High glucose induces and activates Toll like receptor 4 in endothelial cells of diabetic retinopathy
|
|
- Solomon Francis
- 5 years ago
- Views:
Transcription
1 Wng et l. Dibetol Metb Syndr (21) 7:89 DOI /s RESEARCH Open Access High glucose induces nd ctivtes Toll like receptor 4 in endothelil cells of dibetic retinopthy Lu Wng 1,2, Jing Wng 1, Jizhu Fng 1, Hongyn Zhou 1, Xilin Liu 1 nd Sho Bo Su 1 Abstrct Bckground: Hyperglycemi-induced inflmmtion cuses the dysfunction of blood vessels, nd Toll-like receptor 4 (TLR4) plys key role in inflmmtion-induced ngiogenesis. However, the impct of TLR4 on the pthogenesis of dibetic retinopthy (DR) is poorly understood. In this study, we exmined the expression of TLR4 in retinl vsculr endothelil cells of ptients with DR nd dibetic mice, nd explored the role of TLR4 in mediting inflmmtory responses by humn microvsculr endothelil cells (HMEC-1) under high-glucose condition. Methods: The expression of TLR4 in retinl vsculr endothelil cells of ptients with prolifertive dibetic retinopthy nd dibetic mice induced by streptozotocin ws exmined using immunofluorescence. HMEC-1 cells were cultured nd the expression of TLR4, MyD88 nd Interleukin-1β (IL-1β) ws exmined under high-glucose condition. Endothelil cells with TLR4 silencing nd ntgonist of TLR4 s well s endothelil cells from TLR4 deficient mice were used to study the effect of ctivted TLR4 on inflmmtion induced by high-glucose tretment. Results: We observed tht TLR4 ws detected in CD31-lbled humn retinl vsculr endotheli nd its expression ws mrkedly incresed in fibrovsculr membrnes from DR ptients nd in retinl vsculr endothelil cells of dibetic mice. The expression of TLR4, MyD88 nd IL-1β ws enhnced by high glucose in cultured HMEC-1 nd the expression of TLR4 nd IL-1β ws inhibited by TLR4 sirna knock-down nd TLR4 ntgonist. The expression of IL-1β by endothelil cells from TLR4 deficient mice under high glucose condition ws decresed. Conclusions: Our results reveled tht hyperglycemi induced overexpression nd ctivtion of TLR4 in endothelil cells. This effect my led to inflmmtory responses contribute to the pthogenesis of dibetic retinopthy. Keywords: Toll-like receptor 4, Dibetic retinopthy, Endothelium, Inflmmtion, Angiogenesis Bckground Dibetic retinopthy (DR) is common microvsculr compliction of dibetes. It remins the mjor cuse of blindness in developed countries. Multifctors hve been shown to contribute to the initition nd progression of the disese in which inflmmtion is pivotl. Inflmmtion confers n incresed risk for microvsculr nd mcrovsculr complictions of dibetes. The proinflmmtory phenotype in DR is chrcterized by elevted Correspondence: sushobo7836@gmil.com 1 Stte Key Lbortory of Ophthlmology, Zhongshn Ophthlmic Center, Sun Yt-sen University, Gungzhou 16, Chin Full list of uthor informtion is vilble t the end of the rticle retinl cytokines, chemokines nd dhesion molecules [1, 2]. Endothelil cells re key prticipnts in retinl ischemic vsculopthies nd their dysfunction is the initil event of microvsculr disorder in DR [3]. Chronic inflmmtory responses in retinl endotheli cuse the production of inflmmtory meditors, leding to incresed vsculr permebility, poptosis of endothelil cells nd neovsculriztion [3]. Hyperglycemi, one of the mjor risk fctors for DR, could trigger inflmmtion nd leds to vsculr complictions. Upon exposure to high glucose, endothelil cells show series of inflmmtory responses, such s reduced NO production [4], but enhnced NF-κB ctivtion [], inflmmtory gene expression [6] 21 Wng et l. This rticle is distributed under the terms of the Cretive Commons Attribution 4. Interntionl License ( which permits unrestricted use, distribution, nd reproduction in ny medium, provided you give pproprite credit to the originl uthor(s) nd the source, provide link to the Cretive Commons license, nd indicte if chnges were mde. The Cretive Commons Public Domin Dediction wiver ( publicdomin/zero/1./) pplies to the dt mde vilble in this rticle, unless otherwise stted.
2 Wng et l. Dibetol Metb Syndr (21) 7:89 Pge 2 of 1 nd leukocyte recruitment [7] by upregulted production of chemottrctnts [8]. However, how hyperglycemi induces inflmmtion to contribute to DR remins unknown. Toll-like receptors (TLRs) re pttern recognition receptors nd recognize conserved pthogen-ssocited moleculr ptterns (PAMPs) nd non-microbe molecules including endogenous lignds relesed during tissue dmge nd inflmmtion [9]. TLR ctivtion triggers signling cscde leding to cytokine production nd initition of n dptive immune response. TLR expression is incresed in plethor of inflmmtory disorders, including dibetes [1]. Among TLRs, TLR4 recognizes lipopolyscchride (LPS) from Grm-negtive bcteri nd endogenous lignds such s high-mobility group box 1 (HMGB1) nd is expressed in multiple cells, such s endothelil cells nd monocytes [11]. In retin, it hs been reported tht TLR4 ws expressed in the diverse retinl cells, including retinl pigment epithelium, photoreceptors, strocytes, microgli nd retinl vsculr endothelil cells [12]. TLR4 ctivtes both the myeloid differentition fctor 88 (MyD88)-dependent pthwy, which induces inflmmtory cytokines, nd TRIF-dependent pthwy responsible for the induction of type I interferon. Severl studies hve shown tht the expression of TLR4 is incresed in therosclerotic plques of niml models of therosclerosis. The lesion size, lipid content, nd mcrophge infiltrtion in therosclerotic plque were reduced in TLR4 knockout mice [13]. TLR4-medited pthwy lso promotes dysfunction of mesngil cells tht resulted in occluding of glomerulr cpillries in Dibetic nephropthy [14]. Recent results suggest n ssocition between Asp299Gly polymorphism in TLR4 gene nd erly onset of DR in DM2 ptients. Toll-like receptor 4 polymorphisms ws ssocited with higher prevlence of retinopthy [1, 16]. Hyperglycemi nd free ftty cids (FFAs) synergisticlly promoted oxidtive stress to ggrvted the dysfunction of endotheli nd insulin resistnce, which re medited by ctivted TLR4 [17, 18]. Additionlly, the expression of downstrem fctors of TLR4 including MyD88 nd NF-κB, ws significntly incresed in cells exposed to high glucose [17, 19]. This my led to the secretion of inflmmtory cytokines including IL-1β [2]. Studies showed tht the level of IL-1β ws significntly elevted in vitreous fluid of ptients with prolifertive dibetic retinopthy nd in the retin fluid of DR rts [21]. Enhnced expression of TLR4 hs been shown in monocytes of dibetic ptients with microvsculr complictions [22]. Furthermore, the studies showed the involvement of TLR4 in other humn dibetic complictions like nephropthy, wound heling impirment. Lin et l. reported tht Toll-like receptor 4 promoted tubulr inflmmtion in dibetic nephropthy [23]. Down-regultion of TLR4 ws shown in the impirment of wound heling in T2DM ptients [24, 2]. TLR4 plyed n importnt role in the initition nd progression of crdiovsculr pthologies [26]. Our previous study showed tht TLR4 plys criticl role in inflmmtion-induced ngiogenesis by promoting endothelil cell sprouting, prolifertion nd chemotxis in mouse model of lkli-induced cornel neovsculriztion [27]. We lso found tht TLR4 deficiency could protect mice from ngiogenesis in oxygen-induced retinopthy model [28, 29]. Accumulting evidence implicted tht TLR4-medited inflmmtion ws involved in dibetic vsculr compliction. However, the role of TLR4 in mediting the pthogenesis of DR by endothelil cells remins to be elucidted. In this study, we exmined the role of TLR4- dependent pthwy in high glucose-induced inflmmtory responses in retinl vsculr endothelil cells. We demonstrte tht high glucose chllenge enhnces the expression of TLR4 nd the secretion of inflmmtory fctors by humn endothelil cells. These results suggest n importnt role of hyperglycemi-induced expression nd ctivtion of TLR4 in dibetic retinopthy. Methods Ptients nd tissue smples Five ptients dignosed s PDR were recruited from Zhongshn Ophthlmic Centre, Sun Yt-sen University, Gungzhou, Chin. Five norml humn eye blls were from the Eye Bnk of Zhongshn Ophthlmic Centre (Tble 1). PDR ptients underwent series of ophthlmic exmintion, including the history of previous oculr tretments, slit-lmp biomicroscopy, gonioscopy ophthlmoscopy, fluorescein ngiogrphy, nd fundus color photogrphy. The severity of dibetic retinopthy ws ssessed bsed on the stndrdized fundus color photogrphs nd on the fluorescein ngiogrms. The medicl exmintion included fsting plsm concentrtions of blood glucose nd glycosylted hemoglobin. All ptients received vitrectomy becuse of vitreous hemorrhge. Fibrovsculr membrnes from PDR ptients were obtined during the surgery. The size re bout 2. mm 2. mm. mm. After immersed in PBS for 1 s three times, the tissues were embedded in OCT for section. This reserch ws crried out in ccordnce with the principles of the Declrtion of Helsinki s revised in 2. Institutionl Ethics Committee pprovl nd informed consent from ll ptients were obtined. Animl studies C7BL/6 mice were purchsed from Experimentl Animl Centre of Sun Yt-sen University of Medicl Science
