Fasting induces a subcutaneous-to-visceral fat switch mediated by microrna-149-3p and suppression of PRDM16
|
|
- Clifton Lambert
- 5 years ago
- Views:
Transcription
1 Reeived Ot Aepted 6 Apr 6 Published May 6 DOI:.8/nomms OPEN indues a subutaneous-to-viseral fat swith mediated by mirorna-9-p and suppression of PRDM6 Hanyin Din,, Shasha Zhen,, Daniel Garia-Ruiz, Donxia Hou, Zhe Wei, Zhion Liao, Limin Li, Yujin Zhan, Xiao Han,KeZen, Chen-Yu Zhan, Jin Li & Xiaohon Jian Viseral adiposity is stronly assoiated with metaboli disease risk, whereas subutaneous adiposity is omparatively benin. However, their relative physioloial importane in enery homeostasis remains unlear. Here, we show that after -h fastin, the subutaneous adipose tissue of mie aquires key properties of viseral fat. Durin this fast-indued viseralization, upreulation of mir-9-p diretly tarets PR domain ontainin 6 (PRDM6), a key oreulatory protein required for the brownin of white fat. In ultured inuinal preadipoytes, overexpression of mir-9-p promotes a viseral-like swith durin ell differentiation. Mie defiient in mir-9-p display an inrease in whole-body enery expenditure, with enhaned thermoenesis of inuinal fat. However, a viseral-like adipose phenotype is observed in inuinal depots overexpressin mir-9-p. These results indiate that in addition to the apaity of brownin to defend aainst hypothermia durin old exposure, the subutaneous adipose depot is also apable of whitenin to preserve enery durin fastin, presumably to maintain enery balane, via mir-9-p-mediated reulation of PRDM6. State Key Laboratory of Pharmaeutial Biotehnoloy, Collaborative Innovation Center of Chemistry for Life Sienes, Jiansu Enineerin Researh Center for MiroRNA Bioloy and Biotehnoloy, NJU Advaned Institute for Life Sienes (NAILS), Shool of life sienes, Nanjin University, 6 Xianlin Road, Nanjin, Jiansu 6, China. Key Laboratory of Human Funtional Genomis of Jiansu Provine, Nanjin Medial University, Hanzhon Road, Nanjin 9, China. These authors ontributed equally to this work. Correspondene and requests for materials should be addressed to C.-Y.Z. ( yzhan@nju.edu.n) or to J.L. ( jinli@nju.edu.n) or to X.J. ( xiaohonjian@nju.edu.n). NATURE COMMUNICATIONS 7: DOI:.8/nomms
2 NATURE COMMUNICATIONS DOI:.8/nomms Adipoytes have been studied with inreasin intensity due to the onset of the obesity epidemi. Traditionally, adipose tissues have been divided into two types: white adipose tissue (WAT), best known for storin exess enery in the form of trilyerides, and brown adipose tissue (BAT), whih oxidizes hemial enery to produe heat to protet aainst hypothermia and obesity. Most mammals have stereotypial adipose depots loated throuhout the body. Classial BAT is typially loated in the intersapular reion in human infants and small mammals. WAT enerally develops in distint intra-abdominal (viseral) depots and in the subutaneous layer. Sientists have reonized that the distribution of fat is losely linked to metaboli disease risk 6. In partiular, the aumulation of viseral WAT is stronly orrelated with an inreased risk of metaboli dysfuntion and ardiovasular disease 7 9. By ontrast, the expansion of subutaneous adiposity shows little or even an inverse orrelation with disease risk,. Transplantation of subutaneous depots, but not viseral fat, into the abdomen of mie leads to improved whole-body metabolism,. These diverent metaboli effets of different adipose depots have raised interest in the unique properties of viseral and subutaneous fat. Reently, it has beome lear that subutaneous and viseral WAT have unique ene expression sinatures. Moreover, subutaneous fat possesses substantial thermoeni apaity in response to old stimulation ompared with viseral depots. A lare aumulation of brown-like ells (termed beie/brite ells) durin old exposure is most prominent in the subutaneous inuinal depot, whereas viseral adipoytes are less suseptible to brownin. The developmental and transriptional ontrol of beie ells have reeived muh attention, mainly beause of their potential roles in the defene aainst obesity and assoiated disorders. As an interator of enery homeostasis, many basi physioloial funtions provided by adipose tissue have been overlooked beause of their assoiation with obesity. Cold and huner were probably the baseline states in humans over a substantial portion of evolutionary time. Therefore, the lipid-burnin brown/beie adipoytes are speialized to maintain body temperature by produin heat in a old environment, whereas the lipid-storin white adipoytes are adapted to ope with food shortae 6. The old-indued emerene of brown-like adipoytes in subutaneous WAT suests that ertain adipose proesses are extraordinarily plasti in response to hanes in environmental ues 7,8. is defined as a oordinated set of metaboli hanes that spare arbohydrate usae and inrease reliane on fat as the enery supply 9. Althouh several studies have reported that mobilization of the subutaneous depot appears to be less than that of viseral fat durin starvation, an important hallene is to understand the moleular mehanisms by whih physioloial hanes reulate these different white adipose depots. PR domain ontainin 6 (PRDM6) is a zin-finer protein that funtions as a bidiretional ell fate swith between skeletal myoblasts and promotes BAT differentiation,. In addition, etopi expression of PRDM6 in adipoytes stronly indues the thermoeni proramme in subutaneous depots but not in viseral fat. Notably, PRDM6 mrna and protein levels are depot dependent, likely due to differential stability of the PRDM6 protein in subutaneous and viseral depots,. Sinifiant attention has been foused on the role of mirornas (mirnas) in adipoyte funtion. In partiular, several mirnas have a preferential effet on brown and beie ell differentiation and funtion, inludin some that taret PRDM6 (refs ). Here, we report that, after h of food deprivation, subutaneous inuinal WAT (inwat) takes on many of the morpholoial and moleular harateristis of viseral fat to preserve enery via mir-9-p-mediated suppression of PRDM6. These data unravel the ritial role of subutaneous WAT in reulatin the enery balane throuh mirna-mediated reulation of PRDM6. Results mobilizes more viseral fat than subutaneous depot. The early staes of fastin last for up to h as the body adjusts to the absene of nutrient inestion 9. Therefore, we tested the relevant metaboli parameters in mie fed ad libitum or fasted for h. Dereased CO prodution