FGF21 Resistance in Adipose Tissues as a Cause of Insulin Resistance

Transcription

1 Resistance in Adipose Tissues as a Cause of Insulin Resistance The ICDM 213 & 5 th AASD Scientific Meeting Seoul, Korea, Nov 8, 213 Aimin Xu Dept of Medicine & Dept of Pharmacology and Pharmacy The University of Hong Kong

2 Our research focus: Adipokines and hepatokines in obesity-related cardiometabolic syndrome White Adipose Tissue Adipokines (adiponectin, A-FABP, LCN2 ) Liver Hepatokines (, MUP1) Pancreas Brain Skeletal muscle Blood vessel

3 Adipokines characterized in our laboratory A-FABP (Xu A, et al, Clin Chem, 26) (Xu &Tso et al, Circulation, 27) (Tso & Xu et al, Diabetes Care, 27) (Yeung D et al, ATVB, 27) Yeung D et al, Euro Heart J, 28) Hui X, JBC, 21, Neurology, 211) Hoo R, J Hepatology, 212, Lipocalin-2 (Wang Y et al, Clin Chem, 27) (Law I, Diabetes, 21) JBC, 212; Liu Y, BJP, 212 Adipose tissue Adiponectin (Xu A et al, J. Clin. Invest, 23, Wang et al, JBC 22, 24, 25, 26 Cancer Res, 26, Chow WS et al, Hypertension, 26; Cheng K et al, Diabetes, 27, Hoo R, et al. ATVB, 27, Liu M, PNAS, 28, Hepatology, 28, Cell Metabolism, 29, 211 Diabetes, 29, 21, 211, 212, Cell Metabolism, 211, PNAS, 212 Zhang X, Diabetes, 28; Diabetes, 21; Chen C; Diabetes Care, 211; Yu H, Clin. Chem. 211; Chen W, JBC, 211; Ge X, JBC, 211; Xiang Y, JECM, 211 ; Li H, Diabetes, 212; J Hepatology, 212; Ong L, JCEM, 212; Lin ZF, Cell Metabolism, 213

4 as a metabolic regulator 29aa N 28aa 181aa C It is secreted mainly from the liver. Its major target is adipose tissue. Liver Administration of recombinant acutely decreases blood glucose to a normal level in both rodents and monkeys with diabetes. It does not have mitogenic activities. Adipose tissue

5 Multiple beneficial effects of recombinant in animals

6 Adipose tissue as a major action site of FGF2 Liver Adipose tissue

7 Multiple effects of in adipocytes Adipocyte P ERK1/2??? FGFR β-klotho?? AMPK SIRT1 SRF SRF Elk-1 Glut1 transcription GLUT1 Lipolysis Glucose uptake PPARγ PGC1α UCP1 Heat dissipation Chow WS, 212

8 induces glucose uptake by inducing the expression of GLUT1 in adipocytes (Ge X, J Biol. Chem. 211, 286: ) FGFR β-klotho P ERK1/2 P RSK P ERK1/2 P RSK Glut1 promoter P Elk1 P CAGGAAGCACTTCCTTTAAAGG Ets consensus binding motif SRF SRE consensus binding motif Glucose uptake P SRF Glut1 transcription

9 fine-tunes growth hormone-induced lipolysis in adipocytes Pituitary Fasting GH Negative feedback Adipose tissue Lipolysis FFA PPAR-α Liver Chen W, et al, J Biol Chem ;286(4):

10 Regulates PGC-1α and Browning of White Adipose Tissues Cold or β3-adrenergic Stimuli Promoter PGC-1α (PTM Level) UCP1 Production Thermogenesis Transdifferentiation

11 Adipocytes play an obligatory role in mediating the metabolic actions of 1. Cell Metab. 212 Sep 5;16(3): PLoS One. 212;7(7):e Molecular Metabolism, Available online 27 August 212.

12 How does exert its profound effects on systemic insulin sensitivity and glucose homeostasis via its actions in adipocytes?? Adiponectin as a mediator?

13 Adiponectin, an insulin sensitizing adipokine predominantly produced from adipocytes (LMW) (MMW) HMW: High molecular weight Wang Y et al, JBC, 22, JBC, 24, JBC, 26, JBC, 28, Proteomics, 25, 26; Richards AA, Mol. Endocrinol, 21, Wang Y, Biochem J, 28 (Review), JMB, 29

14 Multiple protective effects of adiponectin against a cluster of obesity-related disorders Insulin sensitivity Hypertension Myocardial infarction Cardiomyopathy Atherosclerosis Fatty liver, NASH fibrosis (Xu A, JCI, 23) (Ding X, Am J Path, 25) Zhou M, Hepatology, 28 and 211) Obesity-related asthma (Shore S, J Allergy Clin Immunol. 26) Vascular protection (Cheng K, Diabetes,27) (Chang J, Diabetes, 21) (Wang Y, Diabetes, 211) (Wong J, Cell Metabolism, 211) Inflammation (Fayad R, Gastroenterology. 27) Hoo R, ATVB, 28) Dyslipidemia (Xu A, Endocrinology,25) Obesity-related cancers (Wang Y, Cancer Res, 27 and Cell Res, 29, Liu J, Carcinogenesis, 211)

