSC differentiation in vitro. In conclusion, the c-kit+ CSCs could express GATA-4 and differentiate into cardiac muscle, smooth muscle and endothelial cell. It is therefore feasible to select CSCs for further research about repairing cardiac muscle. Because of expression of pacing-related genes (HCN2 and HCN4) and existence of inward current channels, CSCs seem to be promising to change into pacemaker cells in the future study. The findings raise the possibility to use the cells for the management of sinus bradycardiac disorders and the exploration of pacemaker activity mechanism. References Armiñán, A., Gandía, C., Bartual, M., García-Verdugo, J.M., Lledó, E., Mirabet, V., Llop, M., Barea, J., Montero, J.A. & Sepúlveda, P. (2009) Cardiac differentiation is driven by NKX2.5 and GATA4 nuclear translocation in tissue-specific mesenchymal stem cells. Stem Cells Dev., 18, Beltrami, A.P., Barlucchi, L., Torella, D., Baker, M., Limana, F., Chimenti, S., Kasahara, H., Rota, M., Musso, E., Urbanek, K., Leri, A., Kajstura, J., Nadal-Ginard, B. & Anversa, P. (2003) Adult cardiac stem cells are multipotent and support myocardial regeneration. Cell, 114, Beltrami, A.P., Urbanek, K., Kajstura, J., Yan, S.M., Finato, N., Bussani, R., Nadal-Ginard, B., Silvestri, F., Leri, A., Beltrami, C.A. & Anversa P. (2001) Evidence that human cardiac myo-
8 120 J. Zhang et al. cytes divide after myocardial infarction. N. Engl. J. Med., 344, Bearzi, C., Rota, M., Hosoda, T., Tillmanns, J., Nascimbene, A., De Angelis, A., Yasuzawa- Amano, S., Trofimova, I., Siggins, RW., Lecapitaine, N., Cascapera, S., Beltrami, A.P., D'Alessandro, D.A., Zias, E., Quaini, F., Urbanek, K., Michler, R.E., Bolli, R., Kajstura, J., Leri, A. & Anversa, P. (2007) Human cardiac stem cells. Proc. Natl. Acad. Sci. USA, 104, DiFrancesco, D. (2010) The role of the funny current in pacemaker activity. Circ. Res., 106, Gonzalez, A., Rota, M., Nurzynska, D., Misao, Y., Tillmanns, J., Ojaimi, C., Padin-Iruegas, M.E., Müller, P., Esposito, G., Bearzi, C., Vitale, S., Dawn, B., Sanganalmath, S.K., Baker, M., Hintze, T.H., Bolli, R., Urbanek, K., Hosoda, T., Anversa, P., Kajstura, J. & Leri, A. (2008) Activation of cardiac progenitor cells reverses the failing heart senescent phenotype and prolongs lifespan. Circ. Res., 102, Heubach, J.F., Graf, E.M., Leutheuser, J., Bock, M., Balana, B., Zahanich, I., Christ, T., Boxberger, S., Wettwer, E. & Ravens, U. (2004) Electrophysiological properties of human mesenchymal stem cells. J. Physiol., 554, Heubach, J.F., Köhler, A., Wettwer, E. & Ravens, U. (2000) T-Type and tetrodotoxin-sensitive Ca 2+ currents coexist in guinea pig ventricular myocytes and are both blocked by mibefradil. Circ. Res., 86, Leri, A., Kajstura, J. & Anversa, P. (2005) Cardiac stem cells and mechanisms of myocardial regeneration. Physiol. Rev., 85, Linke, A., Müller, P., Nurzynska, D., Casarsa, C., Torella, D., Nascimbene, A., Castaldo, C., Cascapera, S., Böhm, M., Quaini, F., Urbanek, K., Leri, A., Hintze, T.H., Kajstura, J. & Anversa, P. (2005) Stem cells in the dog heart are self-renewing, clonogenic, and multipotent and regenerate infarcted myocardium, improving cardiac function. Proc. Natl. Acad. Sci. USA, 102, Ludwig, A., Herrmann, S., Hoesl, E. & Stieber, J. (2008) Mouse models for studying pacemaker channel function and sinus node arrhythmia. Prog. Biophys. Mol. Biol., 98, Miake, J., Marban, E. & Nuss, H.B. (2002) Gene therapy: biological pacemaker created by gene transfer. Nature, 419, Messina, E., De Angelis, L., Frati, G., Morrone, S., Chimenti, S., Fiordaliso, F., Salio, M., Battaglia, M., Latronico, M.V., Coletta, M., Vivarelli, E., Frati, L., Cossu, G. & Giacomello, A. (2004) Isolation and expansion of adult cardiac stem cells from human and murine heart. Circ. Res., 95, Oh, H., Bradfute, S.B., Gallardo, T.D., Nakamura, T., Gaussin, V., Mishina, Y., Pocius, J., Michael, L.H., Behringer, R.R., Garry, D.J., Entman, M.L. & Schneider, M.D. (2003) Cardiac progenitor cells from adult myocardium: homing, differentiation, and fusion after infarction. Proc. Natl. Acad. Sci. USA, 