Pulmonary hypertension and vascular remodeling in mice exposed to crystalline silica

Transcription

1 Zelko et l. Respirtory Reserch (216) 17:16 DOI /s RESEARCH Pulmonry hypertension nd vsculr remodeling in mice exposed to crystlline silic Igor N. Zelko 1,2, Jinxin Zhu 1, Jeffrey D. Ritzenthler 1 nd Jesse Romn 1,3 Open Access Abstrct Bckground: Occuptionl nd environmentl exposure to crystlline silic my led to the development of silicosis, which is chrcterized by inflmmtion nd progressive fibrosis. A substntil number of ptients dignosed with silicosis develop pulmonry hypertension. Pulmonry hypertension ssocited with silicosis nd with relted restrictive lung diseses significntly reduces survivl in ffected subjects. An niml model of silicosis hs been described previously however, the mgnitude of vsculr remodeling nd hemodynmic effects of inhled silic re lrgely unknown. Considering the importnce of such informtion, this study investigted whether mice exposed to silic develop pulmonry hypertension nd vsculr remodeling. Methods: C57BL6 mice were intrtrchelly injected with either sline or crystlline silic t doses.2 g/kg,.3 g/kg nd.4 g/kg nd then studied t dy 28 post-exposure. Pulmonry hypertension ws chrcterized by chnges in right ventriculr systolic pressure nd lung histopthology. Results: Mice exposed to sline showed norml lung histology nd hemodynmic prmeters while mice exposed to silic showed incresed right ventriculr systolicpressurendmrkedlungpthology chrcterized by grnulomtous inflmmtory rection nd incresed collgen deposition. Silic-exposed mice lso showed signs of vsculr remodeling with pulmonry rtery musculriztion, vsculr occlusion, nd medil thickening. The expression of pro-inflmmtory genes such s TNF-α nd MCP-1 ws significntly upregulted s well s the expression of the pro-remodeling genes collgen type I, fibronectin nd the metlloproteinses MMP-2 nd TIMP-1. On the other hnd, the expression of severl vsculture specific genes involved in the regultion of endothelil function ws significntly ttenuted. Conclusions: We chrcterized new niml model of pulmonry hypertension secondry to pulmonry fibrosis induced by crystlline silic. Our dt suggest tht silic promotes the dmge of the pulmonry vsculture through mechnisms tht might involve endothelil dysfunction, inflmmtion, nd vsculr remodeling. Keywords: Silicosis, Pulmonry hypertension, Vsculr remodeling, Animl model Bckground Exposure to silic my occur in vriety of working nd living environments since crystlline silic is one of the most bundnt minerls on erth. For exmple, occuptionl expose to silic occurs during mining, stone cutting, tunneling nd qurrying [1]. Environmentl exposure to silic my occur during snd storms, during inhltion of Correspondence: igor.zelko@louisville.edu 1 Deprtment of Medicine, Division of Pulmonry, Criticl Cre, nd Sleep Medicine, University of Louisville, Louisville, KY 422, USA 2 Deprtment of Biochemisry nd Moleculr Genetics, University of Louisville, Louisville, KY 422, USA Full list of uthor informtion is vilble t the end of the rticle very fine prticles of windblown soil, nd following volcnic eruptions. Chronic inhltion of crystlline silic promotes the development of severl diseses such s silicosis, chronic obstructive pulmonry diseses (COPD), nd lung cncer [2, 3]. Silicosis is fibrotic pneumoconiosis chrcterized by nonneoplstic grnulomtous nd fibrotic chnges in the lung. Silic-exposed ptients remin symptomtic for decdes when eventully dignosed by the presence of fine nodulr opcities in the lung by chest X-ry or CT-scn [4]. Depending of dose nd time of exposure, silic my produce cute or vrious forms of chronic silicosis [5]. The Author(s). 216 Open Access This rticle is distributed under the terms of the Cretive Commons Attribution 4. Interntionl License ( which permits unrestricted use, distribution, nd reproduction in ny medium, provided you give pproprite credit to the originl uthor(s) nd the source, provide link to the Cretive Commons license, nd indicte if chnges were mde. The Cretive Commons Public Domin Dediction wiver ( pplies to the dt mde vilble in this rticle, unless otherwise stted.