3 Wng et l. Dibetol Metb Syndr (21) 7:89 Pge 3 of 1 Tble 1 Clinicl chrcteristics for individul prolifertive retinl membrnes nd humn retin Age (yers) Sex Dignosis Durtion of dibetes (yers) Ptient no M PDR epiretinl 1 membrne 2 48 F PDR epiretinl 16 membrne 3 69 M PDR epiretinl 8 membrne 4 63 M PDR epiretinl 2 membrne 68 F PDR epiretinl membrne no. 1 2 M Norml n/ 2 8 F Norml n/ 3 1 M Norml n/ 4 6 M Norml n/ 61 M Norml n/ n/ indictes tht there re no durtion dt for the control subjects (Gungzhou, Chin). Cre, use nd the tretment of ll nimls were in strict greement with the guidelines of the Assocition for Reserch in Vision nd Ophthlmology Sttement for the Use of Animls in Ophthlmic nd Visul Reserch nd pproved by the institutionl niml cre nd use committees in Zhongshn ophthlmic centre. To induce dibetes, 6-week-old C7BL/6 mice were given five consecutive intrperitonel injections of streptozotocin (STZ; 6 mg/kg body wt/dy) (Sigm-Aldrich) or vehicle s control. Six nd eight weeks fter injection, mice were humnely killed nd eyes were embedded in OCT for section. Immunofluorescence Dul-color immunofluorescence stining ws performed on frozen sections of the fibrovsculr membrnes nd mouse eye blls with mouse nti-humn or nti-mouse TLR4 monoclonl ntibody (1:1 dilution; Snt Cruz Biotechnology, Cliforni, USA; 1:1 dilution; Abcm, Cmbridge, MA, USA) nd with rbbit nti-humn/ mouse CD31 polyclonl IgG (1:1 dilution; Biosynthesis Biotechnology Co, Ltd, Beijing, Chin). The smples were then incubted with secondry got nti-rbbit IgG ntibody Alex Fluor nd got nti-mouse IgG ntibody Alex Fluor 488 (1: dilution, Cell Signling Technology, Boston, MA, USA) for 1 h t 37 C in the drk, followed by -min incubtion with Hoechst 3328 (1:1 dilution; Sigm-Aldrich, St. Louis, Missouri, USA). Humn retinl sections were exmined t 4 with fluorescence microscope (Axioskop; Crl Zeiss, Thornwood, NY, USA) nd mouse retinl sections were exmined t 4 by lser confocl microscope (LSCM 1 META; Oberkochen, Germny), mintining identicl settings. We further mesured TLR4-immunofluorescence reltive intensity in ech opticl slice long lines round inner lyer of blood vessels in humn retin smples nd trnsecting inner lyer of mouse retin by Imge-Pro Plus 6. (Medi Cybernetics, Silver Spring, Mrylnd, USA). Imge processing ws performed with Adobe Photoshop CS 3. (Adobe Systems, Sn Jose, CA, USA). Cell culture HMEC-1 humn microvsculr endothelil cell line ws obtined from Americn Type Culture Collection (Mnsss, VA, USA). HMEC-1 cells were cultured in humn endothelil-sfm (. mmol/l glucose, Invitrogen, Crlsbd, CA, USA). Mouse retinl endothelil cells (MRECs) of wild type mice nd TLR4 knockout mice were purchsed from PriCells (Wuhn, Chin) nd were cultured in endothelil cell complete medium (MED2 + SUP2, PriCells) ccording to the mnufcturer s instructions. Only cells between pssges 3 nd 8 were used in the study. The glucose ws purchsed from Sigm-Aldrich, St. Louis, MO, USA. The cells were treted with. mmol/l norml glucose or with 1 nd 2 mmol/l glucose for indicted times in sustined condition. The cells were lso pretreted with TLR4 ntgonist Rhodobcter spheroides LPS (LPS-RS) (Invivogen, Sn Diego, CA, USA) or TLR4 sirna (Snt Cruz Biotechnology, Cliforni, USA) ccording to the instruction of mnufcture followed by 12 h., 1, or 2 mmol/l glucose tretment. Cell superntnts, lystes nd RNA were collected for further experiments. RNA extrction nd rel time quntittive RT PCR HMEC-1 cells or MRECs were cultured in 3-mm tissue culture dishes. After tretment with glucose, totl RNA ws extrcted using Trizol regent (Invitrogen, Crlsbd, CA, USA) nd the cdna ws prepred by reverse trnscription ccording to the mnufcturer s protocol. Rel-time PCR ws performed on n Applied Biosystems StepOne Rel-Time PCR System using the comprtive threshold cycle (CT) quntifiction method. Ech rection contined 12. μl of 2 SYBR green Mster Mix, 3 nm oligonucleotide primers synthesized by Invitrogen Biotechnology Co. Ltd, (Shnghi, Chin), 1 μl of 1 in 1 dilution of the cdna nd wter, to totl of 2 μl. The therml cycling conditions included n initil denturtion t 9 C for 1 min, 4 cycles t 9 C for 3 s, 6 C for 1 min, nd 72 C for 1 min. The mrna expression in ech smple ws determined fter correction with the expression of humn GAPDH or mouse
4 Wng et l. Dibetol Metb Syndr (21) 7:89 Pge 4 of 1 GAPDH. Ech mesurement of smple ws conducted in triplicte. The following primers were used: humn GAPDH (7 bp): forwrd: CCACATCGCTCAGACAC- CAT; reverse: CCAGGCGCCCAATACG; humn TLR4 (138 bp): forwrd: ATGAAATGAGTTGCAGCAGA; reverse: AGCCATCGTTGTCTCCCTAA; humn IL-1β (133 bp): forwrd: TCCAGGGACAGGATATG- GAG; reverse: TCTTTCAACACGCAGGACAG; humn VEGF (12 bp): forwrd: TCCAGGAGTACC- CTGATGAG; reverse: ATTCACATTTGTGTGCTGT; humn bfgf (184 bp): forwrd: GAGGAGTTGT- GTCTATCAAAG; reverse: GTTCGTTTCAGT- GCCACATACC; mouse GAPDH (93 bp): forwrd: TGAGCAAGAGAGGCCCTATC, reverse: AGGCC- CCTCCTGTTATTATG; mouse IL-1β (1 bp): forwrd: TCCAGGATGAGGACATGAGCAC, reverse: GAACGTCACACACCAGCAGGTTA. All mrna vlues were normlized ginst the levels of humn or mouse GAPDH mrna. The normlized vlues of tretment groups re expressed s the fold increse over the untreted control cells in y xis. Western blotting HMEC-1 cells treted with glucose were collected nd lysed with lysis buffer contining RIPA nd phenylmethylsulfonyl fluoride (PMSF). Protein concentrtion ws determined by the Brdford Lowry method nd the smples were stored t 8 C until used for immunoblot nlysis. Protein smples (3 μg) were loded onto SDS-PAGE gels nd then were trnsferred to PVDF membrne (Immobilon-P; Millipore, Bedford, MA, USA). After being blocked with % nonft milk for 1 h, the membrne were incubted with the following primry ntibodies t 4 C overnight: polyclonl rbbit ntihumn TLR4 (1:; Boster Wuhn, Chin), polyclonl rbbit nti-humn MyD88 (1:1; Boster Wuhn, Chin) nd monoclonl mouse nti-β-ctin (1:1; Boster, Wuhn, Chin). Protein bnds were visulized by incubtion with nti-mouse secondry ntibody or nti-rbbit secondry ntibody (1:3; BOSTER, Wuhn, Chin) nd chemiluminescence substrtes (ECL Plus; TIAN- GEN, Beijing, Chin). Flow cytometry HMEC-1 cells were cultured in 24-well pltes for t lest 24 h, then were stimulted with 1 mmol/l glucose for nother 24 h. The cells were then blocked by % BSA PBS for 3 min, nd were incubted with FITC lbeled nti-tlr4 ntibody (ebioscience Inc., Sn Diego, CA, USA) for 1 h t 4 C. After the incubtion, cells were scrped nd suspended in μl buffer. The intensity of fluorescence ws mesured using FACSClibur nd CellQuest softwre (BD PhrMingen). Enzyme linked immunosorbent ssys (ELISA) HMEC1 cells with/without sirna silence or MRECs of wild type or TLR4 knockout mice were stimulted with glucose. Culture superntnt ws hrvested, centrifuged to remove cellulr debris, nd then stored t 8 C until use. The concentrtion of IL-1β in the superntnts ws mesured by humn IL-1β ELISA (Boster Corportion, Wuhn, Chin) or mouse IL-1β ELISA (R&D Systems, Minnepolis, MN, USA) ccording to mnufcturer s instructions. Reproducibility nd sttisticl nlysis All experiments were performed t lest three times. Results were highly reproducible. Representtive results were shown in figures. Results re expressed s the men ± SE. Dt were nlyzed by ANOVA with S N K post hoc nlyses. All sttisticl nlyses were performed using SPSS2. Softwre. P <. ws considered s sttisticlly significnt. Results The expression of TLR4 in premembrne of dibetic retinopthy ptients Our previous study showed tht TLR4 plyed criticl role in inflmmtion-induced ngiogenesis in mouse model. In this study, we t first exmined the expression of TLR4 in the premembrnes of ptients with dibetic retinopthy. The premembrnes of five dibetic retinopthy ptients nd retins of five norml humn eye blls were exmined with immunofluorescence stining. The expression of TLR4 ws detected in the retin from norml humn eyes (Fig. 1, 1 ) nd fibrovsculr membrnes removed from the eyes of ptients with PDR (Fig. 1, PDR 1 ). Positive stining of CD31, n endothelil mrker, ws present in both tissues. Colocliztion of TLR4 nd CD31 ws observed in vessel wlls. TLR4 expression ws significnt higher in PDR fibrovsculr membrnes thn in norml retinl vscultures (Fig. 1b). These dt suggest tht TLR4 expression is incresed in the fibrovsculture nd my ply role in the dysfunction of vsculr endothelil cells in DR. The expression of TLR4 in retinl endothelil cells in STZ induced dibetic mice STZ-induced dibetes in mice is commonly used model to study nonprolifertive DR. We exmined the expression of TLR4 in mice 6 nd 8 weeks fter STZ injection (Fig. 2, c). Colocliztion of TLR4 nd CD31 ws observed in vessel wlls. We found tht in the dibetic retin, TLR4 level ws significntly incresed t 6 nd 8 weeks fter STZ injection compred to control mice (Fig. 2b, d).