100, Plotnikov, A.N., Sosunov, E.A., Qu, J., Shlapakova, I.N., Anyukhovsky, E.P., Liu, L., Janse, M.J., Brink, P.R., Cohen, I.S., Robinson, R.B., Danilo, P.J. & Rosen, M.R. (2004) A biological pacemaker implanted in the canine left bundle branch provides ventricular escape rhythms having physiologically acceptable rates. Circulation, 109, Pu, W.T., Ishiwata, T., Juraszek, A.L., Ma, Q. & Izumo, S. (2004) GATA4 is a dosage-sensitive regulator of cardiac morphogenesis. Dev. Biol., 275, Rota, M., Padin-Iruegas, M.E., Misao, Y., De Angelis, A., Maestroni, S., Ferreira-Martins, J., Fiumana, E., Rastaldo, R., Arcarese, M.L., Mitchell, T.S., Boni, A., Bolli, R., Urbanek, K., Hosoda, T., Anversa, P., Leri, A. & Kajstura, J. (2008) Local activation or implantation of cardiac progenitor cells rescues scarred infarcted myocardium improving cardiac function. Circ. Res., 103, Smith, R.R., Barile, L., Cho, H.C., Leppo, M.K., Hare, J.M., Messina, E., Giacomello, A., Abraham, M.R. & Marbán, E. (2007) Regenerative potential of cardiosphere-derived cells expanded from percutaneous endomyocardial biopsy specimens. Circulation, 115, Singh, M.K., Li, Y., Li, S., Cobb, R.M., Zhou, D., Lu, M.M., Epstein, J.A., Morrisey, E.E. & Gruber, P.J. (2010) Gata4 and Gata5 cooperatively regulate cardiac myocyte proliferation in mice. J. Biol. Chem., 285, Tang, Y.L., Shen, L., Qian, K. & Phillips, M.I. (2007) A novel twostep procedure to expand cardiac Sca-1+ cells clonally. Biochem. Biophys. Res. Commun., 359, Wang, X., Hu, Q., Nakamura, Y., Lee, J., Zhang, G., From, A.H. & Zhang, J. (2006) The role of the sca-1+/cd31- cardiac progenitor cell population in postinfarction left ventricular remodeling. Stem Cells, 24, Zaglia, T., Dedja, A., Candiotto, C., Cozzi, E., Schiaffino, S. & Ausoni, S. (2009) Cardiac interstitial cells express GATA4 and control dedifferentiation and cell cycle re-entry of adult cardiomyocytes. J. Mol. Cell. Cardiol., 46,
Angiotensin II promotes differentiation of mouse c kit positive cardiac stem cells into pacemaker like cells
MOLECULAR MEDICINE REPORTS 11: 3249-3258, 2015 Angiotensin II promotes differentiation of mouse c kit positive cardiac stem cells into pacemaker like cells CHENG XUE 1, JUN ZHANG 1, ZHAN LV 1, HUI LIU
More informationResident cardiac stem cells: how to find and use them
Resident cardiac stem cells: how to find and use them G. Hasenfuß Cardiology and Pneumology Heart Research Center Göttingen Georg-August-University Göttingen Definition: Stem cell Selfrenewal Stem cell
More informationSUPPLEMENTAL MATERIAL. Supplementary Methods
SUPPLEMENTAL MATERIAL Supplementary Methods Culture of cardiomyocytes, fibroblasts and cardiac microvascular endothelial cells The isolation and culturing of neonatal rat ventricular cardiomyocytes was
More informationSupplemental Experimental Procedures
Cell Stem Cell, Volume 2 Supplemental Data A Temporal Switch from Notch to Wnt Signaling in Muscle Stem Cells Is Necessary for Normal Adult Myogenesis Andrew S. Brack, Irina M. Conboy, Michael J. Conboy,
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature10188 Supplementary Figure 1. Embryonic epicardial genes are down-regulated from midgestation stages and barely detectable post-natally. Real time qrt-pcr revealed a significant down-regulation
More informationENDOGENOUS CARDIAC STEM CELLS IN THE REGENERATION OF ACUTE AND CHRONIC ISCHEMIC MYOCARDIUM
ENDOGENOUS CARDIAC STEM CELLS IN THE REGENERATION OF ACUTE AND CHRONIC ISCHEMIC MYOCARDIUM Bernardo Nadal-Ginard, M.D., Ph.D. New York Medical College Angioplasty Summit 2004, Seoul 04/29/04 MYOCARDIAL
More informationStem cells in the dog heart are self-renewing, clonogenic, and multipotent and regenerate infarcted myocardium, improving cardiac function
Stem cells in the dog heart are self-renewing, clonogenic, and multipotent and regenerate infarcted myocardium, improving cardiac function Axel Linke*, Patrick Müller*, Daria Nurzynska*, Claudia Casarsa*,
More informationComparison of Young and Old Cardiac Telocytes Using Atomic Force Microscopy
Comparison of Young and Old Cardiac Telocytes Using Atomic Force Microscopy Jiali Luo 1, 2, 3, 4, a, Shanshan Feng 1, 2, 3, 4, b 1Key Laboratory of Regenerative Medicine, Ministry of Education, Jinan University,