2 Zelko et l. Respirtory Reserch (216) 17:16 Pge 2 of 14 In generl, two mjor stges cn be defined during silicosis progression. First, n inflmmtory stge chrcterized by the relese of inflmmtory meditors such s IL-1β, IL-6,TNF-α tht cn continue to be relesed into the second fibrotic stge. The second stte is fibrotic stge chrcterized by excess deposition of extrcellulr mtrix proteins such s collgen nd fibronectin [6, 7]. Although the exct mechnisms responsible for these chnges remin uncler, it is well estblished tht inhled silic prticles re engulfed by mcrophges, which leds to cell ctivtion nd deth followed by the relese of intrcellulr silic tht is then tken up by other mcrophges. This recurring cycle of cell deth nd mcrophge ctivtion produces the influx of inflmmtory cells nd the production of cytokines nd rective oxygen nd nitrogen species [8]. These inflmmtory meditors re ble to enter the pulmonry nd systemic circultions where they cn produce vsculr injury. Moreover, ultr-fine silic prticles my cross the pulmonry epithelium into the vsculr bed nd directly ffect the integrity of the vsculr endothelium [9, 1]. Interestingly, crdiovsculr diseses re mong the leding cuses of deth in ptients with silicosis [11]. The recurring injury to the pulmonry vsculture my led to the development of pulmonry hypertension. Pulmonry hypertension results from prolifertive vsculopthy of the smll pulmonry rteries nd rterioles of the lung best chrcterized by vsoconstriction, cellulr hyperplsi, fibrosis, nd thrombosis. These constricted or blocked rteries led to incresed pressure in the vessels nd in the right ventricle of the hert. If left untreted, the right ventriculr chmber hypertrophies leding to premture right hert filure. In the United Sttes, bout 2, hospitliztions occur nnully due to pulmonry hypertension s primry or secondry dignosis. About 15, deths per yer re scribed to pulmonry hypertension, lthough this is likely low estimte [12]. The contribution of silicosis to these sttistics is likely smll, but it hs been shown tht pulmonry hypertension in ptients with silicosis is linked with poorer prognosis [13]. Similrly, COPD nd diffuse prenchyml lung diseses, including idiopthic lung fibrosis nd srcoidosis, re ssocited with high incidence of pulmonry hypertension [14, 15]. Ptients with combined interstitil lung disese nd pulmonry hypertension hve significntly lower survivl rte nd qulity of life. Becuse of its clinicl relevnce, elucidting the mechnisms by which silicosis my led to pulmonry hypertension is considered importnt. Animl models of silic exposure exist nd, s observed in humns, silic induces grnulomtous chnges in the lungs of these nimls, resulting from the loose ggregtion of ctivted fomy histiocytes nd lymphocytes or well orgnized nodulr structures consisting of epitheloid mcrophges nd multinucleted gint cells [16, 17]. However, there re currently nowell-describedinvivo models of silic exposure tht demonstrte incresed risk of pulmonry vsculr remodeling nd pulmonry hypertension. The objective of this study ws to determine whether silic exposure leds to incresed right ventriculr systolic pressure (RVSP) nd vsculr remodeling in pulmonry rteries. We now provide evidence tht RVSP nd vsculr bnormlities re mrkedly incresed in silicexposed mice compred to control mice. Methods Experimentl nimls nd niml cre The reserch protocol ws pproved by the Institutionl Animl Cre nd Use Committee of the University of Louisville, nd the cre nd hndling of the nimls were in ccordnce with Ntionl Institutes of Helth guidelines. C57BL6 mice were obtined from Jckson Lbortory (Br Hrbor, ME). Animl model Adult mle C57BL6 mice (1 weeks of ge) were seprted into 5 experimentl groups with 5 nimls per group. Animls were nesthetized nd plced in the supine position. Using sterile technique, the trche ws exposed vi midline neck incision followed by instilltion of silic or sline. Crystlline silic ws sterilized t 2 C for 2 h to inctivte endotoxin contmintion. Silic suspension in sterile.9% NCl ws prepred by vigorous vortexing immeditely prior to intrtrchel dministrtion. Using 27-guge needle ttched to microliter syringe,.2 g/kg,.3 g/kg nd.4 g/kg of crystlline silic suspension or the equivlent volume of sline ws instilled into the trche. The fifth group of mice ws instilled with 3.5 U/kg of bleomycin (APP Phrmceuticls, Schumburg, IL). The incision ws then closed using surgicl clips, nd nimls were llowed to recover. Twenty-eight dys fter intrtrchel instilltion of silic, RSVP prmeters were mesured nd lung nd hert tissues were hrvested for morphologicl, biochemicl, nd histochemicl nlyses. Bleomycininjected mice (3.5 U/kg) were used s positive control nd were nlyzed 21 dys lter. Tissue ws immeditely processed or quick-frozen in liquid nitrogen. Regents Primers nd probes for rel-time PCR were obtined from Integrted DNA nd ThermoFisher Scientific. All other chemicls nd enzymes were from Sigm Chemicl Co. (St. Louis, MO), or Invitrogen (Crlsbd, CA). Crystlline silic ws gift from US Silic (Min-U-Sil-5, US Silic, Frederick, MD).

3 Zelko et l. Respirtory Reserch (216) 17:16 Pge 3 of 14 Hemodynmic mesurements RVSP ws determined with 1 F pressure trnsducer ctheter (Millr Instruments) nd LbChrt 8 softwre (AD Instruments). Briefly, the 1 F pressure trnsducer ws inserted through the right externl jugulr vein of nesthetized mice (1 mg ketmine/5 mg xylzine/kg of body weight, i.p.). Mice were plced on therml pltes to keep body temperture constnt t 37 C. Then, pressure ctheter ws threded into the right ventricle nd RVSP ws recorded using PowerLb 4/35 (AD Instruments) nd nlyzed using LbChrt 8 softwre. Lung nd hert histology Hert nd lungs were flushed with PBS nd inflted nd fixed with 1% formlin overnight, then embedded in prffin, sectioned t thickness of 5 μm, nd stined with Mson s trichrome to visulize lung morphology, fibrosis nd vsculr remodeling. Imges were cptured by high-resolution digitl cmer connected to light microscope using 4 nd 4 mgnifiction lenses. The evlution nd imge nlysis procedures were performed using ImgeJ softwre. Immunohistochemicl stining of mouse lungs for smooth muscle, von Willebrnd Fctor (vwf), LY-6B nd CD17b Longitudinl sections (5 μm) of left lung lobe were hydrted nd ntigen retrievl ws first performed by incubting with.1% pronse for 5 min t 37 C nd then heting the slides in 1 mm sodium citrte (ph 6.) plus.5% Tween 2 t 98 C for 1 min. Sections were stined with nti-smooth muscle ctinlph ntibodies clone 1A4 (Sigm) t concentrtion 23 ng/μl, nti-vwf ntibodies H-3 (Sigm), nti-ly-6b nd nti CD-17b ntibodies (Bio-Rd) t concentrtion 1 ng/μl. After wshing, the slides were incubted with secondry ntibodies lbeled with either AlexFluor 488 or AlexFluor 594. To determine the specificity of stining, lung sections were incubted with control, non-immune IgG. Slides were nlyzed with fluorescent microscopy. Imges were processed using ImgeJ (Ntionl Institutes of Helth, Bethesd, MA). Pulmonry rteries were defined s vessels tht ccompnied irwys (veins re interlobulr). To mesure percent of re stined with specific mrker of neutrophils nd mcrophges we used ImgeJ softwre. For silic nd bleomycin treted lung t lest four different res showing pulmonry rteries nd silicotic grnuloms or fibrotic lesions were selected. The stined res were selected by thresholding nd then clculted using prticles nlysis extension of ImgeJ. The sme prmeters for thresholding nd for clcultion of prticles were pplied to ll imges. Right ventriculr hypertrophy After hemodynmic mesurements, the herts were removed nd right nd left ventricles nd septum were seprted.thertiooftherightventriculrweighttothesum of left ventriculr nd septl weight (RV/[LV + S]) served s mesure for right ventriculr hypertrophy. Grnulom re clcultion In sections stined with Mson s trichrome, the totl re of lung section nd grnulom re were determined using ImgeJ softwre. Three to four imges of ech lung were tken t 4 mgnifiction to cover entire lung lobe. Grnulom re percentge ws clculted by dividing grnulom re by totl lung re nd multiplying by 1. Pulmonry vessels morphometry To ssess musculriztion of pulmonry vessels, ll blood vessels rnging from 1 1 μm in dimeter were counted in t lest four fields t 4 mgnifiction. The counted vessels were ctegorized s fully musculrized (95 1% of medil lyer covered by nti-αsma stining), prtilly musculrized (1 95% of medil lyer is covered by nti-αsma stining), or nonmusculrized vessels. The percentge of pulmonry vessels in ech ctegory ws clculted by dividing the number of vessels in the ctegory by the totl number of counted vessels in the sme field. Morphometric nlysis The dimeter nd wll thickness of rteries were mesured using ImgeJ softwre, fter the number of pixels were clibrted ccording to the scle brs for ech mgnifiction. The vlues of medil wll thickness were clculted s outer dimeter minus inner dimeter divided by 2. At lest four vessels were counted for ech mouse lung. The nlysis nd mesurement of α-sma stining ws evluted by n investigtor blinded to tretment groups. Quntittive RT-PCR Totl RNA ws prepred from the superior lobe of right lung using RNAqueous-Micro Kit (Applied Biosystems, Foster City, CA). The synthesis of single strnded DNA from RNA ws performed using SuperScript First-Strnd Synthesis System for RT-PCR nd rndom hexmers (Invitrogen, Crlsbd, CA), ccording to the protocol provided by mnufcturer. To quntitte the bundnce of gene-specific mrnas, quntittive PCR ws undertken using the StepOnePlus Rel-Time PCR Detection System (Applied Biosystems) nd n SYBR Green Mster Mix. The PCR cycles were 95 C for 3 min, then 4 cycles of 95 C for 15 s, 6 C for 1 min. The mouse fibronectin primers were forwrd (5 - GAC TGT ACT TGT CTA GGC GAA G -3 ) nd reverse (5 -GTT TCC TCG GTT GTC CTT CT-3 ), mouse PECAM-1 primers were forwrd (5 -AGA GAC