15 Fold change of Adiponectin levels Adiponectin mrna(au) induces both expression and secretion of adiponectin in mouse adipocytes A B 3 2 Vehicle 2.5 Vehicle Times(hours) Times(hours) Lin ZF, Cell Metabolism, 213: 7;17:

16 Percentage of adiponectin secreted into Medium enhances adiponectin secretion in A Pulse-chase experiment with 35 S methionine Vehicle CL CM CL CM mouse adipocytes Chase times(hours) B Percentage of adiponectin released 1 Vehicle Times (hours) CL: Cell lysates; CM: Conditioned medium

17 PPARr agonists increase adiponectin expression and secretion Liu M, PNAS, 28 Reviewed by Wang Y, Biochem J, 28

18 Adiponectin(ng/ml) Adiponectin mrna(au) Adiponectin(ng/ml) Adiponectin mrna(au) Suppression of PPARγ attenuates -induced expression and secretion of adiponectin A 6 B GW9662 C Vehicle GW D Vehicle GW9662: PPARr antagonist PPAR (+/+) PPAR (+/-). PPAR (+/+) PPAR (+/-)

19 Fold changes(au) Fold changes(au) induces the expression of molecular chaperones involved in adiponectin secretion Ero1-Lα DsbA-L β-actin GW Ero1-Lα DsbA-L β-actin PPARγ Ero1-L Vehicle GW9662 DsbA-L +GW9662 Ero1-L PPAR (+/+)+Vehicle PPAR (+/-)+Vehicle DsbA-L PPAR (+/+)+ PPAR (+/-)+ p<.5; p<.1. n=5-6

20 Adiponectin(ng/ml) Adiponectin mrna(au) Adiponectin (ng/ml) acts in an autocrine manner to induce adiponectin production in adipocytes A Vehicle Rosiglitazone C 5 4 B WT KO Vehicle Rosiglitazone Rosi anti-fgf21 IgG nonimmnue IgG WT KO p<.5; p<.1. n=5 in each group

21 Adiponectin( g/ml) Absorbance at 28nm Adiponectin( g/ml) (pg/ml) induces adiponectin production in mice A 4 WT KO B 1 Vehicle (.5mg/kg.day) C Chow HFD Chow HFD 4 weeks 35 weeks 4 Vehicle 3 2 D Times(weeks) HMW Hexamer Trimer Vehicle Times(weeks) Elution times(min)

22 Triglycerides(mmol/l) perk1/2 /Erk1/2 Glucose(mmol/l) Insulin(ng/ml) The acute metabolic benefits of are abrogated in adiponectin-deficient mice with dietary obesity A B C Times (min) 6 Times (min) 12 WT+Vehicle ADN(-/-)+Vehicle WT+ ADN(-/-)+ D 6 12 Times (min) p-erk1/2 Erk1/ WT ADN(-/-)

23 The beneficial Effects of on glucose metabolism and insulin sensitivity are impaired in adiponectin KO mice Glucose(mmol/l) Glucose(mmol/l) Glucose(mmol/l) Glucose(mmol/l) Vehicle WT Vehicle ADN(-/-) Times (min) Times (min) WT Vehicle ADN(-/-) Vehicle Times(min) Times(min) Lin ZF, Cell Metabolism, 213: 7;17:

24 Phosphorylation levels Phosphorylation levels The insulin-sensitizing effects of in the liver are mediated by adiponectin A WT B ADN(-/-) p-akt Akt p-gsk3β GSK3β Insulin p-akt Akt p-gsk3β GSK3β Insulin p-akt/akt p-gsk3 /GSK p-akt/akt p-gsk3 /GSK Insulin Insulin p<.5; p<.1. n=5 in each group

25 ALT(U/L) mrna abundance(au) Adiponectin is required for -mediated alleviation of fatty liver disease in obese mice A STC HFD HFD+ WT ADN(-/-) B C TNF MCP STC HFD STC HFD STC HFD p<.5; p<.1. n=6 in each group

26 TG(mg/g tissue) TG(mg/g tissue) Adiponectin is obligatory for -mediated reduction of HFD-induced lipid accumulation in skeletal muscle Vehicle Vehicle Vehicle Vehicle Soleus Gastrocnemius

27 Phosphorylation levels Phosphorylation levels The insulin-sensitizing effects of in skeletal muscle are dependent on adiponectin A WT B ADNKO p-akt p-akt Akt p-gsk3β Akt p-gsk3β 6 4 GSK3β Insulin p-akt/akt p-gsk3 /GSK3 GSK3β Insulin p-akt/akt p-gsk3 /GSK Insulin Insulin p<.5; p<.1