5 Wng et l. Dibetol Metb Syndr (21) 7:89 Pge of 1 NO: TLR4 CD31 Hoechst Merge NO: TLR4 CD31 PDR Hoechst Merge b TLR4 Intensity PDR Fig. 1 Expression of TLR4 in PDR fibrovsculr membrne. Immunofluorescence stining of TLR4 (green) nd CD31 (red) ws performed in norml humn retins, fibrovsculr membrnes from PDR ptients. Results show five fibrovsculr membrnes from ptients with PDR nd five norml humn eye bll controls (). TLR4 immunofluorescence reltive intensity in retinl sections ws quntified nd displyed (b). P <. compred to the control group. Scle br 2 μm High glucose culture induced the expression of TLR4 by HMEC 1 cells We then used HMEC-1 cells s model to exmine microvsculr endothelil cell response to incresed concentrtion of glucose. HMEC-1 cells were exposed to. (norml), 1 nd 2 mmol/l glucose for vrible time points. Incresed expression of TLR4 mrna ws observed fter glucose exposure nd the highest level of TLR4 expression ws induced by 2 mmol/l glucose (Fig. 3). The increse in TLR4 expression by HMEC-1 cells in response to glucose ws time dependent nd reched the mximum t 6 h fter tretment (Fig. 3b). Western blotting (Fig. 3c) showed mrkedly increse in TLR4 expression t 12 nd 24 h fter high glucose chllenge. Anlysis of flow cytometry showed similr effect when glucose ws used t 1 nd 2 mmol/l (Fig. 3d). Induction of MyD88 expression in HMEC 1 cells by high glucose Activtion of MyD88 is key step in the TLR4 pthwy tht culmintes in NF-κB ctivtion nd inflmmtory cytokine expression. We exmined the effect of high glucose on the expression of MyD88 by HMEC-1 cells using Western blotting. We observed tht high glucose incresed the expression of MyD88 by HMEC-1 cells t 1 nd 2 mmol/l for 12 h (Fig. 4). These findings indicte tht incresed TLR4 expression under high glucose
6 Wng et l. Dibetol Metb Syndr (21) 7:89 Pge 6 of 1 TLR4 CD31 Hoechst Merge b STZ TLR4 Intensity DR c d STZ TLR4 Intensity DR Fig. 2 Expression of TLR4 in retinl vessel of dibetic mice. Immunofluorescence stining of TLR4 (green) nd CD31 (red) ws performed in norml nd dibetic mouse retins., c Representtive results from three independent experiments with four dibetic nd control nimls in 6 week-group () or 8 week-group (c) fter STZ injection re shown. b, d TLR4 immunofluorescence reltive intensity in retinl sections of 6 week-group (b) or 8 week-group (d) of dibetic mice ws quntified. P <. compred to the control group. Scle br μm exposure induces the expression of MyD88, which my ctivte inflmmtory cscde. Incresed inflmmtory cytokine production by HMEC 1 cells in response to high glucose To investigte the inflmmtory response of TLR4, we determined the expression of inflmmtory cytokine IL-1β s well s VEGF nd bfgf by HMEC-1 cells under high glucose condition. The level of IL-1β mrna fter 1 nd 2 mmol/l glucose tretment ws significntly incresed compred with tretment with. mmol/l glucose (Fig. 4b) (p <.). Kinetic study showed tretment with 1 mmol/l glucose significntly incresed IL-1β mrna t 3, 6, 12 nd 24 h (Fig. 4c). We then mesured IL-1β protein in the culturl superntnt of glucose-treted HMEC-1 cells. IL-1β level ws significntly incresed t 6, 12, 24 h nd persisted under high glucose condition (1 mmol/l) (Fig. 4d). Similrly, stimultion of HMEC-1 cells by 1 mmol/l glucose enhnced the expression of VEGF nd bfgf (Additionl file 1: Figure S1). Therefore, high glucose elevtes the secretion of inflmmtory nd prongiogenic cytokines vi ctivtion of TLR4 pthwy. Inflmmtory response ctivted by high glucose vi TLR4 in HMEC 1 cells sirna ws used to confirm the role of TLR4 in high glucose-induced inflmmtory response. TLR4 expression in HMEC-1 cells ws significntly decresed fter sirna trnsfection (Fig. ). This resulted in significnt decrese in IL-1β level t 1 mmol/l glucose tretment (Fig. b). Scrmbled sirna hd no significnt effect on IL-1β expression by HMEC-1 cells (Fig. b). We lso tested the effects of TLR4 ntgonist, Rhodobcter spheroides LPS (LPS-RS), on high glucose-induced inflmmtory response in HMEC-1 cells. LPS-RS reduced the production of IL-1β by HMEC-1 cells t 1 mmol/l glucose tretment (Fig. c). These findings confirmed tht the effect of high glucose on the production of IL-1β by HMEC-1 cells ws TLR4-dependent. Reduction of high glucose induced cytokine production by MRECs from TLR4 deficient mice Next, we determined the expression of IL-1β under high glucose condition by MRECs from TLR4 deficient mice. Rel-time PCR showed tht the expression of IL-1β by WT mouse MRECs under 1 mmol/l glucose ws
7 Wng et l. Dibetol Metb Syndr (21) 7:89 Pge 7 of 1 Fold chnge 1 1 Glucose:. 1 2 (mmol/l) b 1 Fold chnge 1 Time: (hour) c 6 h 12 h 24 h -ctin Glucose (mmol/l). 1 2 d Count IgG. mm Glucose 1 mm Glucose Fig. 3 Expression of TLR4 in HMEC-1 cells subjected to high glucose. HMEC-1 cells were stimulted with glucose t the doses of 1 nd 2 mmol/l for 6 h. The mrna for TLR4 ws detected by quntittive RT-PCR nd normlized to GAPDH. Asterisk indictes P <. compred to. mmol/l glucose. b The cells were stimulted with 1 mmol/l glucose for, 1, 3, 6, 12 nd 24 h. The mrna of TLR4 ws detected by quntittive RT-PCR nd normlized to GAPDH nd expressed s the men ± SE. P <. compred to the h group. c HMEC-1 cells were treted with., 1 nd 2 mmol/l glucose for 6, 12 nd 24 h nd western blot ws performed. β-ctin ws used s control. d TLR4 expression on HMEC-1 cells chllenged with 1 mmol/l glucose for 24 h ssessed by flow cytometry MyD88 -ctin. 1 2 Glucose (mmol/l) c 3 Fold chnge 2 1 Time: (hour) b Fold chnge Glucose:. 1 2 (mmol/l) d 4 IL-1β (pg/ml) 2 Time: (hour) Fig. 4 Activtion of MyD88 nd cytokine expression in HMEC-1 cells under high glucose condition. Western blotting ws performed for MyD88 expression in the HMEC-1 cells fter exposure to 1 nd 2 mmol/l glucose for 12 h. β-ctin ws used s control. b Cells were treted with 1 nd 2 mmol/l glucose for 6 h. The mrna for IL-1β ws detected by quntittive RT-PCR nd normlized to GAPDH. Asterisk indictes P <. compred to. mmol/l glucose. c The cells were stimulted with 1 mmol/l glucose for, 1, 3, 6, 12 nd 24 h. The mrna of IL-1β ws detected by quntittive RT-PCR nd normlized to GAPDH to the h group nd expressed s the men ± SE. P <. compred to the h group. d IL-1β protein in the superntnts of HMEC-1 cells fter high-glucose tretment for indicted time points mesured using ELISA. Asterisk indictes P <. compred to. mmol/l glucose
8 Wng et l. Dibetol Metb Syndr (21) 7:89 Pge 8 of 1 b TLR4 GAPDH 4 Scrmbled sirna TLR4 sirna Fold chnge 1 1 WT TLR4 KO IL-1β (pg/ml) 2 Glucose:. 1 (mmol/l). c 4 Medium LPS-RS Glucose: b 6 IL-1β (pg/ml) WT TLR4 KO (mmol/l) IL-1β (pg/ml) 3 1 Glucose:. 1 (mmol/l) Fig. Inhibition of TLR4 reduces high glucose-induced production of IL-1β by HMEC-1 cells. Western blot nlysis of TLR4 expression by HMEC-1 cells under high glucose condition fter sirna tretment. NG norml glucose, HG high glucose, Sc scrmbled control sirna, si2 TLR4 sirna.2 pmol/l, si4 TLR4 sirna.4 pmol/l, si8 TLR4 sirna.8 pmol/l. b IL-1β concentrtion in superntnts of HMEC-1 cells fter high-glucose tretment in the presence of TLR4 sirna (.8 pmol/l) ws mesured using ELISA. Asterisk indictes P <. compred to. mmol/l glucose. c IL-1β level in superntnts of HMEC-1 cells in the presence of TLR4 ntgonist LPS-RS (1 μg/ml) fter high-glucose tretment ws mesured using ELISA. Asterisk indictes P <. compred to scrmbled control RNA incresed. However, the expression of IL-1β in MRECs from TLR4 deficient mice ws significntly reduced (Fig. 6) (p <.). Similrly, the production of IL-1β protein by MRECs from TLR4 / mice ws lso significntly reduced in comprison with WT mouse cells (Fig. 6b) (p <.). These dt confirm tht TLR4 plys criticl role in high glucose-induced inflmmtory responses in endothelil cells. Discussion Dibetic retinopthy is common vsculr compliction nd ppers to involve inflmmtory responses [3]. Hyperglycemi induces inflmmtion, ffects the Glucose:. 