resulted in a markedly redued respiratory exhane ratio (RER) in male mie, indiatin that -h fastin stimulated a substantial shift from arbohydrate to fat-based fuel (Fi. a ). for h sinifiantly redued the body weiht of both male and female mie (Fi. d; Table ). Six adipose depots, inludin intersapular BAT (BAT); three representative viseral WATs, -retroperitoneal (-RP), -mesenteri (--mes) and epididymal (-epi, male)/periovarian (-PO, female) WAT; and two major subutaneous WATs, -inuinal (-in) and anterior (-Ant) WAT, were olleted from male and female mie. Althouh a trend towards dereased weiht was observed in the examined male and female depots, the weiht of the BAT was mainly unhaned in fasted mie (Fi. e; Table ). Compared with the subutaneous depot, whih exhibited a moderate redution in weiht, the weiht of the viseral depots was sinifiantly dereased in both male and female mie. Gonadal fat (- for males, -PO for females) was dereased by B% in mie, and reater than % fat loss was observed in the mesenteri depot, whih also exists in larer mammals inlude humans (Fi. f h; Table ). These results indiate that the mobilization of subutaneous and viseral fat pads durin fastin was different in male and female mie. To investiate possible depot-speifi responses in fasted mie, lipoeni-related enes were measured. The mrna levels of Ppar (peroxisome proliferator-ativated reeptor ) and Srebp (sterol reulatory element bindin protein ), two main lipoeni transription fators, were sinifiantly dereased in the epiwat and meswat of fasted mie. Strikinly, twofold upreulation of Ppar and a sliht inrease in Srebp mrna levels were observed in the inwat of fasted mie (Fi. i,j). also dereased the mrna levels of fatty aid synthesis-related enes in the epiwat and meswat, inludin Lpl (lipoprotein lipase), Fas (fatty aid synthesis) and Glut (luose transporter type ); however, these enes were not sinifiantly altered in the inwat (Fi. k m). Moreover, the mrna levels of Cpt (arnitine palmitoyltransferase ), Aox (ayl-oenzyme A oxidase ) and Asl (Ayl-CoA synthetase lon-hain ), three lipolysis enes involved in fatty aid oxidation, were markedly inreased in fasted epiwat and meswat, whereas the same set of enes showed a tendeny towards a redution in inwat (Fi. n-p). Similar depot-speifi responses were observed in female fasted mie (Supplementary Fi. a h). These results suest that -h fastin triered differential responses amon adipose tissues in male and female mie. Speifially, the preferential mobilization of lipids in response to fastin was observed in the more internally loated viseral WAT ompared with the relatively externally loated subutaneous inwat. drives viseral-like phenotype swithes in inwat. We next tested whether -h fastin also influened the morpholoies of different adipose tissues. A small proportion of multiloular brown-fat-like ells mixed with reions of uniloular fat ells were readily observed in the subutaneous inwat of male C7BL/6J mie that were maintained at ambient temperature NATURE COMMUNICATIONS 7: DOI:.8/nomms
3 NATURE COMMUNICATIONS DOI:.8/nomms a b VO (ml k h ) 8, 6,,, O onsumption VCO (ml k h ) 8, 6,,...9.8, CO prodution Respiratory exhane ratio.7.6 RER d i Body weiht () ln Ant Ppar γ Srebp Lpl Fas e f h Brown adipose tissue mass () j... SubQ adipose tissue mass () Viseral adipose tissue mass ().. k.. RP l... adipose mass (% of ontrol). Ant RP m.. Glut Cpt Aox Asl... ln n ln o... ln p ln Fiure indues depot-speifi mobilization of lipids in different adipose tissues. (a ) O onsumption (a), CO prodution rates (b) and the respiratory exhane ratio (RER) () were measured by indiret alorimetry from ad libitum fed or h-fasted male mie (n ¼ 6). (d h) Male mie (n ¼ 8) were fed ad libitum or fasted for h (n ¼ 8). Body weiht (d), weiht of brown fat mass (e), subutaneous fat mass (f), viseral fat mass (). Dereased ratios of subutaneous and viseral fat mass (h). (i p) Expression of lipoeni and lipolyti enes in epididymal, mesenteri and inuinal depots from ad libitum fed or h-fasted mie (n ¼ 8). The same amount of RNA was used for reverse transription followed by real-time PCR. Gene expression was normalized to housekeepin ene Gapdh. Relative levels of the lipoeni enes Ppar (i), Srebp (j), Lpl (k), Fas (l), Glut (m), and the lipolyti enes Cpt (n), Aox (o), Asl (p) are shown (n ¼ 8). Ant, anterior;, epididymal;, inuinal;, mesenteri; RER, respiratory exhane ratio; RP, -retroperitoneal; SubQ, subutaneous. The data represent the mean±s.e.m. Po.; Po.; (Student s t-test). ( C). Therefore, we examined the effets of two potent fat stimuli in mie: -h old exposure ( C) a physioloial stimulator of subutaneous fat brownin and -h fastin. Cold exposure resulted in inreased lusters of multiloular brown fatlike areas and dereased uniloular white reions in the inwat. However, fastin led to a sinifiant derease in multiloular brown fat-like areas alon with inreased uniloular white reions, suestin that a viseral-like swith miht our in inwat (Fi. a). Althouh the -h fast did not influene the morpholoy of BAT (multiloular) or epiwat (uniloular), a tendeny towards redued ell size was observed in the fasted epiwat (Fi. d; Supplementary Fi. a). Next, we used flow ytometry to measure the hanes in ell size and number in inwat/epiwat after a -h fast. For the inwat, old exposure indued an inrease in the proportion of smaller adipoytes (FSC-H shift to the left). Conversely, a sharp derease in smaller adipoytes was observed in the fasted inwat (FSC-H shift to the riht); however, the size of the uniloular adipoytes was relatively stable (Fi. b). The vanishin of the smaller adipoytes miht aount for the moderate weiht loss observed for the fasted inwat, whih resulted in dereased adipoyte numbers alon with an inreased proportion of uniloular NATURE COMMUNICATIONS 7: DOI:.8/nomms