More informationThe Schedule and the Manual of Basic Techniques for Cell Culture
The Schedule and the Manual of Basic Techniques for Cell Culture 1 Materials Calcium Phosphate Transfection Kit: Invitrogen Cat.No.K2780-01 Falcon tube (Cat No.35-2054:12 x 75 mm, 5 ml tube) Cell: 293
More informationProtocol for Gene Transfection & Western Blotting
The schedule and the manual of basic techniques for cell culture Advanced Protocol for Gene Transfection & Western Blotting Schedule Day 1 26/07/2008 Transfection Day 3 28/07/2008 Cell lysis Immunoprecipitation
More informationIslet viability assay and Glucose Stimulated Insulin Secretion assay RT-PCR and Western Blot
Islet viability assay and Glucose Stimulated Insulin Secretion assay Islet cell viability was determined by colorimetric (3-(4,5-dimethylthiazol-2-yl)-2,5- diphenyltetrazolium bromide assay using CellTiter
More informationFor nearly a century, the adult heart has been considered a
Cardiomyogenesis in the Adult Human Heart Jan Kajstura, Konrad Urbanek, Shira Perl, Toru Hosoda, Hanqiao Zheng, Barbara Ogórek, João Ferreira-Martins, Polina Goichberg, Carlos Rondon, Domenico D Amario,
More informationParacrine Mechanisms in Adult Stem Cell Signaling and Therapy
Paracrine Mechanisms in Adult Stem Cell Signaling and Therapy Massimiliano Gnecchi, Zhiping Zhang, Aiguo Ni, Victor J. Dzau Circulation Research 2008 Nov 21;103(11):1204-19 Introduction(1) After AMI all
More informationInstructions for Use. APO-AB Annexin V-Biotin Apoptosis Detection Kit 100 tests
3URGXFW,QIRUPDWLRQ Sigma TACS Annexin V Apoptosis Detection Kits Instructions for Use APO-AB Annexin V-Biotin Apoptosis Detection Kit 100 tests For Research Use Only. Not for use in diagnostic procedures.
More informationSUPPLEMENTARY INFORMATION
Supplementary Figures Supplementary Figure S1. Binding of full-length OGT and deletion mutants to PIP strips (Echelon Biosciences). Supplementary Figure S2. Binding of the OGT (919-1036) fragments with
More informationHuman TRPC6 Ion Channel Cell Line
TECHNICAL DATA SHEET ValiScreen Ion Channel Cell Line Caution: For Laboratory Use. A research product for research purposes only Human TRPC6 Ion Channel Cell Line Product No.: AX-012-C Lot No.: 512-548-A
More informationNIH Public Access Author Manuscript Circulation. Author manuscript; available in PMC 2011 January 19.
NIH Public Access Author Manuscript Published in final edited form as: Circulation. 2010 January 19; 121(2): 293. doi:10.1161/circulationaha.109.871905. INTRACORONARY ADMINISTRATION OF CARDIAC PROGENITOR
More information(A) PCR primers (arrows) designed to distinguish wild type (P1+P2), targeted (P1+P2) and excised (P1+P3)14-
1 Supplemental Figure Legends Figure S1. Mammary tumors of ErbB2 KI mice with 14-3-3σ ablation have elevated ErbB2 transcript levels and cell proliferation (A) PCR primers (arrows) designed to distinguish
More informationSerum Amyloid A3 Gene Expression in Adipocytes is an Indicator. of the Interaction with Macrophages
Serum Amyloid A3 Gene Expression in Adipocytes is an Indicator of the Interaction with Macrophages Yohei Sanada, Takafumi Yamamoto, Rika Satake, Akiko Yamashita, Sumire Kanai, Norihisa Kato, Fons AJ van
More informationINSTRUCTIONS Pierce Primary Cardiomyocyte Isolation Kit
INSTRUCTIONS Pierce Primary Cardiomyocyte Isolation Kit 88281 Number Description 88281 Pierce Primary Cardiomyocyte Isolation Kit, contains sufficient reagents to isolate cardiomyocytes from 50 neonatal
More informationGladstone Institutes, University of California (UCSF), San Francisco, USA
Fluorescence-linked Antigen Quantification (FLAQ) Assay for Fast Quantification of HIV-1 p24 Gag Marianne Gesner, Mekhala Maiti, Robert Grant and Marielle Cavrois * Gladstone Institutes, University of
More informationPretargeting and Bioorthogonal Click Chemistry-Mediated Endogenous Stem Cell Homing for Heart Repair
Pretargeting and Bioorthogonal Click Chemistry-Mediated Endogenous Stem Cell Homing for Heart Repair Mouse Model of Myocardial Infarction (MI) All animal work was compliant with the Institutional Animal
More informationFor the rapid, sensitive and accurate measurement of apoptosis in various samples.