4 Zelko et l. Respirtory Reserch (216) 17:16 Pge 4 of 14 GGT CTT GTC GCA GT-3 ) ndreverse(5 -TAC TGG GCT TCG AGA GCA TT-3 ), mouse Endothelin 1 primers were forwrd (5 - TCT GCA CTC CAT TCT CAG C-3 ) nd reverse (5 - CGTGATCTTCTCTCTGCTGTT C-3 ), mouse Pltelet Fctor 4 (PF4) primers were forwrd (5 - ACC ATC TCC TCT GGG ATC CAT-3 ) nd reverse (5 -CCA TTC TTC AGG GTG GCT ATG AG-3 ), mouse Nestin primers were forwrd (5 -GGA AAG CCA AGA GAA GCC T-3 ) nd reverse (5 -CAC CTC AAG ATG TCC CTT AGT C-3 ). PCR ssys were run in triplicte, nd gene expression ws normlized to β-actin mrna levels. Primers for β-actin were forwrd (5 - ACA GCT TCT TTG CAG CTC CT-3 ) nd reverse (5 -CCA TCA CAC CCT GGT GCC TA-3 ). Anlysis of Col11, Timp1, Ctgf, Tnf nd Mmp2 were performed using custom gene expression ssys with FAM lbeled probe obtined from Applied Biosystems. The mrna levels for these genes were normlized for β-actin mrna levels tht were detected with custom gene expression ssy with VIC lbeled probe. Dt nlysis Vlues were expressed s mens ± SEM. Comprisons between multiple independent groups were mde by using One-wy ANOVA followed by post hoc nlysis with the Holm-Sidk test. Dt of two groups were compred with unpired t-test. A p-vlue of <.5 indicted sttisticlly significnt differences. Results Silic exposure cuses weight loss Instilltion of incresing mounts of crystlline silic into the trche of nimls led to the progressive loss of body weight t dy 2 nd dy 4 fter the strt of the tretment (Fig. 1). With silic dose of.4 g/kg, mice lost up to 16% of their body weight, but regined close to the weight of the control group by dy 14. This quick recovery of body weight is in contrst with our observtions fter bleomycin tretment where weight loss ws more severe nd mximum body weight loss ws observed round dy 1 (dt not shown). Bleomycin-treted mice did not regin their body weight to the level of control mice even t dy 21. Similrly to the weight loss, survivl of mice fter tretment ws ffected only in the bleomycin group (2 mice out of totl 5 mice died (4% mortlity). Silic-induced lung fibrosis To confirm the effects of silic instilltion on the pthogenesis of lung inflmmtion nd fibrosis, the lung tissues of mice were observed using light microscopy to monitor pthologicl chnges. No obvious bnormlities were evluted in the lungs of mice tht received sline t dys 28 (Fig. 1b, Left Imge). Conversely, cellulr nodules, fibrotic bnds, nd mrked collgen deposition determined by trichrome stining were observed in the silic-treted groups. Quntittive nlysis of the re of the fibrotic nodules indicted significnt nd dosedependent increse of lesion re in the lung of silictreted mice (Fig. 1c). These dt correlted with loss of body weight depicted in Fig. 1. Crystlline silic increses right ventricle (RV) systolic pressure To evlute the dose-dependent effects of silic on right ventricle systolic pressure (RVSP), mice were nesthetized nd RV systolic pressure ws mesured using pressure ctheter. Significnt chnges in RVSP were observed in silic-treted mice (from ± 1.1 mmhg in control to 3.75 ± 1.28 mmhg; p <.5) in mice treted with silic t dose.4 g/kg (see Fig. 2). Tretment of mice with bleomycin incresed RVSP to ± mmhg (Fig.2b).However,nochngesinRVhypertrophymesured s rtio of RV/(S + LV) were observed (Fig. 2c). These dt indicte tht silic exposure induced pulmonry hypertension, but the ltter ws either not severe enough to cuse RV hypertrophy or more time ws required to observe these effects. Morphologicl chnges in pulmonry rteries of silictreted mice Next, we nlyzed the effect of silic on pulmonry vsculr remodeling. Control mice showed norml pulmonry rtery structures (Fig. 3-c). Mice exposed to crystlline silic through intrtrchel instilltion developed mrked vsculr remodeling. The most obvious vsculr bnormlities observed were detected ner inflmmtory grnules nd fibrotic lesions. The representtive imges presented in Fig. 3d-f indicted tht pulmonry rteries showed vsculr wll thickening (see rrows). In ddition, vessels locted in close proximity to inflmmtory nodules in some cses becme completely surrounded by inflmmtory cells (Fig. 3g) nd/or surrounded by collgen fibrils (Fig. 3h). Intiml hypertrophy ws observed in some pulmonry vessels (Fig. 3i). These histologicl observtions indicte tht pulmonry vsculr wlls undergo significnt remodeling in the lungs of silic-treted mice. Induction of inflmmtory nd extrcellulr mtrix genes Quntittive rel-time PCR ws performed to mesure the levels of collgen type I (Col11), fibronectin (Fn1), TIMP-1, MMP-2, CTGF nd TNF-α mrnas in the right lung. The mrna expression of collgen type I nd fibronectin ws mrkedly elevted the lungs of nimls exposed to silic t dose of.3 g/kg nd.4 g/kg, indicting the induction of pro-fibrotic genes in silic-treted lungs (Fig. 4-b). Even greter increses were detected for mrna levels of TIMP-1 (7 fold) nd of MMP-2; (2.2 fold), over control mice (Fig. 4c-d). The expression of