4 NATURE COMMUNICATIONS DOI:.8/nomms Table Weiht-related parameters of female mie. Ad libitum h of fastin Body weiht at sarifie () 6.8±.7.±.9 Food intake ().7±. None BAT ().±..±.8 (k9% versus ad libitum) SubQ inwat ().6±..9±.9 (k9% versus ad libitum) SubQ antwat ().±..9±.8 (k% versus ad libitum) VISC POWAT ().6±..96±.9 (k% versus ad libitum) VISC RPWAT ().±..±. (k% versus ad libitum) VISC meswat().±..±. (k6% versus ad libitum) ant, anterior; BAT, brown adipose tissue; in, inuinal; mes, mesenteri; PO, periovarian; RP, -retroperitoneal; SubQ, subutaneous; VISC, viseral. Weiht of brown adipose tissue (BAT) and subutaneous inuinal, subutaneous anterior, viseral periovarian and viseral retroperitoneal white adipose tissue (inwat, antwat, POWAT and RPWAT, respetively) in C7BL/6J female mie fed ad libitum or fasted for h. The perentae derease in weiht of fat depots after h of fastin is indiated. The data represent the mean±s.e.m. Po.; Po.; (Student s t-test). adipoytes in inwat (Fi. ). For epiwat, h of old exposure yielded no sinifiant alteration of adipoyte size or number. However, the historam showed that -h fastin aused a moderate derease in epididymal ell size, whih is onsistent with the histoloial analysis (Fi. d,e). Moreover, the number of epididymal adipoytes was markedly dereased (Fi. f). Therefore, the dereased ell volume and the sinifiantly dereased ell number presumably aount for the marked weiht loss in the epiwat. We also quantified the major myeloid and lymphoid subsets in the inwat of different roups of mie 6. Compared with ontrol animals, inwat from old-exposed mie exhibited a % derease in the number of CDb þ F/8 þ marophaes, whereas inwat from fasted mie exhibited a % inrease (Fi. ). These alterations were restrited to subutaneous inwat beause no differenes were observed in viseral epiwat or BAT (Fi. ; Supplementary Fi. b). These data onfirm previous observations of a viseral-like phenotype in the fasted inwat. Thus, two sets of marker enes were analysed in inwat and epiwat from old-exposed mie and fasted mie, inludin lassial WAT-seletive enes and newly identified viseral sinature enes by Cohen et al. 6. The lassi WAT-seletive enes, inludin Serpinak (serine peptidase inhibitor, lade A, member k), Resistin, Anxa (annexin A), Endra (endothelin reeptor type A), Psat (phosphoserine aminotransferase) and Wdnm (WDNM-like protein), were markedly inreased in the fasted inwat. Moreover, the newly identified viseral sinature enes,6, whih inlude two transription fators (Wt (Wilms tumour ) and Bn (basonulin )) and several proinflammatory enes (Saa (serum amyloid A), At (aniotensinoen), Opn (osteoproteerin) and Raldh (retinaldehyde dehydroenase )) were also sinifiantly upreulated in the fasted inwat. However, both sets of enes were expressed at redued levels in the old-exposed inwat. Neither old exposure nor fastin influened the expression of the eneral adipoeni markers ap (adipoyte protein ) and AdipoQ (adiponetin CQ and ollaen domain ontainin) (Fi. h). These results onfirmed that a viseral-like swith ourred at the moleular level in the fasted inwat. We also tested these representative WAT/viseral-seletive enes in BAT and viseral WAT (epiwat and meswat). Neither the lassi WAT-seletive nor the viseral sinature enes were sinifiantly altered in these adipose tissues (Fi. i; Supplementary Fi. ). These results were also onfirmed in female mie, indiatin that fastin an drive a subutaneous-to-viseral-like swith at both the morpholoial and moleular levels (Fi. j; Supplementary Fi. d). suppresses inwat thermoenesis by inhibitin PRDM6. A definin feature of subutaneous inwat is its relatively abundant mitohondria and assoiated hiher apaity for thermoenesis ompared with viseral WAT (Supplementary Fi. a). Representative eletron miroraphs showed that old exposure elevated the number of mitohondria in the inwat of mie, whereas fastin resulted in a marked derease in the number of mitohondria (Fi. a,b). We next used O onsumption as a readout to assess the physioloial effets of old exposure and fastin on adipose tissue. The O onsumption of the inwat inreased twofold in old-exposed mie but dereased about % in fasted mie ompared with ontrol mie. The O onsumption in the epiwat and meswat was below the limit of detetion, and no sinifiant alteration was observed in BAT (Fi. ; Supplementary Fi. b). The mrna levels of mitohondrial oxidation assoiated enes (P-a (peroxisome proliferator-ativated reeptor amma, oativator a), Cox7a (ytohrome oxidase subunit 7a), Cox8b (ytohrome oxidase subunit 8b), Cy (ytohrome ) and Dio (type II iodothyronine deiodinase)), BAT-seletive enes (Up(unouplin protein ), Cidea (ell death-induin DNA framentation fator, alpha subunit-like effetor a), Elovl6 (elovl fatty aid elonase 6) and Ppara (peroxisome proliferator ativator reeptora) and beiesinature enes (Cd7(tumour nerosis fator reeptor superfamily, member 9), Tmem6 (transmembrane protein 6) and Tbx (T-box )), whih are losely related to the thermoeni apaity, were profoundly dereased in the fasted inwat, suestin that a sinifiant funtional viseral-like swith ourred in the fasted inwat (Fi. d,e). Considerin that the whole-body swithes to a thrifty mode to redue enery expenditure durin fastin, mitohondrial and BAT-seletive enes were also slihtly dereased in both BAT and viseral WAT (epiwat/meswat) (Fi. d; Supplementary Fi. ). Immunohistohemial analysis revealed that a ertain amount of UCP was readily observed in the inwat of ontrol mie, whereas UCP was almost undetetable in the fasted inwat (Fi. f h). Beause old exposure is learly different from fastin, we also performed similar sets of experiments on mie exposed to old ombined with fastin for h. When mie were exposed to old, the -h fast did not effiiently indue morpholoial, moleular or funtional viseralization of inwat, indiatin that old diminished the effet of fastin on viseral swithin (Supplementary Fi. d h). Emerin evidene suests fasinatin effets of intermittent fastin 7. Therefore, we performed intermittent fastin on mie, by alternatin -h yles of fastin and ad libitum feedin. The viseral fats dereased, whih miht aount for the observation of a sliht derease in body weiht (Supplementary Fi. i,k). This alternate day-fastin (ADF) also markedly inreased the expressions of mitohondrial bioenesis enes in the epiwat of the mie (Supplementary Fi. l). Notably, unlike viseral fat, both the dereased weiht and the impaired mitohondrial bioenesis were restored in subutaneous depots by -h refeedin, suestin that the viseralization of NATURE COMMUNICATIONS 7: DOI:.8/nomms