ab14082 500X Annexin V-FITC Apoptosis Detection Reagent Instructions for Use For the rapid, sensitive and accurate measurement of apoptosis in various samples. This product is for research use only and
More informationAnnexin V-Cy3 Apoptosis Detection Reagent
ab14143 Annexin V-Cy3 Apoptosis Detection Reagent Instructions for Use For the rapid, sensitive and accurate measurement of apoptosis in various samples This product is for research use only and is not
More informationOriginal Article Differentiation induction of mouse cardiac stem cells into sinus node-like cells by co-culturing with sinus node
Int J Clin Exp Pathol 2014;7(5):1868-1879 www.ijcep.com /ISSN:1936-2625/IJCEP1401033 Original Article Differentiation induction of mouse cardiac stem cells into sinus node-like cells by co-culturing with
More informationA549 and A549-fLuc cells were maintained in high glucose Dulbecco modified
Cell culture and animal model A549 and A549-fLuc cells were maintained in high glucose Dulbecco modified Eagle medium supplemented with 10% fetal bovine serum at 37 C in humidified atmosphere containing
More informationSUPPLEMENTARY INFORMATION
DOI:.38/ncb3399 a b c d FSP DAPI 5mm mm 5mm 5mm e Correspond to melanoma in-situ Figure a DCT FSP- f MITF mm mm MlanaA melanoma in-situ DCT 5mm FSP- mm mm mm mm mm g melanoma in-situ MITF MlanaA mm mm
More informationIn vitro functional study of Cardiomyocyte
In vitro functional study of Cardiomyocyte Gwang Hyeon Eom Department of Pharmacology and Medical Research Center for Gene Regulation Chonnam National University Medical School, Gwangju, South Korea Heart
More informationW J C. World Journal of Cardiology. Heart regeneration: Past, present and future INTRODUCTION. Abstract PAST EDITORIAL
W J C World Journal of Cardiology Online Submissions: http://www.wjgnet.com/1949-8462office wjc@wjgnet.com doi:10.4330/wjc.v2.i5.107 World J Cardiol 2010 May 26; 2(5): 107-111 ISSN 1949-8462 (online) 2010
More informationThe toll-like receptor 4 ligands Mrp8 and Mrp14 play a critical role in the development of autoreactive CD8 + T cells
1 SUPPLEMENTARY INFORMATION The toll-like receptor 4 ligands Mrp8 and Mrp14 play a critical role in the development of autoreactive CD8 + T cells Karin Loser 1,2,6, Thomas Vogl 2,3, Maik Voskort 1, Aloys
More informationNIH Public Access Author Manuscript Circ Res. Author manuscript; available in PMC 2012 June 10.
NIH Public Access Author Manuscript Published in final edited form as: Circ Res. 2011 June 10; 108(12): 1467 1481. doi:10.1161/circresaha.111.240648. The IGF-1 Receptor Identifies a Pool of Human Cardiac
More informationThe recognition that myocyte mitosis occurs in the fetal,
Basic Science for Clinicians Life and Death of Cardiac Stem Cells A Paradigm Shift in Cardiac Biology Piero Anversa, MD; Jan Kajstura, PhD; Annarosa Leri, MD; Roberto Bolli, MD The recognition that myocyte
More informationab Adipogenesis Assay Kit (Cell-Based)
ab133102 Adipogenesis Assay Kit (Cell-Based) Instructions for Use For the study of induction and inhibition of adipogenesis in adherent cells. This product is for research use only and is not intended
More informationValidation of the Cardiosphere Method to Culture Cardiac Progenitor Cells from Myocardial Tissue
Validation of the Cardiosphere Method to Culture Cardiac Progenitor Cells from Myocardial Tissue Darryl R. Davis, Yiqiang Zhang, Rachel R. Smith, Ke Cheng, John Terrovitis, Konstantinos Malliaras, Tao-Sheng
More informationCardiac stem cell isolation and characterization. hcpcs are isolated from heart tissue
SUPPLEMENTAL MATERIAL Cardiac stem cell isolation and characterization. hcpcs are isolated from heart tissue obtained from patients undergoing surgery for Left Ventricular Assist Device (LVAD) implantation
More informationAnnexin V-PE Apoptosis Detection Kit
Annexin V-PE Apoptosis Detection Kit Catalog Number KA0716 100 assays Version: 02 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Background... 3 General Information...