5 Zelko et l. Respirtory Reserch (216) 17:16 Pge 5 of % Body Weight Control Silic.2 g/kg Silic.3 g/kg Silic.4 g/kg b Dys c Control 12 1 Silic Grnulom re, % g/kg.3 g/kg.4 g/kg Silic Fig. 1 Weight loss nd silicotic nodules in mice treted with crystlline silic. C57BL6 mle mice were intrtrchelly injected with different mount of crystlline silic suspension. Mice were scrificed 28 dys lter., Silic-induced body weight chnges in mice were mesured t 2, 4, 7, 14, 21 nd 28 dys following silic dministrtion. Mice receiving higher doses of silic showed more weight loss. Results re expressed s the men of five mice +/ SD. b, Morphologic evidence of silic-induced lung injury. Representtive imges of lung from control nd silic-treted mice. Arrows indicte grnulomtous lesions. c, Quntittive nlysis of grnulomtosis in lung of silic-treted mice. p <.5 when compred between tretments, One Wy ANOVA with Holm-Sidk post test pro-inflmmtory meditors TNF-α nd MCP-1 ws lso incresed from 3- to 5-fold compred to control mice (Fig. 4f nd dt not shown). Increses in the mrna expression of these genes were lso detected in the bleomycin model (Fig. 4g). On the other hnd, no induction of CTGF mrna expression ws observed in silic-treted mice in contrst to bleomycin-treted lungs (Fig. 4e nd g). Interestingly, while expression of Col11, Fn1, Timp1 nd Mmp2 genes ws induced to higher extent in bleomycin-treted lungs compred to silic-treted lungs, the expression of the TNF-α gene ws unchnged in the bleomycin group (Fig. 4g). These dt indicte tht silic induces significnt chnges in expression of pro-fibrotic nd pro-inflmmtory genes

6 Zelko et l. Respirtory Reserch (216) 17:16 Pge 6 of RVSP, mmhg RVSP, mmhg N=4 N=5 N=5 N=5 Control.2 g/kg.3 g/kg.4 g/kg Silic c.3 1 Control Bleomycin.25 RV/(LV+S) N=4 N=5 N=5 N=5 Control.2 g/kg.3 g/kg.4 g/kg Fig. 2 Elevtion of right ventriculr systolic pressure in mice treted with silic. Mice treted with different concentrtion of silic for 28 dys () or bleomycin for 21 dys (b) were nlyzed for right ventricle systolic pressure (RVSP) using 1 F pressure-trnsducer ctheter (Millr). c, Rtio of right ventricle (RV) to left ventricle (LV) plus septum (S) ws determined by dissecting RV from LV nd S. The results re shown s men ± SEM, p <.5 when compred to control lung, One Wy ANOVA with Holm-Sidk post test Control b c d e f Silic g h i Fig. 3 Histologicl nlysis of vsculr bnormlities in lung from silic-treted mice. Mouse lung were stined with Mson s trichrome nd imged using 4 mgnifiction. Pnel -c: representtive imges of pulmonry rteries from control mice. Pnel d-i: imges of pulmonry rteries with different vsculr bnormlities. Vsculr wll thickening (d-f); inflmmtory cells nd collgen deposition round pulmonry rteries (g-h); endothelil prolifertion (i)