1 (mmol/l) Fig. 6 The expression of IL-1β by MRECs from TLR4 deficient mice under high glucose condition. MRECSs of wild type (WT) mice nd TLR4 knockout (TLR4 KO) mice were cultured with. nd 1 mmol/l glucose for 6 h () nd 24 h (b). The mrna level of IL-1β ws determined by rel time PCR. Asterisk indictes P <. compred to WT mice. b IL-1β protein concentrtion in the superntnts of MRECs fter high-glucose tretment for 24 h ws mesured using ELISA. Asterisk indictes P <. compred to WT mice production of extrcellulr mtrix nd procogulnt proteins, cuses poptosis nd inhibits the prolifertion of endothelil cells. These events resulted in endothelil dysfunction in dibetic retinopthy [31]. Abnormlities in glucose concentrtion hve been reported to elevte nd ctivte TLR4 to promote the secretion of inflmmtory cytokines in mouse mesngil cells nd contribute to dibetic nephropthy [14, 23]. The expression nd function of TLR4 re elevted in monocytes of dibetic ptients [17, 32]. Genetic deficiency of TLR4 is ssocited with significnt reduction of ortic plque nd lower triglyceride ccumultion in the hert in erly stges of dibetes [13, 33]. In ddition, TLR4 gene polymorphism ws found to be ssocited with dibetic retinopthy [1]. Thus, our findings of incresed TLR4 in endothelil cells fter high glucose exposure provide the evidence for the role of TLR4 in dibetic retinopthy. Hyperglycemi, prticulrly the fluctution of glucose levels, cuses significnt oxidtive stress, decresing the expression of endothelil nitric oxide synthse nd impiring NO metbolism [34]. Fluctuting
9 Wng et l. Dibetol Metb Syndr (21) 7:89 Pge 9 of 1 hyperglycemi induces n incresed production of collgen. Furthermore, fluctutions of glycemi increse endothelil cell poptosis, endothelil expression of dhesion molecules, nd vsculr smooth muscle cell prolifertion [3]. Thus, glucose fluctutions pper to be more deleterious to vsculr cell integrity thn constnt high glucose concentrtions. Oxidtive stress plys criticl role in mediting the upregultion of TLR4 under hyperglycemic conditions. It is reported tht hyperglycemi induces TLR4 expression in hyperglycemic humn retinl endothelil cells. It lso increses both MyD88 nd non-myd88 pthwys, nucler fctor-κb (NF-κB), biomeditors, nd monocyte dhesion. Antioxidnt tretment reduced TLR4 expression nd downstrem inflmmtory mrkers [36]. The rticles by Mudlir et l. [37] nd Lu et l. [38] showed tht TLR4 ply n importnt role in mediting inflmmtory pthwys in endothelil cells exposed to high glucose. Therefore, strtegies to block TLR4 signling pthwys pose promising venue to llevite dibeticinduced vsculr complictions. Hyperglycemi-induced TLR4 expression in humn monocytes is ssocited with incresed NAPDH oxidse ctivity triggered by PKC [17]. High glucose incresed PKC-δ ctivity tht medites wide rnge of cellulr function including incresed trnsloction of NF-κB [39]. Additionlly, PKC-δ stimultes p47phox, NADPH oxidse cytosolic subunit, which in turn stimultes the NAPDH oxidse ctivity to generte ROS criticl for TLR4-medited ctivtion of NF-κB. Furthermore, high glucose ws found to enhnce the poptosis of endothelil cells by ctivtion of PKC nd NAPDH [17]. Conclusion Our study demonstrted tht hyperglycemi enhnces the expression of TLR4 nd ctivtes TLR4 in humn endothelil cells tht my ply n importnt role in dibetic retinopthy. Thus, trgeting TLR4 signling pthwy my be novel therpeutic pproch to vsculture-relted disorders. Additionl file Additionl file 1: Figure S1. HMEC-1 cells were cultured with glucose t the doses of. nd 1 mmol/l for 6 h. The mrna for VEGF nd bfgf ws detected by quntittive RT-PCR nd normlized to GAPDH. indictes P<. compred to. mmol/l glucose. Abbrevitions DR: dibetic retinopthy; ELISA: enzyme-linked immunosorbent ssys; HMEC- 1: humn microvsculr endothelil cells; IL: interleukin; LPS: lipopolyscchride; MRECs: mouse retinl endothelil cells; LPS-RS: Rhodobcter spheroides lipopolyscchride; PAMPs: pthogen-ssocited moleculr ptterns; STZ: streptozotocin; TLR4: toll-like receptor 4. Authors contributions LW, JW, JF, HZ, XL nd SBS were deeply involved in the conception nd design of the study. LW, XL nd SBS were responsible for the nlyses of the dt nd drfted the mnuscript. All uthors red nd pproved the finl mnuscript. Author detils 1 Stte Key Lbortory of Ophthlmology, Zhongshn Ophthlmic Center, Sun Yt-sen University, Gungzhou 16, Chin. 2 Gungdong Province Hospitl of Trditionl Chinese Medicine, Gungzhou 112, Chin. Acknowledgements We re grteful to Dr. Ji Ming Wng, Ntionl Cncer Institute, Ntionl Institutes of Helth for his helpful critique of the mnuscript. This project ws supported in prt by the grnts from the Ntionl Nturl Science Foundtion of Chin ( ). Competing interests The uthors declre tht they hve no competing interests. Received: 26 June 21 Accepted: 6 October 21 References 1. Zheng L, Kern TS. Role of nitric oxide, superoxide, peroxynitrite nd PARP in dibetic retinopthy. Front Biosci. 29;14: Kock N, Alccioglu I, Kynk S, et l. Comprison of vitreous nd plsm levels of vsculr endothelil growth fctor, interleukin-6 nd heptocyte growth fctor in dibetic nd non-dibetic retinl detchment cses. Ann Ophthlmol (Skokie). 21;42 Spec No: Bhrdwj AS, Appukuttn B, Wilmrth PA, et l. Role of the retinl vsculr endothelil cell in oculr disese. Prog Retin Eye Res. 213;32: Du XL, Edelstein D, Dimmeler S, et l. Hyperglycemi inhibits endothelil nitric oxide synthse ctivity by posttrnsltionl modifiction t the Akt site. J Clin Invest. 21;18: Luppi P, Cifrelli V, Tse H, et l. Humn C-peptide ntgonises high glucose-induced endothelil dysfunction through the nucler fctorkppb pthwy. Dibetologi. 28;1: Pig R, Nito Y, Kokur S, et l. Short-term high glucose exposure induces monocyte-endothelil cells dhesion nd trnsmigrtion by incresing VCAM-1 nd MCP-1 expression in humn ortic endothelil cells. Atherosclerosis. 27;193: Esposito C, Fsoli G, Plti AR, et l. Long-term exposure to high glucose up-regultes VCAM-induced endothelil cell dhesiveness to PBMC. Kidney Int. 21;9: Piconi L, Qugliro L, D Ros R, et l. Intermittent high glucose enhnces ICAM-1, VCAM-1, E-selectin nd interleukin-6 expression in humn umbilicl endothelil cells in culture: the role of poly(adp-ribose) polymerse. J Thromb Hemost. 24;2: Kwi T, Akir S. The role of pttern-recognition receptors in innte immunity: updte on Toll-like receptors. Nt Immunol. 21;11: Devrj S, Dsu MR, Rockwood J, et l. Incresed toll-like receptor (TLR) 2 nd TLR4 expression in monocytes from ptients with type 1 dibetes: further evidence of proinflmmtory stte. J Clin Endocrinol Metb. 28;93: Yng H, Trcey KJ. Trgeting HMGB1 in inflmmtion. Biochim Biophys Act. 21;1799: Ko MK, Srswthy S, Prikh JG, et l. The role of TLR4 ctivtion in photoreceptor mitochondril oxidtive stress. Invest Ophthlmol Vis Sci. 211;2: Michelsen KS, Wong MH, Shh PK, et l. Lck of Toll-like receptor 4 or myeloid differentition fctor 88 reduces therosclerosis nd lters plque phenotype in mice deficient in polipoprotein E. Proc Ntl Acd Sci USA. 24;11: Kur H, Chien A, Jill I. Hyperglycemi induces Toll like receptor 4 expression nd ctivity in mouse mesngil cells: relevnce to dibetic nephropthy. Am J Physiol Renl Physiol. 212;33:F114.