More informationImaging of glycolytic metabolism in primary glioblastoma cells with
63 Chapter 5 Imaging of glycolytic metabolism in primary glioblastoma cells with RIMChip 5.1. Introduction Glioblastoma(GBM) is one of the most common brain tumors 1. It is composed of heterogeneous subpopulations
More informationMATERIALS AND METHODS. Neutralizing antibodies specific to mouse Dll1, Dll4, J1 and J2 were prepared as described. 1,2 All
MATERIALS AND METHODS Antibodies (Abs), flow cytometry analysis and cell lines Neutralizing antibodies specific to mouse Dll1, Dll4, J1 and J2 were prepared as described. 1,2 All other antibodies used
More informationSupplementary Information
Supplementary Information Supplementary Figure 1. CD4 + T cell activation and lack of apoptosis after crosslinking with anti-cd3 + anti-cd28 + anti-cd160. (a) Flow cytometry of anti-cd160 (5D.10A11) binding
More informationCardiac Myocytes are Recruited by Bone Marrow-Derived Cells in Intact Murine Heart
Kobe J. Med. Sci., Vol. 48, No. 6, pp. 161-166, 2002 Cardiac Myocytes are Recruited by Bone Marrow-Derived Cells in Intact Murine Heart SEIMI SATOMI-KOBAYASHI 1, SEINOSUKE KAWASHIMA 1*, TSUYOSHI SAKODA
More informationnachr α 4 β 2 CHO Cell Line
B SYS GmbH nachr α 4 β 2 CHO Cell Line Cell Culture Conditions B SYS GmbH B SYS GmbH nachr α 4 β 2 CHO Page 2 TABLE OF CONTENTS 1 BACKGROUND...3 1.1 Human Nicotinic Acetylcholine Receptors...3 1.2 B SYS
More informationCHO α 1 β 2 γ 2 GABAA Cell Line
B SYS GmbH CHO α 1 β 2 γ 2 GABAA Cell Line Specification Sheet B SYS GmbH B SYS GmbH CHO α 1 β 2 γ 2 Cells Page 2 TABLE OF CONTENTS 1 BACKGROUND...3 1.1 THE PHARMACOLOGICAL DISTINCTION OF GABA A RECEPTOR
More informationEffective activity of cytokine-induced killer cells against autologous metastatic melanoma including cells with stemness features
Effective activity of cytokine-induced killer cells against autologous metastatic melanoma including cells with stemness features Loretta Gammaitoni, Lidia Giraudo, Valeria Leuci, et al. Clin Cancer Res
More informationSupporting Information
Supporting Information Identification of Novel ROS Inducers: Quinone Derivatives Tethered to Long Hydrocarbon Chains Yeonsun Hong,, Sandip Sengupta,, Wooyoung Hur, *, Taebo Sim,, * KU-KIST Graduate School
More informationSupplementary Figure S1. Venn diagram analysis of mrna microarray data and mirna target analysis. (a) Western blot analysis of T lymphoblasts (CLS)
Supplementary Figure S1. Venn diagram analysis of mrna microarray data and mirna target analysis. (a) Western blot analysis of T lymphoblasts (CLS) and their exosomes (EXO) in resting (REST) and activated
More informationSupplementary Materials for
immunology.sciencemag.org/cgi/content/full/2/16/eaan6049/dc1 Supplementary Materials for Enzymatic synthesis of core 2 O-glycans governs the tissue-trafficking potential of memory CD8 + T cells Jossef
More informationPlasmids Western blot analysis and immunostaining Flow Cytometry Cell surface biotinylation RNA isolation and cdna synthesis
Plasmids psuper-retro-s100a10 shrna1 was constructed by cloning the dsdna oligo 5 -GAT CCC CGT GGG CTT CCA GAG CTT CTT TCA AGA GAA GAA GCT CTG GAA GCC CAC TTT TTA-3 and 5 -AGC TTA AAA AGT GGG CTT CCA GAG
More informationNIH Public Access Author Manuscript Circ Res. Author manuscript; available in PMC 2014 March 19.
NIH Public Access Author Manuscript Published in final edited form as: Circ Res. 2014 January 3; 114(1): 41 55. doi:10.1161/circresaha.114.302500. c-kit-positive Cardiac Stem Cells Nested in Hypoxic Niches
More information(a) Significant biological processes (upper panel) and disease biomarkers (lower panel)
Supplementary Figure 1. Functional enrichment analyses of secretomic proteins. (a) Significant biological processes (upper panel) and disease biomarkers (lower panel) 2 involved by hrab37-mediated secretory
More informationSUPPLEMENTARY INFORMATION. CXCR4 inhibitors could benefit to HER2 but not to Triple-Negative. breast cancer patients
SUPPLEMENTARY INFORMATION CXCR4 inhibitors could benefit to HER2 but not to Triple-Negative breast cancer patients Lefort S. 1,2, Thuleau A. 3, Kieffer Y. 1,2, Sirven P. 1,2, Bieche I. 4, Marangoni E.
More informationHCC1937 is the HCC1937-pcDNA3 cell line, which was derived from a breast cancer with a mutation
SUPPLEMENTARY INFORMATION Materials and Methods Human cell lines and culture conditions HCC1937 is the HCC1937-pcDNA3 cell line, which was derived from a breast cancer with a mutation in exon 20 of BRCA1
More informationSupplementary Figure 1 Lymphocytes can be tracked for at least 4 weeks after
Supplementary Figure 1 Lymphocytes can be tracked for at least 4 weeks after photoconversion by using H2B-Dendra2. 4-5 PPs of H2B-Dendra2 BM chimeras were photoconverted and analyzed 7 days (upper panel)
More informationProteomic profiling of small-molecule inhibitors reveals dispensability of MTH1 for cancer cell survival
Supplementary Information for Proteomic profiling of small-molecule inhibitors reveals dispensability of MTH1 for cancer cell survival Tatsuro Kawamura 1, Makoto Kawatani 1, Makoto Muroi, Yasumitsu Kondoh,
More informationSuppl Video: Tumor cells (green) and monocytes (white) are seeded on a confluent endothelial
Supplementary Information Häuselmann et al. Monocyte induction of E-selectin-mediated endothelial activation releases VE-cadherin junctions to promote tumor cell extravasation in the metastasis cascade
More informationNIH Public Access Author Manuscript Circ Res. Author manuscript; available in PMC 2012 April 29.