7 Zelko et l. Respirtory Reserch (216) 17:16 Pge 7 of 14 b c d e f g Fig. 4 (See legend on next pge.)

8 Zelko et l. Respirtory Reserch (216) 17:16 Pge 8 of 14 (See figure on previous pge.) Fig. 4 Silic exposure increses pro-fibrotic gene expression. Anlysis of gene expression in the lung of silic treted mice (pnels -f). Whole lung mrna levels for collgen type I, lph 1 (Col11), fibronectin 1 (Fn1), tissue inhibitor of metlloproteinses 1 (Timp1), mtrix metlloproteinse 2 (Mmp-2), connective tissue growth fctor (Ctgf) nd tumor necrosis fctor lph (TNF-α) were determined using rel-time PCR nd normlized to bet-cting expression (β-actin). g, Chnges in gene expression in the lung of bleomycin treted mice t 21 dys. The results re shown s men ± SEM, p <.5 when compred to control lung, One Wy ANOVA with Holm-Sidk post test in the mouse lung, but there re some differences when compred to the bleomycin model. Silic promotes pthologicl signs of pulmonry vsculr remodeling nd medil thickening In order to identify vsculr bnormlities in silictreted mice, lung sections were stined with ntibodies specific for α-smooth muscle ctin (for smooth muscle cells) nd von Willebrnd Fctor (for endothelil cells). While the vsculture from control mice showed norml pulmonry rtery rchitecture (Fig. 5 imges -c), vsculr remodeling ws pprent in the lungs of mice exposed to crystlline silic (Fig. 5 imges d-i). Interestingly, complex stlk-like lesion ws detected within blood vessel lumen (Fig. 5 imge h). It ws formed just distl to dichotomous brnching point. The body of the lesion ppered to be disorgnized hyperchromtic ccumultion of cells tht were covered by von Willebrnd fctor positive endothelil cells. The stlk-like structure ppered to rise from the rteril wll nd extend downstrem into the lumen of the vessel (Fig. 5 imge f). Moreover, quntittive nlysis of medil wll thickness indicted significnt increse in thickness of smooth muscle lyer from 4.85 ±.42 μm in control lung to 9.14 ±.93 μm (p <.5) in silic treted lung nd to 1.21 ± 1.4 μm (p <.5) in bleomycin treted lung (Fig. 5b). Musculriztion of pulmonry rteries in response to silic Tretment of mice with both silic nd bleomycin resulted in decrese in the number of non-musculrized pulmonry vessels (Fig. 6). These chnges were ssocited with significnt increses in prtilly musculrized nd fully musculrized vessels. Tretment with.4 g/kg silic incresed the percent of prtilly musculrized vessels from ± 2.3 to ± 1.92 (p <.5). At the sme time, the percentge of fully musculrized vessels incresed from ± 1.18 in control mice to ± 1.69 (not significnt) in silic-treted mice nd to 22.3 ± 2.36 (p <.5) in bleomycin treted mice (Fig. 6c). Thus, our dt indicte tht crystlline silic nd bleomycin produced comprble chnges in pulmonry vessel musculriztion. Modultion of vsculr-specific gene expression in silictreted mice Exposure of murine lung to crystlline silic for 4 weeks ttenuted the expression of severl endothelium- or smooth muscle-specific genes (Fig. 7). Expression of the endothelium-specific gene CD31 ws downregulted both in silic- nd bleomycin-treted mice (Fig. 7). A similr pttern of ttenuted expression ws observed for pltelet fctor 4 (Fig. 7b). On the other hnd, expression of endothelin 1 remined only slightly ttenuted without reching sttisticlly significnt levels in both tretment groups (Fig. 7d), while expression of nestin ws ttenuted only in silic-treted mice (Fig. 7c). These dt indicte tht crystlline silic ttenuted the expression of genes involved in regultion of crdiopulmonry homeostsis quite similr to bleomycin. Incresed influx of inflmmtory cells into lung of mice treted with silic Mice treted with silic t concentrtion of.4 g/kg showed significntly higher number of inflmmtory cells stined with ntibodies specific for LY-6B nd CD17b in the lung (Fig. 8). Neutrophils nd mcrophges were observed mostly in the res of grnulom loction. They were lso deposited round vessels djcent to the lesions (Fig. 8, imges b nd e). Surprisingly, we did no observed significnt increse in ctivted peripherl neutrophils in the lung exposed to bleomycin for 21 dy (Fig. 8, imge c). In contrst, the number of cells stined with mcrophge specific ntigen CD17b ws incresed in bleomycin treted group (Fig. 8, imge e). Quntittive nlysis indictes tht the CD17b stined re incresed from 2.11 ±.28% in control lung to ± 5.38% (p <.5) in silic treted lung nd to 17.1 ± 3.23% (p <.5) in bleomycin treted lung (Fig. 8b). Similrly, the re stined with the neutrophil specific mrker LY-6B ws incresed from 1.6 ±.17% in control lung to 6.6 ± 1.46% (p <.5) in silic-treted lung, while no significnt chnges were observed in bleomycin-treted lungs (Fig. 8b). These dt indicte tht crystlline silic produced robust inflmmtory response tht persists even 28 dys following initil dministrtion. Attenuted inflmmtory stining in bleomycin treted lungs indicted tht lung tissues most likely undergo fibrotic remodeling with subsided inflmmtory phse. Discussion Despite efforts to prevent occuptionl exposure to crystlline silic dust, silicosis continues to occur in mny developing ntions in Asi nd South Americ, nd still remins

9 Zelko et l. Respirtory Reserch (216) 17:16 Pge 9 of 14 b c d e f g h i b Fig. 5 Abnorml endothelil nd smooth muscle remodeling in the pulmonry vsculture of silic-treted mice., Lung sections (5 μm thick) were stined with ntibodies specific for endothelium-specific von Willebrnd Fctor vwf (red) nd α-smooth muscle ctin (green). Nuclei were stined using DAPI (blue). Imges were tken using 4 objective. Pnel -c: representtive imges of pulmonry rteries from control mice. Pnel d-i: imges of pulmonry rteries with different vsculr bnormlities: incresed ccumultion of inflmmtory cells round vessel (e), intiml oblitertion nd/or luminl occlusion by vwf-positive cells (f nd h), neointiml prolifertion (g nd i). Br = 1 μm. b, Quntittive nlysis of medil wll thickness in pulmonry rteries. p <.5 when compred to control lung, One Wy ANOVA with Holm-Sidk post test significnt hzrd in dvnced countries of North Americ nd Europe [18]. Although this disese cn be prevented by introducing sfer working conditions, eqully importnt is the development of erly dignostic tools nd sfe nd effective therpies for those dignosed with this devstting disese. Animl models remin n importnt tool in studying the genesis nd the progression pulmonry vsculr diseses ssocited with chronic lung disorders. However, despite strong epidemiologic links between exposure to silic nd development of pulmonry hypertension in humns [19], there hve been no mouse models described to our knowledge tht confirm this ssocition nd cn be used to elucidte the underlying mechnism(s) responsible. Severl previous studies nlyzed the effects of sbestos on pulmonry hemodynmic nd vsculr bnormlities in guine pigs nd rts [2, 21]. The current work suggests tht 4 weeks of exposure to crystlline silic is ssocited with increses in RVSP, vsculr remodeling nd dysregultion of genes involved in mintennce of vsculr homeostsis. To compre the effects of silic with other injurious gents, we used mice exposed to bleomycin s model of severe pulmonry hypertension secondry to lung chronic diseses. While mny similrities were observed between the two models, we identified severl distinctive fetures tht were only seen in silic-exposed mouse lungs. First, the increse in RVSP observed in the silic model ws mrkedly less profound compred to bleomycin model. This difference cn be ttributed to dosing nd exposure differences. How inhled silic produces

10 Zelko et l. Respirtory Reserch (216) 17:16 Pge 1 of 14 % Non-Musculrized Vessels Control Silic Bleomycin b c % Fully Musculrized Vessels % Prtilly Musculrized Vessels Control Silic Bleomycin Control Silic Bleomycin Fig. 6 Musculriztion of pulmonry rteries in silic- nd bleomycin-treted mice. Lung sections were stined with vwf (red) nd lph-smooth muscle ctin (green) specific ntibodies. Nuclei were stined using DAPI (blue). Representtive imges of non-musculrized (), prtilly musculrized (b) nd fully-musculrized (c) rteries showed on left side. Quntittive nlysis of pulmonry rteries remodeling presented on right side. Significnt increse in prtilly-musculrized nd fully musculrized rteries ws detected in silic (.4 g/kg) nd bleomycin-treted lungs its effects on the pulmonry vsculture nd hemodynmic is not well understood. It is possible tht silic-prticles trpped within the lung prenchym re quickly surrounded by ggregtes of thrombocytes nd mononucler leukocytes, rising the likelihood tht regionl vsoconstriction triggered in response to foclly relesed thromboxne or serotonin could substntilly mplify the overll increse in pulmonry vsculr resistnce [22, 23]. On the other hnd, it is possible tht reduced crdic output cn significntly obscure pulmonry vsculr resistnce. Unfortuntely, we do not hve dequte stte-of-the-rt equipment to test these possibilities. During the lst decde, the proinflmmtory cytokines TNF-α nd IL-1β hve emerged s biomrkers nd meditors of oxidtive stress nd endothelil dysfunction in severl crdiovsculr diseses [24]. In the present study, we observed tht pulmonry rteries from silic-exposed nimls showed enhnced TNF-α gene expression despite there being no chnges in IL1-β (dt not shown). In ddition, incresed levels of TNF-α cn be responsible for the