10 Wng et l. Dibetol Metb Syndr (21) 7:89 Pge 1 of 1 1. Burczynsk M, Brnowicz-Gszczyk I, Trch J, et l. Toll-like receptor 4 gene polymorphism nd erly onset of dibetic retinopthy in ptients with type 2 dibetes. Hum Immunol. 29;7: Singh K, Knt S, Singh VK, et l. Toll-like receptor 4 polymorphisms nd their hplotypes modulte the risk of developing dibetic retinopthy in type 2 dibetes ptients. Mol Vis. 214;2: Dsu MR, Devrj S, Zho L, et l. High glucose induces toll-like receptor expression in humn monocytes: mechnism of ctivtion. Dibetes. 28;7: Pl D, Dsgupt S, Kundu R, et l. Fetuin-A cts s n endogenous lignd of TLR4 to promote lipid-induced insulin resistnce. Nt Med. 212;18: Qugliro L, Piconi L, Assloni R, et l. Intermittent high glucose enhnces poptosis relted to oxidtive stress in humn umbilicl vein endothelil cells: the role of protein kinse C nd NAD(P)H-oxidse ctivtion. Dibetes. 23;2: Dsu MR, Jill I. Free ftty cids in the presence of high glucose mplify monocyte inflmmtion vi Toll-like receptors. Am J Physiol Endocrinol Metb. 211;3:E Wng YL, Wng K, Yu SJ, et l. Assocition of the TLR4 signling pthwy in the retin of streptozotocin-induced dibetic rts. Grefe s Arch Clin Exper Ophthlmol Albrecht von Grefes Archiv fur klinische und experimentelle Ophthlmologie 21;23: Devrj S, Jill I, Yun JM, et l. Demonstrtion of incresed toll-like receptor 2 nd toll-like receptor 4 expression in monocytes of type 1 dibetes mellitus ptients with microvsculr complictions. Metbolism. 211;6: Lin M, Yiu WH, Wu HJ, et l. Toll-like receptor 4 promotes tubulr inflmmtion in dibetic nephropthy. J Am Soc Nephrol. 212;23: Singh K, Singh VK, Agrwl NK, et l. Assocition of Toll-like receptor 4 polymorphisms with dibetic foot ulcers nd ppliction of rtificil neurl network in DFU risk ssessment in type 2 dibetes ptients. Biomed Res Int. 213;213: Knhiy AN, Gupt SK, Singh Kirn. Differentil expression of toll like receptor 4 in type 2 dibetic ptients with impired wound heling. J Dibetes Metb. 213;4: de Kleijn D, Psterkmp G. Toll-like receptors in crdiovsculr diseses. Crdiovsc Res. 23;6: Lin Q, Yng XP, Fng D, et l. High-mobility group box-1 medites toll-like receptor 4-dependent ngiogenesis. Arterioscler Thromb Vsc Biol. 211;31: He C, Sun Y, Ren X, et l. Angiogenesis medited by toll-like receptor 4 in ischemic neurl tissue. Arterioscler Thromb Vsc Biol. 213;33: Yng S, Xu L, Yng T, et l. High-mobility group box-1 nd its role in ngiogenesis. J Leukoc Biol. 214;9: Tng J, Kern TS. Inflmmtion in dibetic retinopthy. Prog Retin Eye Res. 211;3: Hsueh WA, Anderson PW. Hypertension, the endothelil cell, nd the vsculr complictions of dibetes mellitus. Hypertension. 1992;2: Jill I, Huet BA, Kur H, et l. Incresed toll-like receptor ctivity in ptients with metbolic syndrome. Dibetes Cre. 212;3: Dong B, Qi D, Yng L, et l. TLR4 regultes crdic lipid ccumultion nd dibetic hert disese in the nonobese dibetic mouse model of type 1 dibetes. Am J Physiol Hert Circ Physiol. 212;33:H Chen X, Feng L, Jin H. Constnt or fluctuting hyperglycemis increses cytomembrne stiffness of humn umbilicl vein endothelil cells in culture: roles of cytoskeletl rerrngement nd nitric oxide synthesis. BMC Cell Biol. 213;14: Med M, Hyshi T, Mizuno N, et l. Intermittent high glucose implements stress-induced senescence in humn vsculr endothelil cells: role of superoxide production by NADPH oxidse. PLoS One. 21;1:e Rjmni U, Jill I. Hyperglycemi induces Toll-like receptor-2 nd -4 expression nd ctivity in humn microvsculr retinl endothelil cells: implictions for dibetic retinopthy. J Dibetes Res. 214;214: Mudlir H, Pollock C, M J, et l. The role of TLR2 nd 4-medited inflmmtory pthwys in endothelil cells exposed to high glucose. PLoS One. 214;9:e Lu Z, Li Y, Jin J, et l. Toll-like receptor 4 ctivtion in microvsculr endothelil cells triggers robust inflmmtory response nd cross tlk with mononucler cells vi interleukin-6. Arterioscler Thromb Vsc Biol. 212;32: Hu KF, Wng SH, Dong WC, et l. High glucose increses nitric oxide genertion in lipopolyscchride-ctivted mcrophges by enhncing ctivity of protein kinse C-α/δ nd NF-κB. Inflmm Res. 212;61: Submit your next mnuscript to BioMed Centrl nd tke full dvntge of: Convenient online submission Thorough peer review No spce constrints or color figure chrges Immedite publiction on cceptnce Inclusion in PubMed, CAS, Scopus nd Google Scholr Reserch which is freely vilble for redistribution Submit your mnuscript t
Supplementary Figure 1
Roles of endoplsmic reticulum stress-medited poptosis in -polrized mcrophges during mycocteril infections Supplementry informtion Yun-Ji Lim, Min-Hee Yi, Ji-Ae Choi, Jung-hwn Lee, Ji-Ye Hn, Sung-Hee Jo,
More informationUlk λ PPase. 32 P-Ulk1 32 P-GST-TSC2. Ulk1 GST (TSC2) : Ha-Ulk1 : AMPK. WB: Ha (Ulk1) : Glu. h CON - Glu - A.A WB: LC3 AMPK-WT AMPK-DKO
DOI: 10.1038/ncb2152 C.C + - + - : Glu b Ulk1 - - + λ PPse c AMPK + - + + : ATP P-GST-TSC2 WB: Flg (Ulk1) WB Ulk1 WB: H (Ulk1) GST (TSC2) C.C d e WT K46R - + - + : H-Ulk1 : AMPK - + - + + + AMPK H-Ulk1
More informationTNF-α (pg/ml) IL-6 (ng/ml)
Xio, et l., Supplementry Figure 1 IL-6 (ng/ml) TNF-α (pg/ml) 16 12 8 4 1,4 1,2 1, 8 6 4 2 med Cl / Pm3CSK4 zymosn curdln Poly (I:C) LPS flgelin MALP-2 imiquimod R848 CpG TNF-α (pg/ml) IL-6 (ng/ml) 2 1.6
More information2018 American Diabetes Association. Published online at
Supplementry Figure S1. Ft-1 mice exhibit reduced diposity when fed n HFHS diet. WT nd ft-1 mice were fed either control or n HFHS diet for 18 weeks. A: Representtive photogrphs for side-by-side comprison
More informationAcute and gradual increases in BDNF concentration elicit distinct signaling and functions in neurons
nd grdul increses in BDNF concentrtion elicit distinct signling nd functions in neurons Yunyun Ji,, Yun Lu, Feng Yng, Wnhu Shen, Tin Tze-Tsng Tng,, Linyin Feng, Shumin Dun, nd Bi Lu,.. - Grdul (normlized
More information* * * * * liver kidney ileum. Supplementary Fig.S1
Supplementry Fig.S1 liver kidney ileum Fig.S1. Orlly delivered Fexrmine is intestinlly-restricted Mice received vehicle or Fexrmine (100mg/kg) vi per os (PO) or intrperitonel (IP) injection for 5 dys (n=3/group).
More informationGDF11 Protects against Endothelial Injury and Reduces Atherosclerotic Lesion Formation in Apolipoprotein E-Null Mice
originl rticle The Americn Society of Gene & Cell Therpy Protects ginst Endothelil Injury nd Reduces Atherosclerotic Lesion Formtion in Apolipoprotein E-Null Mice Wen Mei, Gungd Xing, Yixing Li 2, Hun
More informationSupplementary Figure S1
Supplementry Figure S Connexin4 TroponinI Merge Plsm memrne Met Intrcellulr Met Supplementry Figure S H9c rt crdiomyolsts cell line. () Immunofluorescence of crdic mrkers: Connexin4 (green) nd TroponinI
More informationFeeding state and age dependent changes in melaninconcentrating hormone expression in the hypothalamus of broiler chickens
Supplementry Mterils Epub: No 2017_23 Vol. 65, 2018 https://doi.org/10.183/bp.2017_23 Regulr pper Feeding stte nd ge dependent chnges in melninconcentrting hormone expression in the hypothlmus of broiler
More informationDose-dependent effect of daptomycin on the artificial prolongation of prothrombin time in coagulation abnormalities: in vitro verification
Hshimoto et l. BMC Phrmcology nd Toxicology (2017) 18:74 DOI 10.1186/s40360-017-0180-3 RESEARCH ARTICLE Open Access Dose-dependent effect of dptomycin on the rtificil prolongtion of prothrombin time in
More informationSUPPLEMENTARY INFORMATION
Prentl doi:.8/nture57 Figure S HPMECs LM Cells Cell lines VEGF (ng/ml) Prentl 7. +/-. LM 7. +/-.99 LM 7. +/-.99 Fold COX induction 5 VEGF: - + + + Bevcizum: - - 5 (µg/ml) Reltive MMP LM mock COX MMP LM+
More informationProtective effect of rosuvastatin treatment by regulating oxidized low-density lipoprotein expression in a rat model of liver fibrosis
BIOMEDICAL REPORTS 5: 311-316, 2016 Protective effect of rosuvsttin tretment by regulting oxidized low-density lipoprotein expression in rt model of liver fibrosis SHUIPING YU 1, XUELING ZHOU 1, BINGZONG
More informationDOI: 10.1038/nc2331 PCre;Ros26R 12 h induction 48 h induction Vegfr3 i EC c d ib4 24 h induction VEGFR3 e Fold chnge 1.0 0.5 P < 0.05 Vegfr3 i EC Vegfr3 Figure S1 Cre ctivtion leds to genetic deletion
More informationResearch Article Protective Effect of Short-Term Genistein Supplementation on the Early Stage in Diabetes-Induced Renal Damage
Meditors of Inflmmtion Volume 2013, rticle ID 510212, 14 pges http://dx.doi.org/10.1155/2013/510212 Reserch rticle Protective Effect of Short-Term Genistein Supplementtion on the Erly Stge in Dibetes-Induced
More informationEFFECTS OF AN ACUTE ENTERIC DISEASE CHALLENGE ON IGF-1 AND IGFBP-3 GENE EXPRESSION IN PORCINE SKELETAL MUSCLE
Swine Dy 22 Contents EFFECTS OF AN ACUTE ENTERIC DISEASE CHALLENGE ON IGF-1 AND IGFBP-3 GENE EXPRESSION IN PORCINE SKELETAL MUSCLE B. J. Johnson, J. P. Kyser, J. D. Dunn, A. T. Wyln, S. S. Dritz 1, J.