NIH Public Access Author Manuscript Published in final edited form as: Circ Res. 2011 April 29; 108(9): 1071 1083. doi:10.1161/circresaha.110.239459. The Ephrin A1-EphA2 System Promotes Cardiac Stem Cell
More informationHuman Pluripotent Stem Cell Cardiomyocyte Differentiation Kit (PSCCDK) Introduction Kit Components Cat. # # of vials Reagent Quantity Storage
Human Pluripotent Stem Cell Cardiomyocyte Differentiation Kit (PSCCDK) Catalog #5901 Introduction Human pluripotent stem cells (hpsc), including embryonic stem cells (ESC) and induced pluripotent stem
More informationAttempts made to introduce cell therapy in the management. Molecular Cardiology
Molecular Cardiology Cardiac Progenitor Cells and Biotinylated Insulin-Like Growth Factor-1 Nanofibers Improve Endogenous and Exogenous Myocardial Regeneration After Infarction M. Elena Padin-Iruegas,
More informationCANINE CARDIAC MYOCYTE ISOLATION PROTOCOL November 2000
CANINE CARDIAC MYOCYTE ISOLATION PROTOCOL November 2000 I. Preparation for cell isolation: A. Make sure the following items are autoclaved: 1. 1-8X8 baking dish 6. 3-1 liter bottles 2. 2-500 ml beaker
More informationFig. S4. Current-voltage relations of iglurs. A-C: time courses of currents evoked by 100 ms pulses
Fig. S1. Immunohistochemical detection of iglur2 protein in single islet cells. A: α cells identified using glucagon-specific antibody express the iglur2 subtype of AMPA receptor. 24 out of 26 identified
More informationSupplementary Figure S1. Flow cytometric analysis of the expression of Thy1 in NH cells. Flow cytometric analysis of the expression of T1/ST2 and
Supplementary Figure S1. Flow cytometric analysis of the expression of Thy1 in NH cells. Flow cytometric analysis of the expression of T1/ST2 and Thy1 in NH cells derived from the lungs of naïve mice.
More informationErzsebet Kokovay, Susan Goderie, Yue Wang, Steve Lotz, Gang Lin, Yu Sun, Badrinath Roysam, Qin Shen,
Cell Stem Cell, Volume 7 Supplemental Information Adult SVZ Lineage Cells Home to and Leave the Vascular Niche via Differential Responses to SDF1/CXCR4 Signaling Erzsebet Kokovay, Susan Goderie, Yue Wang,
More informationL6 GLUT4myc Cell Growth Protocol
L6 GLUT4myc Cell Growth Protocol Background: Parental L6 cells selected for high fusion (2, 3) were stably transfected with a rat GLUT4 cdna carrying a myc epitope (recognized by the commercially available
More informationSupplemental Information. T Cells Enhance Autoimmunity by Restraining Regulatory T Cell Responses via an Interleukin-23-Dependent Mechanism
Immunity, Volume 33 Supplemental Information T Cells Enhance Autoimmunity by Restraining Regulatory T Cell Responses via an Interleukin-23-Dependent Mechanism Franziska Petermann, Veit Rothhammer, Malte
More informationRNA extraction, RT-PCR and real-time PCR. Total RNA were extracted using
Supplementary Information Materials and Methods RNA extraction, RT-PCR and real-time PCR. Total RNA were extracted using Trizol reagent (Invitrogen,Carlsbad, CA) according to the manufacturer's instructions.
More informationAnnexin V-Cy3 Apoptosis Detection Kit
ab14142 Annexin V-Cy3 Apoptosis Detection Kit Instructions for Use For the rapid, sensitive and accurate measurement of apoptosis in various samples. This product is for research use only and is not intended
More informationEx vivo Human Antigen-specific T Cell Proliferation and Degranulation Willemijn Hobo 1, Wieger Norde 1 and Harry Dolstra 2*
Ex vivo Human Antigen-specific T Cell Proliferation and Degranulation Willemijn Hobo 1, Wieger Norde 1 and Harry Dolstra 2* 1 Department of Laboratory Medicine - Laboratory of Hematology, Radboud University
More information2-Deoxyglucose Assay Kit (Colorimetric)
2-Deoxyglucose Assay Kit (Colorimetric) Catalog Number KA3753 100 assays Version: 01 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Background... 3 General Information...
More informationExosomes/tricalcium phosphate combination scaffolds can enhance bone regeneration by activating the PI3K/Akt signalling pathway
Exosomes/tricalcium phosphate combination scaffolds can enhance bone regeneration by activating the PI3K/Akt signalling pathway Jieyuan Zhang, Xiaolin Liu, Haiyan Li, Chunyuan Chen, Bin Hu, Xin Niu, Qing
More informationInternational Graduate Research Programme in Cardiovascular Science
1 International Graduate Research Programme in Cardiovascular Science This work has been supported by the European Community s Sixth Framework Programme under grant agreement n LSHM-CT-2005-01883 EUGeneHeart.