28 Adiponectin confers the metabolic actions of in the liver and skeletal muscle Adipocytes PPARγ (+) APN mrna Ero1-Lα DsbA-L APN (+)? βklotho FGFR Secretion (+) Blood vessel Insulin Sensitivity (+) Lipid accumulation (-) Muscle Insulin Sensitivity (+) Lipid accumulation (-) Liver Lin ZF, Cell Metabolism, 213: 7;17:779-8

29 Log Visceral fat (%) Serum levels (ng/l) BMI (kg/m 2 ) Human Serum levels are significantly elevated in overweight/obese subjects N=15 N=127 N=232 r² =.229, p<.1 Lean Overweight/obese Log Serum levels r² =.24, P <.1 N=217 Log Serum levels Zhang, X., et al. Diabetes 28 Giannini C et al., J Clin Endocrinol Metab. 213

30 Elevated circulating is associated with a cluster of obesity-related complications Coronary heart disease Lin, Z., et al. PLoS ONE 21 Atherosclerosis Chow WS, et al. ATVB. 213 Diabetes Chen, C., et al. Diabetes Care 211 Yang, M., et al. PLoS ONE 211 Serum Metabolic syndrome Zhang, X., et al. Diabetes 28 Reinehr, T. et al. JCEM 212 Obesity Zhang, X., et al. Diabetes 28 Reinehr, T. et al. JCEM 212 NAFLD Li, H., et al. J Hepatol 21 Dushay, J., et al. Gastroenterology 21 Diabetic Nephropathy Jian, W.X., et al. Metabolism 212

31 Zhang X, et al. Diabetes 28; Fisher FM, et al. Diabetes 21; Hale C, et al. Endocrinology 212 Elevated production in obese animals Tissue Genetic-induced obesity Diet-induced obesity Liver Epid Serum Resistance??

32 Impaired actions of in ob/ob obese mice Fasting glucose and free fatty acid Glucose clamping Berglund ED et al., Endocrinology. 29 ; Fisher FM, et al. Diabetes 21

33 Glucose level (fold change) Glucose level (fold change) Glucose level (fold change) Glucose level (fold change) The glucose-lowering effects of are progressively decreased in High Fat High Cholesterol (HFHC) diet-induced obese mice weeks 8 weeks STC- HFHC- min 3 mins 6 mins 12 mins STC- HFHC- min 3 mins 6 mins 12 mins weeks STC- HFHC weeks STC- HFHC-.5 min 3 mins 6 mins 12 mins.5 min 3 mins 6 mins 12 mins

34 A progress development of resistance during diet-induced obesity Serum triglyceride levels (fold changes) weeks 2 weeks 12 weeks 8 weeks 4 weeks Baseline HFHC diet induction.5 min 3 mins 6 mins 12 mins Time after injection : 1 mg/kg; n=5

35 The ability of recombinant (rm) to increase circulating adiponectin is progressively impaired in diet-induced obesity Serum adiponectin (ug/ml) 2 18 saline 16 rm week 8 week 12 week 24 week High fat high cholesterol diet

36 -induced signal transduction pathways in adipose tissues are impaired in obesity lean obese Ge X, et al. J Biol Chem 211; Fisher FM, et al. Diabetes 21

37 Mechanisms of resistance? Adipocyte P ERK1/2??? FGFR β-klotho?? AMPK SIRT1 SRF SRF Elk-1 Glut1 transcription GLUT1 Lipolysis Glucose uptake PPARγ PGC1α UCP1 Heat dissipation Chow WS, 212

38 A marked down-regulation of β-klotho and FGFR1 in different fat depots in obese mice PVAT BAT Epididylmal β- klotho FGFR1 STC HFHC STC HFHC STC HFHC STC HFHC STC HFHC STC HFHC HFHC: High fat high cholesterol diet

39 A marked down-regulation of β-klotho and FGFR1 in different fat depots in obese mice PVAT BAT STC HFHC STC HFHC β-klotho FGFR1

40 How does obesity cause reduced β-klotho and FGFR1 expression?

41 Involvement of TNFα-JNK pathway in modulating β-klotho expression??? Díaz-Delfín J, et al. Endocrinology. 212

42 Obesity Adipocyte??? TNFα FGFR1 β-klotho Glucose uptake JNK activation

43 resistance as a cause of systemic insulin resistance Adipocytes FGFR1c Autocrine APN βklotho Obesity Secretion Endorcine Blood vessel Muscle Insulin Sensitivity Insulin Sensitivity Liver Systemic Insulin resistance

44 HKU team Acknowledgement Prof. Karen Lam Kyoto University Prof. Nobuyuki Itoh & Dr. Yuhei Hotta Xiangya 2 nd Hospital, Hunan Prof. Zhi-guang Zhou Shanghai Diabetes Center, Jiao Tong University Prof. Jia Weiping, Dr. Li Huating

45