11 Zelko et l. Respirtory Reserch (216) 17:16 Pge 11 of 14 c b d Fig. 7 Expression of vsculr-specific genes. Anlysis of gene expression in the lung of silic- nd bleomycin-treted mice (pnels -d). Expression of genes ws nlyzed 28 dys following silic instilltion nd 21 dys following bleomycin instilltion. Whole lung mrna levels for PECAM-1 (CD31), pltelet fctor 4 (PF4), nestin nd endothelin 1 were determined using rel-time PCR nd normlized to bet-cting expression (β-actin). The results re shown s men ± SEM, p <.5 when compred to control lung, One Wy ANOVA with Holm-Sidk post test recruitment of more inflmmtory cells such s neutrophils nd mcrophges to the site of injury in silic-treted lungs. Our dt indicte tht elevted TNF-α gene expression correltes with infiltrtion of mcrophges nd neutrophils into silic-induced fibrotic lesions. On the other hnd, levels of TNF-α nd number of neutrophils did not increse significntly in bleomycin-induced fibrotic lesions. Thus, inhled silic prticles could directly induce endothelil dysfunction by stimulting TNF-α expression nd/or by incresing inflmmtory cell recruitment in response to elevted secretion of pro-inflmmtory cytokines. We lso observed incresed expression of MMP-2 nd TIMP-1 in lung tissue of silic-exposed mice. MMPs re involved in remodeling of the lveolr rchitecture ner grnulomtous lesions but, t the sme time, cn influence the composition nd remodeling of vsculr wll. In response to ngiogenic stimulus, endothelil-derived MMPs medite proteolytic degrdtion of endothelil cell-cell interctions, which promotes prolifertive nd migrtory phenotype in endothelil cells [25]. In ddition, incresed MMP-2 nd TIMP-1 expression were identified in pulmonry rtery smooth muscle cells isolted from idiopthic PAH ptients [26]. Importntly, incresed geltinolytic ctivity ws minly observed in the medil lyer, nd correlted with incresed MMP-2 expression in the pulmonry rteries of monocrotlinetreted nimls [27]. This geltinolytic ctivity cn be ttributed to MMP-2 since expression of MMP-9 gene in the pulmonry hypertension model ws not observed. The correltion between MMP-2 expression nd progression of pulmonry hypertension in the described niml model indicted importnt roles of this proteinse in different vsculr remodeling processes tht involves smooth muscle cell prolifertion, migrtion nd intiml thickening. The other source of incresed MMP-2 nd TIMP-1 mrna levels might be dventitil fibroblsts. Progressing grnulomtosis cn promote hypoxemi in the lung tissues of silic-treted mice. It hs been shown tht hypoxi significntly incresed MMP-2, TIMP-1, TIMP-2 nd α-smooth muscle ctin gene

12 Zelko et l. Respirtory Reserch (216) 17:16 Pge 12 of 14 Control Silic Bleomycin b c CD-17b LY-6B d e f b % Are stined with LY-6B % Are stined with CD-17b Control Silic Bleomycin Control Silic Bleomycin Fig. 8 Influx of inflmmtory cells in the lung of mice treted with silic nd bleomycin., Lung sections (5 μm thick) were stined with ntibodies specific for neutrophil-specific mrker LY-6B (red), mcrophge-specific mrker CD17b (red) nd α-smooth muscle ctin (green). Nuclei were stined using DAPI (blue). Imges were tken using 2 objective. Representtive imges of mouse lung from control (imges nd d),.4 g/kg silic treted (imges b nd e) or bleomycin treted (imges c nd f) mice. Incresed ccumultion of inflmmtory cells round vessel (imges b nd e) found in silic treted lungs. Br = 2 μm. b, Quntittive nlysis of re stined with corresponding specific ntibodies. p <.5 when compred to control lung, One Wy ANOVA with Holm-Sidk post test expression in dventitil fibroblsts nd promoted neointiml hyperplsi [28]. The increse of collgen type I (Col11) mrna levels coinciding with musculriztion nd thickening of pulmonry vsculr wll indictes collgen ccumultion in the vsculture. The phenotype switch of pulmonry smooth muscle cell to hypertrophic cells cn be regulted by chnges in homeostsis of extrcellulr mtrix components like vsculr collgen, elstin nd fibronectin. Incresed expression nd deposition of collgen re known to be importnt determinnts of medil thickening during the progression of PAH [29]. Collgen ccumultion increses pulmonry rteril stiffening, which trnsltes into pulmonry hypertension progression nd eventully, RV dysfunction [3]. We observed significnt downregultion in expression of endothelium specific genes such s Pecm 1, lso known s CD31, pltelet fctor 4 (PF4), nd nestin. Pecm-1 is expressed on the cell surfce of endothelil cells s well s hemtopoietic nd immune cells including pltelets, neutrophils nd monocytes. TNF-α nd IFN-gmm cn reduce the expression of Pecm-1 nd trnsmigrtion of leukocyte in endothelil cells [31]. Mice deficient in Pecm-1 become hyperresponsive to stimultion with collgen nd