5 NATURE COMMUNICATIONS DOI:.8/nomms a H&E C b Historam 8 6 C 6 8 k FSC-H ell size 6 8 k FSC-H Cell number ( 7 ) per tissue C d i %CDb + F/8 + (% of CD + ells) Relation mrna expression..... H&E C 8 6 Serpinak Resistin C Anxa Ednra Wt Bn Saa At h 6 Adiposeseletive ap AdipoQ Serpinak Resistin Anxa Ednra e Historam 8 6 Serpinak Resistin Wt C ell size 6 8 k 6 8 k FSC-H FSC-H White-seletive Bn Saa At Anxa Ednra Psat C Wdnm j Serpinak Resistin f Cell number ( 7 ) per tissue Female Anxa Ednra Wt VISC-sinature Wt Bn Saa At Opn Raldh C Bn Saa Raldh At Fiure drives viseral-like morpholoial and moleular phenotypes in inwat. (a) Representative imaes from haematoxylin and eosin (H&E) stained setions of inuinal adipose tissue. Sale bar, mm. (b) Historams showin ell size (FSC-) in inuinal adipose tissue from ad libitum fed ( ells per sample), h-fasted or h old-exposed ( C) male mie (n ¼ 8). () Absolute quantifiation of ell number in inuinal adipose tissue from the three roups of male mie (n ¼ 8). (d) Representative imaes from haematoxylin and eosin (H&E) stained setions of epididymal adipose tissue. Sale bar, mm. (e) Historams show ell size (FSC-) in epididymal adipose tissue from ad libitum fed ( ells per sample), -h fasted or -h old-exposed ( C) male mie (n ¼ 8). (f) Absolute quantifiation of ell number in epididymal adipose tissue from the roups of male mie (n ¼ 8). () Flow ytometri quantitation of CDb þ F/8 þ marophaes in inuinal, epididymal and mesenteri adipose tissue from ad libitum fed, -h fasted mie or -h old exposed ( C) male mie (n ¼ 6). (h) Normalized expression of eneral adipose marker enes, white fat-seletive enes, and viseral sinature enes in inuinal adipose tissue from ad libitum fed, h-fasted or h-old-exposed ( C) male mie (n ¼ 8). (i) Normalized expression of white-seletive and viseral sinature enes in epididymal and mesenteri adipose tissue from the three roups of male mie (n ¼ 8). (j) Normalized expression of white-seletive and viseral sinature enes in inuinal adipose tissues from ad libitum-fed or h-fasted female mie (n ¼ 8)., epididymal;, inuinal;, mesenteri; VISC, viseral. The data present the mean±s.e.m. Po.; Po.; (Student s t-test). C the inwat is an adaptive response to -h fastin-indued physioloial stress to maintain whole-body enery homeostasis (Supplementary Fi. j,l). These results onfirmed that ADF preferentially onsumes the metabolially harmful viseral fat, and that lon-term ADF miht benefit health 8. Intriuinly, the -h fast did not sinifiantly influene on the mrna level of Prdm6 (Fi. i). Strikinly, the protein level of PRDM6 dereased markedly in the fasted inwat of both male and female mie (Fi. j,k; Supplementary Fi. m,n). Beause PRDM6 is a ritial mediator of adaptive thermoenesis in subutaneous WAT, fastin miht suppress the thermoeni proramme in the inwat mainly by suppressin the protein level of PRDM6. The inonsisteny in mrna and protein levels stronly suests that a post-transriptional mehanism may funtion in the reulation of PRDM6. Beause the expression levels of Gapdh (lyeraldehyde--phosphate dehydroenase) and NATURE COMMUNICATIONS 7: DOI:.8/nomms
6 NATURE COMMUNICATIONS DOI:.8/nomms b,,.... ND... f h U C p id El ea o Pp vl6 ar α 8 6 Female kda PRDM6 kda kda 7 kda. kda trl C stin Fa trl C stin Fa GAPDH trl kda... trl C in st Fa C k.. Relative Prdm6 protein level Relative Prdm6 mrna expression j in st Fa BA T Ma rke r C Male trl i. Up+ sinal/ field ( μm) Beiesinature. BATseletive M Female Perentae of Up+ adipoytes. Male BATBeieseletive sinature es Ep C Tm d em 7 Tb 6 x P C α ox C 7a ox 8 Cb y D io P C α ox C 7a ox 8 Cb y D io P C α ox C 7a ox 8 Cb y D io i In e Male mitohondrial enes ND. rl C Ct stin Fa d C. μ O per min per m tissue C Mean mitohondrion number (per ell) U C p id El ea o Pp vl6 ar α C Tm d em 7 Tb 6 x a in st Fa Fiure indues a funtional viseral-like swith in inwat. (a) Transmission eletron mirosopy of inuinal adipose tissue in the three roups of mie. Sale bar, mm. (b) Mitohondrial numbers in inuinal adipose tissue setions from male mie (n ¼ ). () O onsumption in inuinal, epididymal and mesenteri white adipose tissue from the three roups of mie (n ¼ 6). (d) Normalized expression of mitohondrial omponent enes in inuinal, epididymal and mesenteri adipose tissue in fasted mie ompared with that in male ontrol mie (n ¼ 8). (e) Normalized thermoeni enes in inuinal adipose tissues from the ad libitum and h-fasted male and female mie (n ¼ 8). (f h) Quantifiation of UCP protein in inuinal subutaneous adipose tissue from ad libitum-fed and, -h-fasted male mie. (f) Representative imaes of setions from UCP immunohistohemistry. Sale bar, mm. () Quantifiation of UCP þ sinals per field (h), and perentae of UCP þ ells in setions (n ¼ ). (i k) Analysis of Prdm6 mrna (n ¼ 8) (i) and protein levels (j,k) in the inuinal adipose depots from ad libitum fed and h-fasted male mie. GAPDH was used as an internal ontrol. BAT; brown adipose tissue;, epididymal;, inuinal;, mesenteri. The data represent the mean±s.e.m. Po.; Po.; (Student s t-test). 6 NATURE COMMUNICATIONS 7: DOI:.8/nomms
7 NATURE COMMUNICATIONS DOI:.8/nomms 6b were stable in both fasted and old-exposed mouse samples (Supplementary Fi. o), the relative ene expression levels were obtained by normalization to Gapdh and onfirmed by 6b (Supplementary Fi. p). mir-9-p diretly taretin PRDM6 in subutaneous inwat. To investiate whether mirnas are involved in the reulation of PRDM6 in the inwat in response to different physioloial stimuli, we performed mirna miroarray analysis usin inwats from the old-exposed, -fasted and ontrol mie. Given that old exposure inreased the protein level of PRDM6 whereas fastin dereased its expression, mirnas with expression patterns opposite that of PRDM6 were seleted (Fi. a; Supplementary Fi. a,b). Usin two omputational alorithms TaretSan and miranda, mir-9-p, whih has a onserved taret site with the seed sequene in the UTR of the Prdm6 mrna, was seleted for further experimental verifiation. The onservation of the seed sequene suests bioloial relevane for these mirnas in the reulation of Prdm6 expression in humans (Fi.,d). Quantitative RT PCR (PCR with reverse transription) assays verified that old exposure sinifiantly dereased mir-9-p expression, whereas fastin resulted in a marked inrease in mir-9-p in both male and female mie. Of note, neither old nor fastin markedly haned the expression of mir-9-p in BAT or viseral (-epi, -mes) WAT (Fi. b). However, when mie were exposed to old, fastin failed to indue mir-9-p expression in inwat, and it subsequently led to a relatively stable level of PRDM6 protein (Supplementary Fi. a,b). Notably, the expression of reported myomir- was also analysed by quantitative RT PCR analysis. We onfirmed that old exposure dereased the level of mir-a in inwat, whereas fastin indued its expression, suestin that mir-a miht also play a role in inwat in response to hanes in physioloial onditions hane (Supplementary Fi. ). Beause myomir- has been reported