More informationIn vitro human regulatory T cell expansion
- 1 - Human CD4 + CD25 + regulatory T cell isolation, Workflow in vitro expansion and analysis In vitro human regulatory T cell expansion Introduction Regulatory T (Treg) cells are a subpopulation of T
More informationActa Physiologica Sinica
, 1999 4, 51 (2), 187 192 187 Acta Physiologica Sinica 3 1998204222 1998206203 3 (No139500052) 3 3, 221002 3 3 3 3 3 (, 200031) ( Ito), 28 d (H28, 6 h/ d), Ito (16118 4161 6132 1135 pa/ pf, P < 0105),
More informationSupplementary data Supplementary Figure 1 Supplementary Figure 2
Supplementary data Supplementary Figure 1 SPHK1 sirna increases RANKL-induced osteoclastogenesis in RAW264.7 cell culture. (A) RAW264.7 cells were transfected with oligocassettes containing SPHK1 sirna
More informationEssential Medium, containing 10% fetal bovine serum, 100 U/ml penicillin and 100 µg/ml streptomycin. Huvec were cultured in
Supplemental data Methods Cell culture media formulations A-431 and U-87 MG cells were maintained in Dulbecco s Modified Eagle s Medium. FaDu cells were cultured in Eagle's Minimum Essential Medium, containing
More informationEML Erythroid and Neutrophil Differentiation Protocols Cristina Pina 1*, Cristina Fugazza 2 and Tariq Enver 3
EML Erythroid and Neutrophil Differentiation Protocols Cristina Pina 1*, Cristina Fugazza 2 and Tariq Enver 3 1 Department of Haematology, University of Cambridge, Cambridge, UK; 2 Dipartimento de Biotecnologie
More informationSupplementary Figures
Inhibition of Pulmonary Anti Bacterial Defense by IFN γ During Recovery from Influenza Infection By Keer Sun and Dennis W. Metzger Supplementary Figures d a Ly6G Percentage survival f 1 75 5 1 25 1 5 1
More informationSUPPLEMENTARY INFORMATION. Involvement of IL-21 in the epidermal hyperplasia of psoriasis
SUPPLEMENTARY INFORMATION Involvement of IL-21 in the epidermal hyperplasia of psoriasis Roberta Caruso 1, Elisabetta Botti 2, Massimiliano Sarra 1, Maria Esposito 2, Carmine Stolfi 1, Laura Diluvio 2,
More informationSupporting Information. Calculation of the relative contributions of myocyte proliferation, stem cell. Supporting Information Fig 1 (page 9)
Supporting Information Table of contents Calculation of the relative contributions of myocyte proliferation, stem cell differentiation and cardioprotection (page 2) Supporting Information Fig 1 (page 9)
More informationImmature organoids appear after hours.
THE ESSENTIALS OF LIFE SCIENCE RESEARCH GLOBALLY DELIVERED Allison Ruchinskas, B.S., and James Clinton, Ph.D. ATCC Cell Systems, Gaithersburg, MD INTRODUCTION Figure 1. Mouse small intestinal organoid
More informationIn vitro human regulatory T cell expansion
- 1 - Human CD4 + CD25 + CD127 dim/- regulatory T cell Workflow isolation, in vitro expansion and analysis In vitro human regulatory T cell expansion Introduction Regulatory T (Treg) cells are a subpopulation
More information9/23/2017. Prof. Steven S. Saliterman. Department of Biomedical Engineering, University of Minnesota
Department of Biomedical Engineering, University of Minnesota http://saliterman.umn.edu/ Murphy, S. V., and A. Atala. "3d Bioprinting of Tissues and Organs." Nature Biotechnology 32, no. 8 (Aug 2014):
More informationEpithelial interleukin-25 is a key mediator in Th2-high, corticosteroid-responsive
Online Data Supplement: Epithelial interleukin-25 is a key mediator in Th2-high, corticosteroid-responsive asthma Dan Cheng, Zheng Xue, Lingling Yi, Huimin Shi, Kan Zhang, Xiaorong Huo, Luke R. Bonser,
More informationFigure S1. PMVs from THP-1 cells expose phosphatidylserine and carry actin. A) Flow
SUPPLEMENTARY DATA Supplementary Figure Legends Figure S1. PMVs from THP-1 cells expose phosphatidylserine and carry actin. A) Flow cytometry analysis of PMVs labelled with annexin-v-pe (Guava technologies)
More informationDownregulation of serum mir-17 and mir-106b levels in gastric cancer and benign gastric diseases
Brief Communication Downregulation of serum mir-17 and mir-106b levels in gastric cancer and benign gastric diseases Qinghai Zeng 1 *, Cuihong Jin 2 *, Wenhang Chen 2, Fang Xia 3, Qi Wang 3, Fan Fan 4,
More informationPBMC from each patient were suspended in AIM V medium (Invitrogen) with 5% human
Anti-CD19-CAR transduced T-cell preparation PBMC from each patient were suspended in AIM V medium (Invitrogen) with 5% human AB serum (Gemini) and 300 international units/ml IL-2 (Novartis). T cell proliferation
More informationRayBio Annexin V-FITC Apoptosis Detection Kit
RayBio Annexin V-FITC Apoptosis Detection Kit User Manual Version 1.0 May 25, 2014 (Cat#: 68FT-AnnV-S) RayBiotech, Inc. We Provide You With Excellent Support And Service Tel:(Toll Free)1-888-494-8555 or