13 Zelko et l. Respirtory Reserch (216) 17:16 Pge 13 of 14 demonstrte enhnced ggregtion nd formtion of lrger thrombi in vitro under physiologic flow conditions [32, 33]. Nestin downregultion in vsculr smooth muscle cells represented n erly event in vsculr disese in experimentl type I dibetes [34]. On the other hnd, vsculr cells expressing nestin were implicted in the development of pulmonry hypertension [35]. Pltelet fctor 4 (PF4) expression ws downregulted in humn lung tissue derived from ptients dignosed with pulmonry hypertension secondry to pulmonry fibrosis, but up-regulted in PAH ptients [36]. A mjor physiologicl role of PF4 is to neutrlize heprin-like molecules on the endothelil surfce of blood vessels, thereby promoting cogultion nd inhibiting ngiogenesis. One physiologicl role of PF4 in endothelil cells is to inhibit endothelil cell growth through multiple signling mechnisms [37]. Thus, downregultion of PF4 gene expression in our silic-induced model of pulmonry hypertension might promote ngiogenesis nd vsculr remodeling in ffected lungs. Conclusions We demonstrted tht exposure of mice to single intrtrchel instilltion of crystlline silic cuses pulmonry vsculr remodeling nd pulmonry hypertension in mice, lthough these chnges were less severe thn those observed in bleomycin-treted mice. To our knowledge, this is the first study to estblish tht silic exposure cuses vsculr bnormlities nd mild elevted RVSP in mice. Additionlly, we observed significnt chnges in the expression of genes responsible for inflmmtory nd fibrotic responses in pulmonry cells s well s genes involved in regultion of vsculr function. Together, these observtions begin to unveil mechnistic link between silicosis nd pulmonry hypertension. Furthermore, they suggest tht the silic-induced murine model of pulmonry hypertension could become vluble tool to explore the pthogenesis of this disese in humns. Abbrevitions COPD: Chronic obstructive pulmonry disese; CTGF: Connective tissue growth fctor; IL-6: Interleukin 6; LY-6B: Lymphocyte ntigen 6 complex, locus B; MCP-1: Monocyte chemottrctnt protein 1; MMP-2: Mtric metllopeptidse 2; PAH: Pulmonry rteril hypertension; PECAM- 1: Pltelet nd endothelil cell dhesion molecule 1; PF4: Pltelet fctor 4; RV: Right ventricle; RVSP: Right ventriculr systolic pressure; TIMP-1: Tissue inhibitor of metlloproteinse 1; TNF-α: Tumor necrosis fctor lph Acknowledgments We thnk US Silic Inc. (Frederick, MD) for providing the smple of crystlline silic used in this study. Funding This work ws supported by NIH grnts R56HL (Zelko), R1 AA19953 (Romn) nd Reserch Incentive Grnt from UofL School of Medicine (Zelko). Avilbility of dt nd mterils The dt obtined nd/or nlyzed during the current study re vilble from the corresponding uthor on resonble request. Authors contributions Conception nd design: INZ; Anlysis nd interprettion: INZ, JR, JZ, JDR; Drfting the mnuscript for importnt intellectul content: INZ, JR. All uthors red nd pproved the finl mnuscript. Competing interests Igor Zelko reserch is funded by Ntionl Institutes of Helth. Jesse Romn serves or hs served s investigtor on industry-sponsored clinicl trils relted to pulmonry fibrosis (Giled, Fibrogen, Intermune, Promedi, Novrtis, Boehringer Ingelheim, nd Bristol-Meyers-Squibb). He lso serves on the bords of the Americn Lung Assocition - Midlnd Sttes, the Pulmonry Fibrosis Foundtion, nd the Americn Thorcic Society. His reserch is funded by the Ntionl Institutes of Helth nd the Deprtment of Veterns Affirs. Jeffrey Ritzenthler nd Jin Zhu hve no competing interests to disclose. Consent for publiction Not pplicble. Ethics pprovl All niml experiments were pproved by the Institutionl Animl Cre nd Use Committee of the University of Louisville, nd the cre nd hndling of the nimls were in ccordnce with Ntionl Institutes of Helth guidelines. Author detils 1 Deprtment of Medicine, Division of Pulmonry, Criticl Cre, nd Sleep Medicine, University of Louisville, Louisville, KY 422, USA. 2 Deprtment of Biochemisry nd Moleculr Genetics, University of Louisville, Louisville, KY 422, USA. 3 Robley Rex VA Medicl Center, Louisville, KY 422, USA. Received: 8 September 216 Accepted: 22 November 216 References 1. Hnizdo E, Vllythn V. Chronic obstructive pulmonry disese due to occuptionl exposure to silic dust: review of epidemiologicl nd pthologicl evidence. Occup Environ Med. 23;6: Liu Y, Steenlnd K, Rong Y, Hnizdo E, Hung X, Zhng H, Shi T, Sun Y, Wu T, Chen W. Exposure-response nlysis nd risk ssessment for lung cncer in reltionship to silic exposure: 44-yer cohort study of 34,18 workers. Am J Epidemiol. 213;178: Cullinn P. Occuption nd chronic obstructive pulmonry disese (COPD). Br Med Bull. 212;14: Hughes JM, Weill H, Checkowy H, Jones RN, Henry MM, Heyer NJ, Seixs NS, Demers PA. Rdiogrphic evidence of silicosis risk in the ditomceous erth industry. Am J Respir Crit Cre Med. 1998;158: Cstrnov V, Porter D, Millecchi L, M JY, Hubbs AF, Tess A. Effect of inhled crystlline silic in rt model: time course of pulmonry rections. Mol Cell Biochem. 22; : Huux F. New developments in the understnding of immunology in silicosis. Curr Opin Allergy Clin Immunol. 27;7: Dostert C, Petrilli V, Vn Bruggen R, Steele C, Mossmn BT, Tschopp J. Innte immune ctivtion through Nlp3 inflmmsome sensing of sbestos nd silic. Science. 28;32: Mossmn BT, Churg A. Mechnisms in the pthogenesis of sbestosis nd silicosis. Am J Respir Crit Cre Med. 1998;157: Nemmr A, Vnbilloen H, Hoylerts MF, Hoet PH, Verbruggen A, Nemery B. Pssge of intrtrchelly instilled ultrfine prticles from the lung into the systemic circultion in hmster. Am J Respir Crit Cre Med. 21;164: Seton A, McNee W, Donldson K, Godden D. Prticulte ir pollution nd cute helth effects. Lncet. 1995;345: Lnden DD, Wssell JT, McWillims L, Ptel A. Col dust exposure nd mortlity from ischemic hert disese mong cohort of U.S. col miners. Am J Ind Med. 211;54: Hyduk A, Croft JB, Ayl C, Zheng K, Zheng ZJ, Mensh GA. Pulmonry hypertension surveillnce United Sttes, MMWR Surveill Summ. 25;54: Jndov R, Widimsky J, Eisler L, Nvrtil M. Long-term prognosis of pulmonry hypertension in silicosis. Cor Vs. 198;22: Crlsen J, Hsseriis Andersen K, Boesgrd S, Iversen M, Steinbruchel D, Bogelund Andersen C. Pulmonry rteril lesions in explnted lungs