to reulate brown fat differentiation throuh Prdm6, we foused on the role of the newly identified andidate mir-9-p in the followin study. Moreover, another mirna luster, mir-9b/6 (ref. ), whih has been reported to be reulated by PRDM6 in lassial brown fat, was not sinifiantly altered in BAT, inwat or epiwat when the mie were exposed to old or fastin (Supplementary Fi. d,e). We next performed luiferase assays to investiate the diret taretin of the Prdm6 -UTR by mir-9-p. Human embryoni kidney 9 T (HEK9T) ells transfeted with reporter plasmids ontainin the Prdm6 -UTR showed markedly dereased luiferase ativity in the presene of etopi mir-9-p. Mutation of the onserved seed sequene abroated the mirna-indued repression of the Prdm6 -UTR (Fi. e). We also knoked down the expression of Prdm6 in primary ultured inwat stromal-vasular (SV) ells usin a shrna expressed from an adenovirus. Adenoviral vetors expressin a ontrol srambled sequene or Prdm6 shrna (sh-prdm6) were used to infet sub-onfluent ultured SV ells from inwat, and these ells were transfeted with mir-9-p mimi when indued to undero adipoenesis days after adenovirus transdution. After days of differentiation, transfer of the mir-9-p mimi resulted in a sinifiant redution of the PRDM6 protein level in ontrol (srambled) ells alon with dereased Prdm6 mrna expression (Fi. f,; Supplementary Fi. f). Conversely, inhibition of the mirna usin an anti-mir-9-p olionuleotide markedly inreased the protein level of PRDM6 in ontrol ells. The mrna level of Prdm6 was larely unhaned in ells transfeted with the anti-mir-9-p, althouh a trend towards elevation was observed (Fi. h,i; Supplementary Fi. ). However, beause the levels of PRDM6 mrna and protein were both very effiiently dereased (reater than 7% redution) by the sh-prdm6 vetors in adipoytes, transfetion with neither the mir-9-p mimi nor the antimir-9-p olionuleotide sinifiantly altered the PRDM6 protein level (Fi.,i). These data suest that PRDM6 is a diret taret of mir-9-p in subutaneous inwat. As shown in Fi. j, beause mir-9-p has rarely been reported, we also measured its expression level in different mouse tissues. Inhibition of mir-9-p stimulates adipoytes brownin. To identify whether mir-9-p alters the funtion of subutaneous adipoytes, we isolated SV ells from the inwat of mie and indued their differentiation into beie adipoytes (Supplementary Fi. a). mir-9-p was sinifiantly downreulated durin differentiation (Fi. a). To mimi physioloial onditions, we used a relatively low dose of anti-mir to inhibit mirna expression (Fi. b). The inhibition of mir-9-p inreased the protein level of PRDM6 approximately sixfold at day six of differentiation, ompared with an approximately threefold inrease in ells treated with srambled anti-mir. mir- 9-p inhibition also aused sinifiant inreases in PGC-a and UCP protein levels ompared with ontrols (Fi. ; Supplementary Fi. b). Next, to examine whether mir-9-p alters the funtion of inuinal adipoytes to dissipate enery in a PRDM6-dependent manner, thermoeni enes in ontrol and PRDM6-defiient ells were measured in the presene or absene of mir-9-p. Inhibition of mir-9-p markedly inreased the set of brown-seletive enes Cox7a, Cox8b, Cidea and Evovl6. However, in PRDM6-defiient ells, these enes were not altered in the absene of mir-9-p, suestin that mir-9-p ats throuh PRDM6 (Fi. d ). Conversely, inhibition of mir-9-p dereased the mrna level of the viseral-seletive marker Wt in adipoytes, and it subsequently suppressed IL-6 and Resistin, two representative WAT-seletive sereted proteins in ulture medium (Fi. h j). Notably, mir- 9-p inhibition did not affet inuinal adipoyte differentiation per se (Supplementary Fi. ). The expression levels of three enes ommon to both white and brown fat ells, Ppar, ap and AdipoQ, were similar in the presene or absene of mir-9-p (Fi. k-m). Moreover, at day six of differentiation, the mrna levels of the fatty aid synthesis-related enes Lpl, Fas and Glut were sinifiantly repressed, whereas Cpta, Aox and Asl, three enes involved in fatty aid oxidation, were markedly inreased by mir-9-p inhibition (Fi. n). To further address the funtional properties, we performed real-time bioenereti kinetis on differentiated inuinal adipoytes. A hiher oxyen onsumption rate (OCR) from proton leakae and an inrease in the maximal respiratory apaity were observed in adipoytes after mir-9-p inhibition (Fi. o,p). These data demonstrate that depletion of mir-9-p durin inuinal adipoyte differentiation inreased mitohondrial ativity levels, whih is an important funtional harateristi of BAT. Beause mir-9-p is also expressed in viseral epiwat, to examine whether mir- 9-p plays a role in viseral fat ells, we isolated SV ells from the epiwat of mie and performed the same set of experiments. However, inhibition of mir-9-p did not alter the thermoeni proramme, lipoenesis/lipolysis or mitohondrial respiration of epididymal adipoytes, suestin that mir-9-p miht have tissue speifi roles (Fi. q; Supplementary Fi. d o). This is reasonable onsiderin that PRDM6 expression is muh lower in epiwat ompared with inwat. mir-9-p indues adipoytes viseral differentiation. To further investiate the funtions of mir-9-p in inuinal adipoytes, we overexpressed mir-9-p in inuinal preadipoytes NATURE COMMUNICATIONS 7: DOI:.8/nomms 7
8 NATURE COMMUNICATIONS DOI:.8/nomms (Fi. 6a). Durin differentiation, overexpression of mir-9-p dereased the protein levels of PRDM6, PGC-a and UCP ompared with ontrols, in addition to repressin the brown fat-seletive enes Cox7a and Cox8b (Fi. 6b; Supplementary Fi. 6a ). In ontrast, mir-9-p overexpression markedly inreased the viseral-seletive enes, Wt, Bn Raldh, At and Saa, in differentiated ells, as well as the sereted proteins IL-6 and Resistin in ultured medium, ompared with ells transfeted with ontrol-mir. However, in PRDM6-depleted ells, overexpression of mir-9-p failed to indue viseral-seletive a.. b Cold/ ad libitum /ad libitum mmu-mir-78 mmu-mir- mmu-mir-6 mmu-mir--p mmu-mir-9 mmu-mir- mmu-mir-96 mmu-mir-79 mmu-mir--star mmu-mir-a mmu-mir-a-star mmu-mir-77-star mmu-mir- mmu-mir-9a mmu-mir-86 mmu-mir-8-star mmu-mir-7b mmu-mir-6b mmu-mir-6a mmu-mir-a mmu-mir-7 mmu-mir-b mmu-mir-99a-p mmu-mir-9 mmu-mir-9 mmu-mir-89-p mmu-mir-6 mmu-mir-a mmu-mir-9 mmu-mir-6b mmu-mir- mmu-mir-6 mmu-mir-9 mmu-mir- mmu-mir- mmu-mir-9-p mmu-mir-b mmu-mir-a mmu-mir-a-p d Relative mir-9-p expression C C Male C BAT C Female e Perentae of luiferase ativity 8 6 '-UTR '-UTR mut Mimi-mir-9-p f Relative Prdm6 mrna level... Mimi sh-n+sramble sh-n+9 sh-prdm6+sramble sh-prdm6+9 PRDM6 GAPDH Mimi sh-n+sramble sh-n+9 sh-prdm6+sramble sh-prdm6+9 BAT Marker kda kda kda 7 kda kda Relative Prdm6 protein level... sh-n+sramble sh-n+9 sh-prdm6+sramble sh-prdm6+9 h Relative Prdm6 mrna level.... sh-n+sramble Anti sh-n+9 sh-prdm6+sramble sh-prdm6+9 i PRDM6 GAPDH Anti sh-n+sramble sh-n+9 sh-prdm6+sramble sh-prdm6+9 kda kda kda 7 kda kda Relative Prdm6 protein level.... sh-n+sramble sh-n+9 sh-prdm6+sramble sh-prdm6+9 j Relative expression BAT mirna-9-p Heart Liver Spleen Lun Kidney Musle 8 NATURE COMMUNICATIONS 7: DOI:.8/nomms