More informationMicrotubule-driven spatial arrangement of mitochondria promotes activation of the NLRP3 inflammasome
Supplementry Informtion Microtuule-driven sptil rrngement of mitochondri promotes ctivtion of the NLRP3 inflmmsome Tkum Misw 1,2, Michihiro Tkhm 1,2, Ttsuy Kozki 1,2, Hnn Lee 1,2, Jin Zou 1,2, Ttsuy Sitoh
More informationA Comparison of Serum Magnesium Level in Pregnant Women with and without Gestational Diabetes Mellitus (GDM)
Brief Report J Bbol Univ Med Sci Vol 18, Issu 12; Dec 2016. P:71-75 A Comprison of Serum Mgnesium Level in Pregnnt Women with nd without Gesttionl Dibetes Mellitus (GDM) Z. Bouzri (MD) 1, F. Elmi(MD) 2,
More informationDiabetes mellitus secondary to pancreatic diseases (type 3c): The effect of smoking on the exocrine endocrine interactions of the pancreas
764062DVR0010.1177/1479164118764062Dibetes & Vsculr Disese ReserchŚliwińsk-Mossoń et l. reserch-rticle2018 Originl Article Dibetes mellitus secondry to pncretic diseses (type 3c): The effect of smoking
More informationSupplementary figure 1
Supplementry figure 1 Dy 8 post LCMV infection Vsculr Assoc. Prenchym Dy 3 post LCMV infection 1 5 6.7.29 1 4 1 3 1 2 88.9 4.16 1 2 1 3 1 4 1 5 1 5 1.59 5.97 1 4 1 3 1 2 21.4 71 1 2 1 3 1 4 1 5 1 5.59.22
More informationSignificance of Expression of TGF- in Pulmonary Metastasis in Non-small Cell Lung Cancer Tissues
Originl Article Significnce of Expression of in Pulmonry Metstsis in Non-smll Cell Lung Cncer Tissues Hisshi Sji, Hruhiko Nkmur, Idiris Awut, Norihito Kwski, Msru Hgiwr, Akihiko Ogt, Mkoto Hosk, Tkmoto
More informationRelationship between serum irisin, glycemic indices, and renal function in type 2 diabetic patients
J Renl Inj Prev. 2017; 6(2): 88-92. http://journlrip.com Journl of Renl Injury Prevention DOI: 10.15171/jrip.2017.17 Reltionship between serum irisin, glycemic indices, nd renl function in type 2 dibetic
More informationUlinastatin reduces urinary sepsis related inflammation by upregulating IL 10 and downregulating TNF α levels
MOLECULAR MEDICINE REPORTS 8: 29-34, 2013 Ulinsttin reduces urinry sepsis relted inflmmtion by upregulting IL 10 nd downregulting TNF α levels XIAN CHEN 1*, YI WANG 1*, HONGMEI LUO 2, ZHIGANG LUO 1, LISHA
More informationMyricetin Ameliorates Defective Post-Receptor Insulin Signaling via
Evidence-Bsed Complementry nd Alterntive Medicine Volume 211, Article ID 15752, 9 pges doi:1.193/ecm/neq17 Originl Article Ameliortes Defective Post-Receptor Insulin Signling vi β-endorphin Signling in
More informationSUPPLEMENTARY INFORMATION
X p -lu c ct ivi ty doi:.8/nture8 S CsA - THA + DAPI Merge FSK THA TUN Supplementry Figure : A. Ad-Xp luc ctivity in primry heptocytes exposed to FSK, THA, or TUN s indicted. Luciferse ctivity normlized
More informationClinical Study Report Synopsis Drug Substance Naloxegol Study Code D3820C00018 Edition Number 1 Date 01 February 2013 EudraCT Number
EudrCT Number 2012-001531-31 A Phse I, Rndomised, Open-lbel, 3-wy Cross-over Study in Helthy Volunteers to Demonstrte the Bioequivlence of the Nloxegol 25 mg Commercil nd Phse III Formultions nd to Assess
More informationSupplementary Figure 1
doi: 1.138/nture6188 SUPPLEMENTARY INFORMATION Supplementry Figure 1 c CFU-F colonies per 1 5 stroml cells 14 12 1 8 6 4 2 Mtrigel plug Neg. MCF7/Rs MDA-MB-231 * * MCF7/Rs-Lung MDA-MB-231-Lung MCF7/Rs-Kidney
More informationCME/SAM. Study on Hyperuricemia in HBV-Associated Glomerulonephritis
AJCP / Originl Article Study on Hyperuricemi in HBV-Associted Glomerulonephritis Yongze Zhung, MD, PhD, 1 Yingho Yu, MD, PhD, 2 Yingfng Hung, MD, 3 nd Xiorong Zhong, MD 1 From the 1 Deprtment of Nephrology,
More informationSUPPLEMENTARY INFORMATION
doi:1.138/nture1794 BR EPFs BRI1? ERECTA TMM BSKs YDA PP2A BSU1 BIN2 pbzr1/2 BZR1/2 MKK4/5/7/9 MPK3/6 SPCH Cell growth Stomtl production Supplementry Figure 1. The model of BR nd stomtl signling pthwys.
More informationAssessment of Depression in Multiple Sclerosis. Validity of Including Somatic Items on the Beck Depression Inventory II
Assessment of Depression in Multiple Sclerosis Vlidity of Including Somtic Items on the Beck Depression Inventory II Peggy Crwford, PhD; Noh J. Webster, MA Signs nd symptoms of multiple sclerosis (MS)
More informationSupplementary Online Content
Supplementry Online Content Zulmn DM, Pl Chee C, Ezeji-Okoye SC, et l. Effect of n intensive outptient progrm to ugment primry cre for high-need Veterns Affirs ptients: rndomized clinicl tril. JAMA Intern
More informationSESSIONE I: RELATORI. Ghrelin: from oroxigenic signal to metabolic master regulator?
SESSIONE I: RELATORI Ghrelin: from oroxigenic signl to metbolic mster regultor? Prof. Rocco Brzzoni Professore ssocito di Medicin Intern Università degli Studi di Trieste Ghrelin: d segnle oressizznte
More informationABSTRACT. Marek s disease virus (MDV) infection causes atherosclerosis, and prior
ABSTRACT Title of Document: Directed By: COMPARATIVE STUDY OF LIPOPROTEIN METABOLISM IN MAREK S DISEASE SUSCEPTIBLE AND RESISTANT LINES Ping Yun, Mster of Science, 2010 Assistnt professor Dr. Jiuzhou Song,
More informationAbstract ABSTRACT #69. Abstract. Introduction & Methods. Methods & Results. Results. Results & Conclusions
Effects of dietry β-glucn on Growth Performnce, Dirrhe, nd Gut Permeility of Wening Pigs Experimentlly Infected with Pthogenic E. coli Kwngwook Kim, Amy Ehrlich, Vivin Perng, Jennifer Chse, Helen Ryould,
More informationSerum nesfatin-1 levels are decreased in pregnant women newly diagnosed with gestational diabetes
originl rticle Serum nesftin-1 levels re decresed in pregnnt women newly dignosed with gesttionl dibetes Esr Nur Ademoglu 1, Suheyl Gorr 2, Muge Keskin 3, Ayse Crlioglu 4, Rifki Ucler 5, Husmettin Erdmr
More informationSafety and Tolerability of Subcutaneous Sarilumab and Intravenous Tocilizumab in Patients With RA
Sfety nd Tolerbility of Subcutneous Srilumb nd Intrvenous Tocilizumb in Ptients With RA Pul Emery, 1 Jun Rondon, 2 Anju Grg, 3 Hubert vn Hoogstrten, 3 Neil M.H. Grhm, 4 Ming Liu, 4 Nncy Liu, 3 Jnie Prrino,
More informationPDGF-BB secreted by preosteoclasts induces angiogenesis during coupling with osteogenesis
Supplementry Informtion PDGF-BB secreted y preosteoclsts induces ngiogenesis during coupling with osteogenesis Hui Xie, Zhung Cui, Long Wng, Zhuying Xi, Yin Hu, Lingling Xin, Chngjun Li, Ling Xie, Jnet
More informationSUPPLEMENTARY INFORMATION
DOI: 1.138/nc286 Figure S1 e f Medium DMSO AktVIII PP242 Rp S6K1-I Gr1 + + + + + + Strvtion + + + + + IB: Akt-pT38 IB: Akt K-pT389 K IB: Rptor Gr1 shs6k1-a shs6k1-b shs6k1-c shrictor shrptor Gr1 c IB:
More informationSUPPLEMENTARY INFORMATION
doi:0.08/nture0987 SUPPLEMENTARY FIGURE Structure of rbbit Xist gene. Exons re shown in boxes with romn numbers, introns in thin lines. Arrows indicte the locliztion of primers used for mplifiction. WWW.NATURE.COM/NATURE
More informationSupplementary Information. SAMHD1 Restricts HIV-1 Infection in Resting CD4 + T Cells
Supplementry Informtion SAMHD Restricts HIV- Infection in Resting CD T Cells Hnn-Mri Blduf,2,, Xioyu Pn,, Elin Erikson,2, Srh Schmidt, Wqo Dddch 3, Mnj Burggrf, Kristin Schenkov, In Amiel,2, Guido Wnitz
More informationImpact of Pharmacist Intervention on Diabetes Patients in an Ambulatory Setting
Impct of Phrmcist Intervention on Dibetes Ptients in n Ambultory Setting Julie Stding, PhrmD, CDE, Jmie Herrmnn, PhrmD, Ryn Wlters, MS, Chris Destche, PhrmD, nd Aln Chock, PhrmD Dibetes is the seventh-leding
More informationAnalysis of alternatives for insulinizing patients to achieve glycemic control and avoid accompanying risks of hypoglycemia
284 Anlysis of lterntives for izing ptients to chieve glycemic control nd void ccompnying risks of hypoglycemi JIALIN GAO 1,2*, QIANYIN XIONG 1,2*, JUN MIAO 1*, YAO ZHANG 2,3, LIBING XIA 1, MEIQIN LU 1,
More informationEffect of intranasal rosiglitazone on airway inflammation and remodeling in a murine model of chronic asthma
ORIGINAL ARTICLE Koren J Intern Med 2016;31:89-97 Effect of intrnsl rosiglitzone on irwy inflmmtion nd remodeling in murine model of chronic sthm Hw Young Lee *, Chin Kook Rhee *, Ji Young Kng, Chn Kwon
More informationMyricetin Ameliorates Defective Post-Receptor Insulin Signaling via b-endorphin Signaling in the Skeletal Muscles of Fructose-Fed Rats
ecam Advnce Access published Mrch 3, 2010 ecam 2010;Pge 1 of 9 doi:10.1093/ecm/neq017 Originl Article Ameliortes Defective Post-Receptor Insulin Signling vi b-endorphin Signling in the Skeletl Muscles
More informationphosphatase isoenzyme activity: estimation of
J Clin Pthol 1988;41:202-206 Quntittive method for determining serum lkline phosphtse isoenzyme ctivity: estimtion of intestinl component M J PEAKE, M PEJAKOVIC, G H WHITE From the Deprtment ofbiochemistry
More informationBiochemical and Biophysical Research Communications
Biochemicl nd Biophysicl Reserch Communictions 423 (2012) 884 888 Contents lists vilble t SciVerse ScienceDirect Biochemicl nd Biophysicl Reserch Communictions journl homepge: www.elsevier.com/locte/ybbrc
More informationAdipocyte in vascular wall can induce the rupture of abdominal aortic aneurysm
Adipocyte in vsculr wll cn induce the rupture of dominl ortic neurysm Hiron Kugo 1 *, Nouhiro Zim 1 *, Hiroki Tnk 2 *, Youhei Mouri 1, Kenichi Yngimoto 3, Kohsuke Hymizu 3,4, Keisuke Hshimoto 1, Tkeshi
More informationSUPPLEMENTARY INFORMATION. Cytochrome P450-2E1 promotes fast food-mediated hepatic fibrosis