14 Zelko et l. Respirtory Reserch (216) 17:16 Pge 14 of 14 fter trnsplnttion correlte with severity of pulmonry hypertension in chronic obstructive pulmonry disese. J Hert Lung Trnsplnt. 213;32: Lettieri CJ, Nthn SD, Brnett SD, Ahmd S, Shorr AF. Prevlence nd outcomes of pulmonry rteril hypertension in dvnced idiopthic pulmonry fibrosis. Chest. 26;129: Dvis GS, Leslie KO, Hemenwy DR. Silicosis in mice: effects of dose, time, nd genetic strin. J Environ Pthol Toxicol Oncol. 1998;17: Honnons S, Porcher JM. In vivo experimentl model for silicosis. J Environ Pthol Toxicol Oncol. 2;19: Chen W, Zhung Z, Attfield MD, Chen BT, Go P, Hrrison JC, Fu C, Chen JQ, Wllce WE. Exposure to silic nd silicosis mong tin miners in Chin: exposure-response nlyses nd risk ssessment. Occup Environ Med. 21;58: HuSN,VllythnV,GreenFH,WeberKC,LqueurW.Pulmonry rteriolr musculriztion in col workers pneumoconiosis nd its correltion with right ventriculr hypertrophy. Arch Pthol Lb Med. 199;114: Wright J, Wiggs B, Churg A. Pulmonry hypertension induced by mosite sbestos: physiologicl nd morphologic study in the guine pig. Lung. 1991;169: McGvrn PD, Moore LB, Brody AR. Inhltion of chrysotile sbestos induces rpid cellulr prolifertion in smll pulmonry vessels of mice nd rts. Am J Pthol. 199;136: Schmeck J, Jnzen R, Munter K, Neuhof H, Koch T, Jnzen R. Endothelin-1 nd thromboxne A2 increse pulmonry vsculr resistnce in grnulocyte-medited lung injury. Crit Cre Med. 1998;26: McMhon TJ, Hood JS, Nossmn BD, Ibrhim IN, Feng CJ, Kdowitz PJ. Influence of SQ 3741 on thromboxne receptor-medited responses in the feline pulmonry vsculr bed. J Appl Physiol. 1985;71: Hjjr DP, Gotto Jr AM. Biologicl relevnce of inflmmtion nd oxidtive stress in the pthogenesis of rteril diseses. Am J Pthol. 213;182: vn Hinsbergh VW, Koolwijk P. Endothelil sprouting nd ngiogenesis: mtrix metlloproteinses in the led. Crdiovsc Res. 28;78: Lepetit H, Eddhibi S, Fdel E, Frisdl E, Munut C, Noel A, Humbert M, Adnot S, D'Ortho MP, Lfum C. Smooth muscle cell mtrix metlloproteinses in idiopthic pulmonry rteril hypertension. Eur Respir J. 25;25: FrisdlE,GestV,Vieillrd-BronA,LevmeM,LepetitH,EddhibiS, Lfum C, Hrf A, Adnot S, Dortho MP. Geltinse expression in pulmonry rteries during experimentl pulmonry hypertension. Eur Respir J. 21;18: Misr S, Fu AA, Misr KD, Shergill UM, Leof EB, Mukhopdhyy D. Hypoxiinduced phenotypic switch of fibroblsts to myofibroblsts through mtrix metlloproteinse 2/tissue inhibitor of metlloproteinse-medited pthwy: implictions for venous neointiml hyperplsi in hemodilysis ccess. J Vsc Interv Rdiol. 21;21: Rbinovitch M. Pthobiology of pulmonry hypertension. Extrcellulr mtrix. Clin Chest Med. 21;22: viii. 3. Vieillrd-Bron A, Frisdl E, Eddhibi S, Deprez I, Bker AH, Newby AC, Berger P, Levme M, Rffestin B, Adnot S, d'ortho MP. Inhibition of mtrix metlloproteinses by lung TIMP-1 gene trnsfer or doxycycline ggrvtes pulmonry hypertension in rts. Circ Res. 2;87: Rivl Y, Del Mschio A, Rbiet MJ, Dejn E, Duperry A. Inhibition of pltelet endothelil cell dhesion molecule-1 synthesis nd leukocyte trnsmigrtion in endothelil cells by the combined ction of TNF-lph nd IFN-gmm. J Immunol. 1996;157: Jones KL, Hughn SC, Dopheide SM, Frndle RW, Jckson SP, Jckson DE. Pltelet endothelil cell dhesion molecule-1 is negtive regultor of pltelet-collgen interctions. Blood. 21;98: Ptil S, Newmn DK, Newmn PJ. Pltelet endothelil cell dhesion molecule-1 serves s n inhibitory receptor tht modultes pltelet responses to collgen. Blood. 21;97: Trdif K, Hertig V, Dumis C, Villeneuve L, Perrult L, Tnguy JF, Clderone A. Nestin downregultion in rt vsculr smooth muscle cells represents n erly mrker of vsculr disese in experimentl type I dibetes. Crdiovsc Dibetol. 214;13: Sboor F, Reckmnn AN, Tomczyk CU, Peters DM, Weissmnn N, Kschtnow A, Schermuly RT, Michurin TV, Enikolopov G, Muller D, Mietens A, Middendorff R. Nestin-expressing vsculr wll cells drive development of pulmonry hypertension. Eur Respir J. 216;47: Rjkumr R, Konishi K, Richrds TJ, Ishizwr DC, Wiechert AC, Kminski N, Ahmd F. Genomewide RNA expression profiling in lung identifies distinct signtures in idiopthic pulmonry rteril hypertension nd secondry pulmonry hypertension. Am J Physiol Hert Circ Physiol. 21;298: H Bikflvi A. Pltelet fctor 4: n inhibitor of ngiogenesis. Semin Thromb Hemost. 24;3: Submit your next mnuscript to BioMed Centrl nd we will help you t every step: We ccept pre-submission inquiries Our selector tool helps you to find the most relevnt journl We provide round the clock customer support Convenient online submission Thorough peer review Inclusion in PubMed nd ll mjor indexing services Mximum visibility for your reserch Submit your mnuscript t