9 NATURE COMMUNICATIONS DOI:.8/nomms inflammatory ene expression (Fi. 6-i). Etopi mir-9-p expression did not influene the adipoyte differentiation per se (Fi. 6j l; Supplementary Fi. 6d). Moreover, inreased lipoenesis and dereased lipolysis were observed in ells overexpressin mir-9-p (Fi. 6m). Importantly, overexpression of mir-9- p led to a marked redution in mitohondrial respiration, indiatin a funtional hane in the differentiated inuinal adipoytes (Fi. 6n,o). Therefore, overexpression of mir-9-p aused an impaired thermoeni proramme alon with the aquisition of partial viseral-seletive harateristis durin the ourse of inuinal adipoyte differentiation. However, neither of these alterations were observed in epididymal adipoytes overexpressin mir-9-p (Supplementary Fi. 6f n). inwat inhibition of mir-9-p inreases mie thermoenesis. To identify the role of mir-9-p in a purely in vivo ontext, a lentiviral vetor expressin anti-mir-9-p was diretly introdued into the inuinal depot of mie. Speifially, 7 lentiviral transduin partiles (TU)/mouse lentiviral vetors were inoulated into inuinal fat by multi-point subutaneous injetion (Supplementary Fi. 7a). Aordin to the immunofluoresene mirosopy analysis, B% of inuinal ells expressed GFP week post infetion, and the infetion rate stabilized at nearly % weeks after infetion (Supplementary Fi. 7b d). Three weeks post-infetion, lentivirus-driven expression of anti-mir-9-p in mie effiiently dereased mir-9-p expression in inwat (Fi. 7a; Supplementary Fi. 7e). Althouh Prdm6 mrna was unhaned, the loss of mir-9-p robustly elevated the level of PRDM6 protein in inwat (Fi. 7b,; Supplementary Fi. 7f). The indution of PRDM6 protein was hihly orrelated with brownin effets, as determined by the indution of UCP expression in the inwat of mir-9-p-depleted mie (Fi. 7d,e). The broad sets of enes (BAT-seletive, mitohondrial oxidation and beie-sinature enes) assoiated with the thermoeni proramme were also markedly inreased by mir-9-p inhibition, espeially the beie-sinature enes (Fi. 7f). Althouh the viseral-seletive enes were repressed by mir-9-p inhibition in inwat, the expression levels of the eneral adipoeni markers ap and AdipoQ were not affeted (Fi. 7,h). Furthermore, inhibition of mir-9-p resulted in slihtly dereased lipoenesis and markedly inreased lipolysis, alon with indued O onsumption, suestin that loss of mir-9-p elevated enery expenditure in the inwat of mie (Fi. 7i,j). Considerin strikin effet of mir-9-p defiieny in inwat, the mie were subjeted to metaboli analysis. Physial ativity and food intake were similar in both roups of mie (Fi. 7k,l). Importantly, inhibition of mir-9-p in inwat inreased O onsumption and dereased RER, indiatin a substantial elevation of fat-based fuel (Fi. 7m,n). Thus, the weihts of six adipose depots were measured, inludin BAT; viseral WAT depots: RP, mes and epiwat; and subutaneou WAT depots: in, and antwat. The dereased viseral WAT appeared to aount for the sliht body derease in weiht in anti-mir-9-p treated mie (Fi. 7o q). The ation of PRDM6 an be enhaned by AMP treatment, whih mimis adreneri input. In our animal model, the level of PRDM6 protein in inwat was robustly enhaned by mir-9-p inhibition. Thus, we treated both roups of mie with norepinephrine (NE), a seletive b-adreneri aonist. As expeted, althouh the NE treatment inreased O onsumption in ontrol mie, the enery expenditure indution was sinifiantly enhaned in mir-9-p-depleted mie (Fi. 7r). These results suest that inhibition of mir-9-p stimulates the thermoeni proramme of inwat, leadin to inreased enery expenditure in mie. mir-9-p auses partial viseralization of inwat in mie. Next, overexpression of mir-9-p by lentivirus effiiently redued the PRDM6 protein level in the inwat of mie, althouh only a downward trend in Prdm6 mrna expression was observed (Fi. 8a-; Supplementary Fi. 7). The inwat of mie overexpressin mir-9-p showed redued UCP þ adipoytes alon with redued expression of a broad panel of thermoeni enes, inludin BAT-seletive and mitohondrial enes (Fi. 8d-f). Althouh adipoenesis per se (ap and AdipoQ) was not affeted by etopi mir-9-p expression, the sets of lassi WAT and viseral-seletive enes were sinifiantly inreased (Fi. 8). Given that mir-9-p overexpression appeared to viseralize inwat at the moleular level, we assessed the physioloial effets of this overexpression. In addition to inreasin lipoenesis, etopi mir-9-p expression sinifiantly redued O onsumption in inwat, suestin viseral funtional harateristis (Fi. 8h,i). Metaboli analysis showed no differene in food intake or ativity between the two roups of mie. However, mie overexpressin mir-9-p exhibited a markedly inreased RER, suestin a derease in the utilization of fatty aid oxidation as an enery substrate (Fi. 8j n). Althouh the overexpression of mir-9-p in inwat resulted in a sliht inrease in viseral WAT, no sinifiant alteration in whole-body weiht was observed (Fi. 8o,p). We also studied these animals after injetion with NE. Control animals showed a marked inrease in O onsumption followin NE injetion; however, overexpression of mir-9-p in inwat blunted this NE-indued elevation, suestin that this inwat-speifi overexpression of mir-9-p an affet whole-body enery expenditure (Fi. 8q). Disussion The obesity epidemi has enerated onsiderable interest in adipose tissue. The linial desription of obesity has larely been Fiure Prdm6 is diretly tareted by mir-9-p. (a) Heat map showin the relative expression of mirnas that haned in the opposite diretion in inuinal adipose tissues of fasted and old exposed mie. Eah sample omprised a pool of inuinal adipose tissues from four animals. Eah olumn depits an individual mirna. Eah row depits the mirna expression in fasted or old exposed samples relative to the expression in ontrol mie. The