SUPPLEMENTARY INRMATION Cytochrome P-E1 promotes fst food-medited heptic fibrosis Mohmed A. Abdelmegeed, Youngshim Choi, Grzegorz Godlewski b, Seung-Kwon H, Atryee Bnerjee, Sehwn Jng, nd Byoung-Joon Song
More informationSUPPLEMENTARY INFORMATION
SUPPEMENTARY INFORMATION DOI: 1.138/ncb956 Norml CIS Invsive crcinom 4 months months b Bldder #1 Bldder # Bldder #3 6 months (Invsive crcinom) Supplementry Figure 1 Mouse model of bldder cncer. () Schemtic
More informationIGF-I and IGFBP-3 augment transforming growth factor-b actions in human renal carcinoma cells
originl rticle http://www.kidney-interntionl.org & Interntionl Society of Nephrology IGF-I nd IGFBP-3 ugment trnsforming growth fctor-b ctions in humn renl crcinom cells AH Rosendhl 1, nd G Forsberg 1
More informationNappHS. rrna. transcript abundance. NappHS relative con W+W 0.8. nicotine [µg mg -1 FM]
(A) W+OS 3 min 6 min con L S L S RNA loding control NppHS rrna (B) (C) 8 1 k NppHS reltive trnscript undnce 6 4.5 *** *** *** *** 3 k. + + + line 1 line (D) nicotine [µg mg -1 FM] 1..8.4. con W+W Supplementl
More informationRole of interleukin 18 in acute lung inflammation induced by gut ischemia reperfusion
PO Box 2345, Beijing 100023, Chin World J Gstroenterol 2005;11(29):4524-4529 www.wjgnet.com World Journl of Gstroenterology ISSN 1007-9327 wjg@wjgnet.com ELSEVIER 2005 The WJG Press nd Elsevier Inc. All
More informationEffects of Rosiglitazone on Inflammation in Otsuka Long-Evans Tokushima Fatty Rats
Originl Article Koren Dibetes J 21;34:191-199 doi: 1.493/kdj.21.34.3.191 pissn 1976-918 eissn 293-265 Effects of Rosiglitzone on Inflmmtion in Otsuk Long-Evns Tokushim Ftty Rts Jin Woo Lee 1, Il Seong
More informationExpression of circulating microrna-1 and microrna-133 in pediatric patients with tachycardia
MOLECULAR MEDICINE REPORTS 11: 4039-4046, 2015 Expression of circulting microrna-1 nd microrna-133 in peditric ptients with tchycrdi LING SUN 1*, SHUO SUN 2*, SHAOYING ZENG 1, YUFEN LI 1, WEI PAN 1 nd
More informationSUPPLEMENTARY INFORMATION
. Norml Physiologicl Conditions. SIRT1 Loss-of-Function S1. Model for the role of SIRT1 in the regultion of memory nd plsticity. () Our findings suggest tht SIRT1 normlly functions in coopertion with YY1,
More informationA cross-sectional and follow-up study of leukopenia in tuberculosis patients: prevalence, risk factors and impact of anti-tuberculosis
Originl Article A cross-sectionl nd follow-up study of leukopeni in tuberculosis ptients: prevlence, risk fctors nd impct of nti-tuberculosis tretment Fei-Shen Lin 1 *, Mei-Ying Wu 2 *, Wen-Jun Tu 3, Hong-Qiu
More informationIncreased expression of receptor for advanced glycation end-products worsens focal brain ischemia in diabetic rats*
NEURAL REGENERATION RESEARCH Volume 7, Issue 13, My 2012 www.nrronline.org Cite this rticle s: Neurl Regen Res. 2012;7(13):1000-1005. Incresed expression of receptor for dvnced glyction end-products worsens
More informationEffects of blueberries on migration, invasion, proliferation, the cell cycle and apoptosis in hepatocellular carcinoma cells
BIOMEDICAL REPORTS 5: 579-584, 2016 Effects of blueberries on migrtion, invsion, prolifertion, the cell cycle nd poptosis in heptocellulr crcinom cells WEI ZHAN 1*, XIN LIAO 2*, LEI YU 3, TIAN TIAN 3,
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nture09663 Scrmle shnlrp3 shcsp1 IL-1β (p17) IL-1β (pg/ml) 2000 1500 1000 500 Wt Nlrp3-/- Ipf-/- 0 APDC IL-1β (p17) Supplementl Figure 1. Mitochondril ROS cn trigger NLRP3 inflmmsome ctivtion,
More information*** *** *** *** T-cells T-ALL. T-cells T-ALL. T-cells T-ALL. T-cells T-ALL. T-cells T-ALL. Relative ATP content. Relative ATP content RLU RLU
RLU Events 1 1 1 Luciferin (μm) T-cells T-ALL 1 1 Time (min) T-cells T-ALL 1 1 1 1 DCF-DA Reltive ATP content....1.1.. T-cells T-ALL RLU 1 1 T-cells T-ALL Luciferin (μm) 1 1 Time (min) c d Control e DCFH-DA
More informationExtraction and Some Functional Properties of Protein Extract from Rice Bran
Ksetsrt J. (Nt. Sci.) 40 : 209-214 (2006) Extrction nd Some Functionl Properties of Protein Extrct from Rice Brn Chockchi Theerkulkit*, Siree Chiseri nd Siriwt Mongkolknchnsiri ABSTRACT Rice brn protein
More informationSUPPLEMENTARY INFORMATION
doi: 1.138/nture862 humn hr. 21q MRPL39 murine Chr.16 Mrpl39 Dyrk1A Runx1 murine Chr. 17 ZNF295 Ets2 Znf295 murine Chr. 1 COL18A1 -/- lot: nti-dscr1 IgG hevy hin DSCR1 DSCR1 expression reltive to hevy
More informationEffect on Glycemic, Blood Pressure, and Lipid Control according to Education Types
Originl Article http://dx.doi.org/10.4093/dmj.2011.35.6.580 pissn 2233-6079 eissn 2233-6087 D I A B E T E S & M E T A B O L I S M J O U R N A L Effect on Glycemic, Blood Pressure, nd Lipid Control ccording
More informationA proliferation-inducing ligand (APRIL) in neutrophils of patients with oral cavity squamous cell carcinoma
Eur. Cytokine Netw. Vol. 23 n 3, July-August-September 212, 93-1 93 RESEARCH ARTICLE A prolifertion-inducing lignd (APRIL) in neutrophils of ptients with orl cvity squmous cell crcinom Ew Jbłońsk 1, Ntli
More informationVitamin D and Mushrooms: Enrichment With Pulsed UV Light. Michael Kalaras Department of Food Science The Pennsylvania State University
Vitmin D nd Mushrooms: Enrichment With Pulsed UV Light Michel Klrs Deprtment of Food Science The Pennsylvni Stte University Vitmin D Synthesis Source: http://vitmind.ucr.edu/imges/chem1.gif Vitmin D In
More informationThe Acute Time Course of Concurrent Activation Potentiation
Mrquette University e-publictions@mrquette Exercise Science Fculty Reserch nd Publictions Exercise Science, Deprtment of 1-1-2010 The Acute Time Course of Concurrent Activtion Potentition Luke Grceu Mrquette
More informationClinical statistics analysis on the characteristics of pneumoconiosis of Chinese miner population
Originl Article Clinicl sttistics nlysis on the chrcteristics of pneumoconiosis of Chinese miner popultion Mei-Fng Wng 1 *, Run-Ze Li 2 *, Ying Li 2, Xue-Qin Cheng 1, Jun Yng 1, Wen Chen 3, Xing-Xing Fn
More informationJournal of Hainan Medical University 2017; 23(2): Journal of Hainan Medical University.
Journl of Hinn Medicl University 2017; 23(2): 151-155 151 Journl of Hinn Medicl University http://www.hnykdxxb.com Reltionship between DEXA bone minerl density mesurement results nd serum cytokines s well
More informationTREM-1 regulates macrophage polarization in ureteral obstruction
sic reserch http://www.kidney-interntionl.org & 1 Interntionl Society of Nephrology regultes mcrophge polriztion in ureterl ostruction Tzu-Hn Lo 1,1, Ki-Yu Tseng,1, Wen-Shn Tso, Chih-Y Yng,3, Shie-Ling
More informationUsing Paclobutrazol to Suppress Inflorescence Height of Potted Phalaenopsis Orchids
Using Pcloutrzol to Suppress Inflorescence Height of Potted Phlenopsis Orchids A REPORT SUBMITTED TO FINE AMERICAS Linsey Newton nd Erik Runkle Deprtment of Horticulture Spring 28 Using Pcloutrzol to Suppress
More informationAdult mouse model of early hepatocellular carcinoma promoted by alcoholic liver disease
University of Msschusetts Medicl School escholrship@umms Open Access Articles Open Access Publictions by UMMS Authors -8-16 Adult mouse model of erly heptocellulr crcinom promoted by lcoholic liver disese
More informationResearch Article. Mohammad Lalmoddin Mollah, Dong Ki Park, and Hye-Jin Park. 1. Introduction
Evidence-Bsed Complementry nd Alterntive Medicine Volume 212, Article ID 249217, 7 pges doi:1.1155/212/249217 Reserch Article Cordyceps militris GrownonGermintedSoybenInduces G2/M Cell Cycle Arrest through
More informationAssociation of PTEN expression with liver function and inflammatory changes in patients with liver cancer after chemotherapy
ONCOLOGY LETTERS Assocition of PTEN expression with liver function nd inflmmtory chnges in ptients with liver cncer fter chemotherpy JIXIANG ZHOU nd XIAOLI LI Deprtment of Heptobiliry Surgery, Xingy Hospitl,
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nture09973 Plsm Memrne Phgosome TLR1/2/4 ROS Mitochondrion ROS OXPHOS Complex I ROS TRAF6 NADPH Oxidse Supplementry Figure 1 Model detiling the roles of mitochondril ROS in mcrophge cteril
More informationThe Effect of Glucose Fluctuation on Apoptosis and Function of INS-1 Pancreatic Beta Cells
Originl Article doi: 1.493/kdj.21.34.1.47 pissn 1976-918 eissn 293-265 The Effect of Glucose Fluctution on Apoptosis nd Function of INS-1 Pncretic Bet ells Mi Kyung Kim 1,2, Hye Sook Jung 2, hng Shin Yoon
More informationCombination of microrna-21 and microrna-146a Attenuates Cardiac Dysfunction and Apoptosis During Acute Myocardial Infarction in Mice
Cittion: Moleculr Therpy Nucleic Acids (16) 5, e96; doi:1.138/mtn.16.1 Officil journl of the Americn Society of Gene & Cell Therpy All rights reserved 16-531/16 www.nture.com/mtn Combintion of microrna-1
More informationYKL-40: An Emerging Biomarker of Endothelial Dysfunction in Arteriogenic Erectile Dysfunction
YKL-40: An Emerging Biomrker of Endothelil Dysfunction in Arteriogenic Erectile Dysfunction Originl Article Hnn H. Sbry 1, Ahmed H. Hmed 1, Jehn H. Sbry 2, Osm H. Abdel-Slm 1 1 Deprtments of Dermtology
More informationPulmonary hypertension and vascular remodeling in mice exposed to crystalline silica
Zelko et l. Respirtory Reserch (216) 17:16 DOI 1.1186/s12931-16-478-5 RESEARCH Pulmonry hypertension nd vsculr remodeling in mice exposed to crystlline silic Igor N. Zelko 1,2, Jinxin Zhu 1, Jeffrey D.