More informationPrimary Adult Naïve CD4+ CD45RA+ Cells. Prepared by: David Randolph at University of Alabama, Birmingham
Primary Adult Naïve CD4+ CD45RA+ Cells Prepared by: David Randolph (drdrdr@uab.edu) at University of Alabama, Birmingham Goal: To obtain large numbers of highly pure primary CD4+ CD45RO- CD25- cells from
More informationMouse primary keratinocytes preparation
Mouse primary keratinocytes preparation 1. Fill a 150 X 25 mm petri dish with ice. Put newborn mice (2 3 days old) in the petri dish and insert it in an ice bucket. Leave the mice in the ice bucket for
More informationSupplementary Information and Figure legends
Supplementary Information and Figure legends Table S1. Primers for quantitative RT-PCR Target Sequence (5 -> 3 ) Target Sequence (5 -> 3 ) DAB2IP F:TGGACGATGTGCTCTATGCC R:GGATGGTGATGGTTTGGTAG Snail F:CCTCCCTGTCAGATGAGGAC
More informationCD14 + S100A9 + Monocytic Myeloid-Derived Suppressor Cells and Their Clinical Relevance in Non-Small Cell Lung Cancer
CD14 + S1A9 + Monocytic Myeloid-Derived Suppressor Cells and Their Clinical Relevance in Non-Small Cell Lung Cancer Po-Hao, Feng M.D., Kang-Yun, Lee, M.D. Ph.D., Ya-Ling Chang, Yao-Fei Chan, Lu- Wei, Kuo,Ting-Yu
More informationSupplementary Figure 1
Supplementary Figure 1 The average sigmoid parametric curves of capillary dilation time courses and average time to 50% peak capillary diameter dilation computed from individual capillary responses averaged
More informationFigure S1, related to Figure 1. Escaper p38a-expressing cancer cells repopulate the tumors (A) Scheme of the mt/mg reporter that expresses a
Cancer Cell, Volume 33 Supplemental Information Targeting p38a Increases DNA Damage, Chromosome Instability, and the Anti-tumoral Response to Taxanes in Breast Cancer Cells Begoña Cánovas, Ana Igea, Alessandro
More informationFACOLTÀ DI MEDICINA E CHIRURGIA DIPARTIMENTO DI SCIENZE BIOMORFOLOGICHE E FUNZIONALI
UNIVERSITÀ DEGLI STUDI DI NAPOLI "FEDERICO II" FACOLTÀ DI MEDICINA E CHIRURGIA DIPARTIMENTO DI SCIENZE BIOMORFOLOGICHE E FUNZIONALI Scuola di Dottorato in Morfologia Clinica e Patologica (XX ciclo) Coordinatore:
More informationT H 1, T H 2 and T H 17 polarization of naïve CD4 + mouse T cells
A complete workflow for cell preparation, isolation, polarization and analysis T H 1, T H 2 and T H 17 polarization of naïve CD4 + mouse T cells Introduction Workflow CD4 + T helper (T H) cells play a
More informationImpact factor: Reporter:4A1H0019 Chen Zi Hao 4A1H0023 Huang Wan ting 4A1H0039 Sue Yi Zhu 4A1H0070 Lin Guan cheng 4A1H0077 Chen Bo xuan
Curcumin Protects Neonatal Rat Cardiomyocytes against High Glucose-Induced Apoptosis via PI3K/Akt Signalling Pathway Wei Yu,1,2 Wenliang Zha,1 Zhiqiang Ke,1 Qing Min,2 Cairong Li,1 Huirong Sun,3 and Chao
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION FOR Liver X Receptor α mediates hepatic triglyceride accumulation through upregulation of G0/G1 Switch Gene 2 (G0S2) expression I: SUPPLEMENTARY METHODS II: SUPPLEMENTARY FIGURES
More informationIn vitro bactericidal assay Fig. S8 Gentamicin protection assay Phagocytosis assay
In vitro bactericidal assay Mouse bone marrow was isolated from the femur and the tibia. Cells were suspended in phosphate buffered saline containing.5% BSA and 2 mm EDTA and filtered through a cell strainer.
More informationENGINEERING THREE DIMENSIONAL CARDIOSPHERES FROM PLURIPOTENT STEM CELLS
ENGINEERING THREE DIMENSIONAL CARDIOSPHERES FROM PLURIPOTENT STEM CELLS A Thesis Presented to The Academic Faculty by Nicole Votaw In Partial Fulfillment of the Requirements for the Degree B.S. in Biomedical
More informationThe Annexin V Apoptosis Assay
The Annexin V Apoptosis Assay Development of the Annexin V Apoptosis Assay: 1990 Andree at al. found that a protein, Vascular Anticoagulant α, bound to phospholipid bilayers in a calcium dependent manner.
More informationSupplementary Figure (OH) 22 nanoparticles did not affect cell viability and apoposis. MDA-MB-231, MCF-7, MCF-10A and BT549 cells were
Supplementary Figure 1. Gd@C 82 (OH) 22 nanoparticles did not affect cell viability and apoposis. MDA-MB-231, MCF-7, MCF-10A and BT549 cells were treated with PBS, Gd@C 82 (OH) 22, C 60 (OH) 22 or GdCl
More informationVEGFR2-Mediated Vascular Dilation as a Mechanism of VEGF-Induced Anemia and Bone Marrow Cell Mobilization
Cell Reports, Volume 9 Supplemental Information VEGFR2-Mediated Vascular Dilation as a Mechanism of VEGF-Induced Anemia and Bone Marrow Cell Mobilization Sharon Lim, Yin Zhang, Danfang Zhang, Fang Chen,
More information