fold hane for the samples is olour-oded aordin to the key. (b) Relative expression level of mirna-9-p normalized to snrnau6 measured by quantitative real-time PCR in inuinal, epididymal, mesenteri and brown adipose tissue from old-exposed and fasted male mie, or in inuinal adipose tissue from fasted female mie (n ¼ 8). () Putative mirna taret sites of mir-9-p within the -UTR of Prdm6. (d) Bioinformati predition of mir-9-p taret sites and free enery values within the -UTRs of mouse and human Prdm6. (e) Relative luiferase ativity in HEK9T ells transfeted with plasmid reporter onstruts ontainin the -UTR or mutated -UTR of Prdm6, o-transfeted with mimi-mir-9-p (n ¼ 6). (f,) Prdm6 mrna (f) and protein () levels in two-day differentiated inuinal SV ells infeted with adenovirus expressin a shrna tareted to Prdm6 or a srambled ontrol shrna (sh-n), o-transfeted with sramble or mir-9-p mimi. (h,i) PRDM6 mrna (h) and protein (i) levels in two-day differentiated inuinal SV ells infeted with adenovirus expressin a shrna tareted to Prdm6 or a srambled ontrol shrna (sh-n), o-transfeted with sramble or mir-9-p anti-mirs. (j) Relative mir-9-p expression level in different tissues of mie measured by RT PCR (n ¼ 8). BAT; brown adipose tissue;, epididymal;, inuinal;, mesenteri. The data represent the mean±s.e.m. Po.; Po.; (Student s t-test). NATURE COMMUNICATIONS 7: DOI:.8/nomms 9
10 NATURE COMMUNICATIONS DOI:.8/nomms a b d e mir-9-p (rel. expression) f Cidea (rel. expression). mirna fold hane. PRDM6 kda. PGCα 7 kda. UCP kda GAPDH. kda 6 s of differentiation 6 sh-prdm6+ sh-prdm6+ 6 s of differentiation Elovl6 (rel. expression) sh-prdm6+ sh-prdm6+ 6 s of differentiation D D D6 D D D6 h Wt (rel. expression) 6 s of differentiation Cox7a (rel. expression) sh-prdm6+ sh-prdm6+ sh-prdm6+ sh-prdm6+ Cox8b (rel. expression) 6 6 s of differentiation s of differentiation i Relative IL-6 level... j Relative resistin level... k Pparγ (rel. expression) s of differentiation l ap (rel. expression) 6 s of differentiation m AdipoQ (rel. expression) 6 s of differentiation n Lipoenesis Lpl Fas Glut Lipolysis Cpt Aox Asl o OCR (pmol min ) FCCP Antimyin A and Rotenone Oliomyin Time (min) Differentiated inuinal adipoytes Bakround p OCR (pmol min ) 8 6 Proton leak ATP prodution q OCR (pmol min ) Oliomyin FCCP Antimyin A and Rotenone Bakround Time (min) Differentiaed epididymal adipoytes Fiure Inhibition of mir-9-p indues thermoenesis in differentiated inuinal adipoytes. (a) Relative mir-9-p expression durin primary inuinal SV differentiation usin an indution oktail, measured by quantitative real-time PCR with normalization to U6. (b) Relative expression level of mir-9-p in inuinal SV ells transfeted with anti-mir-9-p. () Western blot analysis of PRDM6, PGC-a and UCP levels in inuinal SV ells transfeted with anti-mir-9-p or anti-mir-ontrol (anti-sramble), at the indiated time points (day, day and day 6) durin inuinal SV ell differentiation. (d ) of Cox7a (d), Cox8b (e), Cidea (f), and Elovl6 () in inuinal SV ells infeted with adenovirus expressin a shrna tareted to Prdm6 o-transfeted with anti-mir-9-p or anti-mir-ontrol durin differentiation. (h) of Wt. (i,j) ELISA analysis of IL-6 (i) and Resistin (j) expression in inuinal SV ells in differentiation medium at day 6. (k m) of the adipoeni marker enes Ppar (k), ap (l) and AdipoQ (m) in inuinal SV ells transfeted with anti-mir-9-p or anti-mir-ontrol durin differentiation. (n) Relative mrna expression of lipoenesis and lipolysis enes in inuinal SV ells at day 6. The data show the mean of five independent experiments. (o q) Oxyen onsumption rates (OCRs) were quantified under basal onditions and with drus that disrupt the respiratory hain usin a Seahorse Biosienes XF 96 analyser in 6-day differentiated inuinal adipoytes (o,p) or epididymal adipoytes (q) transfeted with anti-mir-9-p or anti-mir-ontrol. Experiments were performed in tripliated wells for eah ondition and repeated five times independently. The data present the mean±s.e.m. Po.; Po.; (Student s t-test). NATURE COMMUNICATIONS 7: DOI:.8/nomms
11 NATURE COMMUNICATIONS DOI:.8/nomms a mirna fold hane e Raldh (rel. expression) sh-prdm6+ sh-prdm6+ b D D D6 D D D6 PRDM6 kda PGCα 7 kda UCP kda GAPDH kda Mimi sramble f At (rel. expression) 8 6 sh-prdm6+ sh-prdm Wt (rel. expression) Saa (rel. expression) sh-prdm6+ sh-prdm s of differentiation sh-prdm6+ sh-prdm6+ 6 s of differentiation s of differentiation s of differentiation d Bn (rel. expression) sh-prdm6+ sh-prdm s of differentiation h.. Relative IL-6 level... i Relative resistin level j Ppar γ (rel. expression) 6 s of differentiation k ap (rel. expression) 6 s of differentiation l AdipoQ (rel. expression) 6 s of differentiation m Lipoenesis Lpl Fas Glut Lipolysis Cpt Aox Asl n OCR (pmol min ) Time (min) Antimyin A and Rotenone Oliomyin FCCP Bakround o OCR (pmol min ) 8 6 Proton leak Fiure 6 Overexpression of mir-9-p indues viseral-seletive ene expression in differentiated inuinal adipoytes. (a) Relative expression level of mir-9-p in inuinal SV ells transfeted with mimi-mir-9-p. (b) Western blot analysis of PRDM6, PGC-a and UCP levels in inuinal SV ells transfeted with mimi-mir-9-p or mimi-mir-ontrol (mimi-sramble) at the indiated time points (day, day and day 6) durin inuinal SV ell differentiation). ( ) of Wt (), Bn (d), Raldh (e), At (f), and Saa () in inuinal SV ells infeted with adenovirus expressin a shrna tareted to Prdm6, o-transfeted with mimi-mir-9-p or mimi-mir-ontrol durin differentiation. (h,i) ELISA analysis of IL-6 (h) and Resistin (i) expression in inuinal SV ells in differentiation medium at day 6. (j l) of the adipoeni marker enes Ppar (j), ap (k) and AdipoQ (l), (m) of lipoenesis and lipolysis enes in inuinal SV ells at day 6. The data show the mean of five independent experiments. (n,o) Oxyen onsumption rates (OCRs) were quantified under basal onditions and with drus that disrupt the respiratory hain usin a Seahorse Biosienes XF 96 analyser in 6-day differentiated inuinal adipoytes transfeted with mimi-mir-9-p or mimi-mir-ontrol. Experiments were performed in tripliated wells for eah ondition and repeated five times independently. The data represent the mean±s.e.m. Po.; Po.; (Student s t-test). NATURE COMMUNICATIONS 7: DOI:.8/nomms