More informationInvasive Pneumococcal Disease Quarterly Report. July September 2017
Invsive Pneumococcl Disese Qurterly Report July September 2017 Prepred s prt of Ministry of Helth contrct for scientific services by Rebekh Roos Helen Heffernn October 2017 Acknowledgements This report
More informationAnalysis of Regulatory of Interrelated Activity of Hepatocyte and Hepatitis B Viruses
Interntionl Journl of Biomedicl Mterils Reserch 8 6(): -7 http://www.sciencepublishinggroup.com/j/ijbmr doi:.648/j.ijbmr.86. ISSN: 33-756 (Print) ISSN: 33-7579 (Online) Anlysis of Regultory of Interrelted
More informationSupplemental Information. Lymphocytes Negatively Regulate NK Cell Activity. via Qa-1b following Viral Infection
Cell Reports, Volume 21 Supplementl Informtion Lymphocytes Negtively Regulte NK Cell Activity vi Q-1b following Virl Infection Hifeng C. Xu, Jun Hung, Aleksndr A. Pndyr, Elisbeth Lng, Yun Zhung, Christine
More informationResearch Article Oral Administration of Alkylglycerols Differentially Modulates High-Fat Diet-Induced Obesity and Insulin Resistance in Mice
Evidence-Bsed Complementry nd Alterntive Medicine Volume 2013, Article ID 834027, 11 pges http://dx.doi.org/10.1155/2013/834027 Reserch Article Orl Administrtion of Alkylglycerols Differentilly Modultes
More informationARTICLE. E. Pavlova 1, N. Atanassova 1, C. McKinnell 2, R.M. Sharpe 2 1 Institute of Experimental Morphology, Pathology and Anthropology with Museum,
DOI:.554/5YRTIMB..3 OPPOSITE MODELS OF EXPRESSION OF ANDROGEN RECEPTOR (AR) AND RETINOIC ACID RECEPTOR-α (RAR-α) IN THE ONSET OF MALE GERM CELL DEVELOPMENT IN HORMONALLY MANIPULATED RATS E. Pvlov, N. Atnssov,
More informationInhibition of adipocyte differentiation in 3T3-L1 cell line by quercetin or isorhamnetin
Louisin Stte University LSU Digitl Commons LSU Mster's Theses Grdute School 2012 Inhibition of dipocyte differentition in 3T3-L1 cell line by quercetin or isorhmnetin Din Gbriel Crvjl-Aldz Louisin Stte
More informationCHAPTER- 3 ANALYSIS OF PATHOPHYSIOLOGICAL MARKER ENZYMES, LIPID AND PROTEIN PROFILES IN CONTROL AND EXPERIMENTAL ANIMALS
CHAPTER- 3 CHAPTER- 3 ANALYSIS OF PATHOPHYSIOLOGICAL MARKER ENZYMES, LIPID AND PROTEIN PROFILES IN CONTROL AND EXPERIMENTAL ANIMALS 3.1. INTRODUCTION The liver, hs vriety of trnsminse to synthesize nd
More informationESM Table 1. Characterisation of the human non-diabetic cohort used for MRIbased assessment of pancreatic fat and insulin secretion via OGTT.
ESM Tle 1. Chrcteristion of the humn non-dietic cohort used for MRIsed ssessment of pncretic ft nd insulin secretion vi OGTT. Trit sex Medin (IQR) 86 femles, 5 mles ge (yers) 4.4 (.5-5.57) BMI (kg/m²).62
More informationSUPPLEMENTARY INFORMATION
doi: 10.1038/nture07679 Emryonic Stem (ES) cell Hemngiolst Flk1 + Blst Colony 3 to 3.5 Dys 3-4 Dys ES differentition Sort of Flk1 + cells Supplementry Figure 1. Chrcteristion of lst colony development.
More informationTrends in antihypertensive and lipidlowering therapy in subjects with type II diabetes: clinical effectiveness or clinical discretion?
ORIGINAL ARTICLE Trends in ntihypertensive nd lipidlowering therpy in subjects with type II dibetes: clinicl effectiveness or clinicl discretion? MC Gulliford, J Chrlton nd R Ltinovic Deprtment of Public
More informationPROVEN ANTICOCCIDIAL IN NEW FORMULATION
PROVEN ANTICOCCIDIAL IN NEW FORMULATION Coxidin 100 microgrnulte A coccidiosttic dditive for roilers, chickens rered for lying nd turkeys Contins 100 g of monensin sodium per kg Aville s homogenous grnules
More informationInhibition of ALDH2 expression aggravates renal injury in a rat sepsis syndrome model
EXPERIMENTAL AND THERAPEUTIC MEDICINE 14: 2249-2254, 2017 Inhibition of ALDH2 expression ggrvtes renl injury in rt sepsis syndrome model JUN FENG HU 1*, HUA XUE WANG 2*, HUI HUI LI 3, JIE HU 4, YING YU
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/nc2824 Hcn4 Tx5 Mlc2 c Hcn4- ISH d Tx5- ISH e Mlc2-ISH Hcn4-ISH f e Tx5-ISH f -ISH Figure S1 Section in situ hyridistion nlysis of crescent stge mouse emryos (E7.5). () More nterior section
More informationTumor Necrosis Factor- et Modulates Monocyte/Macrophage Apoprotein E Gene Expression
Tumor Necrosis Fctor- et Modultes Monocyte/Mcrophge Apoprotein E Gene Expression Hongwei Dun, Zhigo Li, nd Theodore Mzzone Deprtments of Medicine nd Biochemistry, Rush Medicl College, Chicgo, Illinois
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:1.138/nture1188 1mM CCl 2 (min) 3 4 6 CCl 2 (mm) for 4min.1. 1 (mm) Pro- d WT GdCl 3 R-68 -/- P2x7r -/- -/- Csp1 -/- WT -/- P2x7r -/- -/- Csp1 -/- Csp1 (p2) (p17) Pro-Csp1
More informationFat intake in patients newly diagnosed with type 2 diabetes: a 4-year follow-up study in general practice
Originl ppers Ft intke in ptients newly dignosed with type 2 dibetes: 4-yer follow-up study in generl prctice Floris A vn de Lr, Eloy H vn de Lisdonk, Peter L B J Lucssen, J M H Tigchelr, Sski Meyboom,
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nture11225 Numer of OTUs sed on 3% distnce Numer of 16s rrna-sed V2-V4 tg sequences LF MF PUFA Supplementry Figure 1. High-ft diets decrese the richness nd diversity
More informationThe Effects of Small Sized Rice Bowl on Carbohydrate Intake and Dietary Patterns in Women with Type 2 Diabetes
Originl Article doi: 10.4093/kdj.2010.34.3.166 pissn 1976-9180 eissn 2093-2650 The Effects of Smll Sized Rice Bowl on Crbohydrte Intke nd Dietry Ptterns in Women with Type 2 Dibetes Hee-Jung Ahn 1, *,
More informationMETHOD 4010 SCREENING FOR PENTACHLOROPHENOL BY IMMUNOASSAY
METHOD 4010 SCREENING FOR PENTACHLOROPHENOL BY IMMUNOASSAY 1.0 SCOPE AND APPLICATION 1.1 Method 4010 is procedure for screening solids such s soils, sludges, nd queous medi such s wste wter nd lechtes
More informationEffect of environmental stress on biochemical and physiological features in cultured fish
Effect of environmentl stress on biochemicl nd physiologicl fetures in cultured fish Toshiki Nkno, Toshiysu Ymguchi, nd Yoshihiro Ochii Grd. Sch. Agric. Sci., Tohoku Univ., Sendi, Jpn Fmous Smuri Mr. Msmune
More informationDendritic cells engineered to secrete anti-dcr3 antibody augment cytotoxic T lymphocyte response against pancreatic cancer in vitro
Submit Mnuscript: http://www.wjgnet.com/esps/ Help Desk: http://www.wjgnet.com/esps/helpdesk.spx DOI: 10.3748/wjg.v23.i5.817 World J Gstroenterol 2017 Februry 7; 23(5): 817-829 ISSN 1007-9327 (print) ISSN
More informationSUPPLEMENTARY INFORMATION
SUPPLEMEARY IFORMAIO doi:./nture correction to Supplementry Informtion Adenom-linked rrier defects nd microil products drive IL-/IL-7-medited tumour growth Sergei I. Grivennikov, Kepeng Wng, Dniel Mucid,
More informationEffects of physical exercise on working memory and prefrontal cortex function in post-stroke patients
Effects of physicl exercise on working memory nd prefrontl cortex function in post-stroke ptients M Moriy, C Aoki, K Sktni Grdute School of Helth Sciences Reserch, Mjor of Physicl Therpy, TeikyoHeisei
More information