12 NATURE COMMUNICATIONS DOI:.8/nomms a Relative mir-9-p expression... b Relative Prdm6 mrna expression... PRDM6 GAPDH kda Relative PRDM6 protein level d e Perentae of Up + adipoytes f 8 6 Bat-seletive Cidea Elovl6 Pparα Mitohondrial Pα Cox7a Cox8b Cy Dio Beie-sinature Cd7 Tmem6 Tbx.... Wt Bn Saa At Opn Raldh h... ap AdipoQ i j k l m n Respiratory exhane ratio. 6, Anti-miR-9. 8, 7,..,,.. 6,,,,.. Lpl Fas Glut Cpt Aox Asl o Body weiht () μ O per min per m tissue p Tissue weiht () Total ativity (nts) Bat SubQ unial Anterior q Food intake ( h per body weiht) Viseral tissue weiht () didymal Retroperitoneal enteri VO (ml k h ) r VO (ml k h ), 8, 6,,, PBS NE Fiure 7 Subutaneous inhibition of mir-9-p indued brownin of inwat in mie. (a r) Lentiviral expression onstruts ontainin srambled ontrol (vetor) or antisense-mir-9-p (anti-mir-9-p) were used for inuinal adipose infetion in male mie (n ¼ 8). (a) Relative expression level of mir-9-p in inuinal adipose tissue infeted with anti-mir-9-p lentivirus vetor (n ¼ 8). (b,) Analysis of Prdm6 mrna (n ¼ 8) (b) and protein () levels in inuinal adipose tissue infeted with LV-vetor or LV-antisense-miR-9-p. GAPDH was used as an internal ontrol. (d) Immunohistohemial stainin for UCP abundane in respetive inuinal setions. Sale bar, mm. (e) Perentae of UCP þ adipoytes in setions (n ¼ ). (f i) Normalized expression of BAT-seletive enes, mitohondrial enes, beie-sinature enes (f), viseral sinature enes () adipose marker enes (h) and lipid metabolism enes (i) in inuinal adipose tissue in LV-vetor or LV-antisense-miR-9-p infeted mie (n ¼ 8). (j) O onsumption by inuinal adipose tissue (n ¼ 8). (k n) Total ativity (k), food intake (l), O onsumption (m), and respiratory exhane ratio (n) in LV-vetor or LV-antisense-miR-9-p infeted male mie (n ¼ 8). (o q) Body weiht (o), weiht of brown fat mass, SubQ fat mass (p) and viseral fat mass (q) in LV-vetor or LV-antisense-miR-9-p infeted mie (n ¼ 8). (r) O onsumption in LV-vetor or LV-antisense-miR-9-p infeted mie treated with NE or PBS (n ¼ 8). NE, Norepinephrine; SubQ, subutaneous. The data represent the mean±s.e.m. Po.; Po.; (Student s t-test). NATURE COMMUNICATIONS 7: DOI:.8/nomms
13 NATURE COMMUNICATIONS DOI:.8/nomms a Relative mir-9-p expression b Relative Prdm6 mrna expression... PRDM6 GAPDH kda Relative PRDM6 protein level... d e Perentaes of Up + adipoytes Lpl Fas Glut f.... Cpt Aox Asl Bat-seleted Cidea Elovl6 Pparα Total ativity (nts) 6,.,, 6 Adiposeseletive ap AdipoQ h i j k μ O per min per m tissue Mitohondrial Pα Cox7a Cox8b Cy Dio Food intake ( h per body weiht) White-seletive Serpinak Resistin Anxa Ednra Psat... Wdnm l Respiratory exhane ratio Viseral sinature Wt Bn Saa At Opn Raldh m VO (ml k h ) 8, 6,,, n VO (ml k h ) 8, 6,,, o Body weiht () p Tissue weiht ()..... Bat unial Anterior didymal Retroperitoneal enteri q VO (ml k h ) 8, 6,,, PBS NE Fiure 8 Subutaneous overexpression of mir-9-p indues a viseral-like phenotype in mouse inuinal adipose. (a q) Lentiviral expression onstruts ontainin srambled ontrol (vetor) or mimi-mir-9-p (mimi-mir-9-p) were used for inuinal adipose infetion in 6 8 week-old male mie (n ¼ 8). (a) Relative expression level of mir-9-p in inuinal adipose tissue infeted with mimi-mir-9-p lentivirus vetor (n ¼ 8). (b,) Analysis of Prdm6 mrna (b) and protein () levels in inuinal adipose tissue infeted with LV-vetor or LV-mimi-miR-9-p. GAPDH served as an internal ontrol. (d) Immunohistohemial stainin for UCP abundane in respetive inuinal setions. Sale bar, mm. (e) Perentae of UCP þ adipoytes in setions (n ¼ ). (f h) Normalized expression of BAT-seletive enes, mitohondrial enes (f), adipose marker enes, white adipose seletive enes, viseral sinature enes () and lipid metabolism enes (h) in inuinal adipose tissue in LV-vetor or LV-mimi-miR-9-p infeted mie (n ¼ 8). (i) O onsumption by inuinal adipose tissue (n ¼ 8). (j n) Total ativity (j), food intake (k), respiratory exhane ratio (l), O onsumption (m) and CO prodution (n) in LV-vetor or LV-mimi-miR-9-p infeted male mie (n ¼ 8). (o,p) Body weiht (o), weiht of brown fat mass, SubQ fat mass and viseral fat mass (p) in LV-vetor or LV-mimi-miR-9-p infeted mie (n ¼ 8). (q) O onsumption in LV-vetor or LV-mimi-miR-9-p infeted mie treated with NE or PBS (n ¼ 6). BAT, brown adipose tissue; NE, Norepinephrine. The data represent the mean±s.e.m. Po.; Po.; (Student s t-test). NATURE COMMUNICATIONS 7: DOI:.8/nomms
14 NATURE COMMUNICATIONS DOI:.8/nomms based on measurements that aue total body fat. However, sientists have reonized that the loation of fat appears to have a lose assoiation with obesity. Viseral adiposity, whih is more ommonly observed amon men than premenopausal women, is stronly assoiated with inreased mortality. However, the aumulation of subutaneous adiposity has been termed metabolially healthy obesity, whih suests that the distint metaboli effets of viseral and subutaneous WAT are most likely ell autonomous 6. has been pratied for millennia and has been used as a powerful tool for studyin the reulation of intermediary metabolism. Here, we showed that -h fastin triered a depot-speifi pattern of hanes in both lipoeni and lipolyti enes in mie, indiatin preferential mobilization of lipids in viseral depots ompared with subutaneous fat pads (Fi. ). Food deprivation also stimulated a viseral-like swith in subutaneous depots, from the morpholoial to the funtional level (Fis and ). This observation may be evolutionarily important. Durin fastin, preferentially oxidized viseral fat an drain diretly into the portal irulation and appears to be more effiient at meetin enery needs ompared with the relatively externally loated subutaneous fat. Simultaneously, beause lare amounts of viseral fat are bein used, subutaneous fat must undero a morpholoial and funtional viseral-like swith to prepare to beome a bakup enery reservoir. Thus, under ertain physioloial irumstanes, subutaneous fat an be used to supplement the funtions of viseral fat. Despite sharin the ability to aumulate trilyerides, the physioloial roles of WAT and BAT are almost diametrially opposite, whih makes sense evolutionarily, beause huner and old are two historial hallenes durin the development and evolution of mammals. Althouh studies have demonstrated the existene of BAT in adult humans, it is still debated whether the amount of ativated BAT in humans is suffiient to impat enery balane in a meaninful way 7. However, subutaneous WAT is very abundant in humans. Reent studies indiate that a subset of the preursor ells within subutaneous adipose tissue an ive rise to beie/brite ells, whih are apable of defendin aainst hypothermia and obesity 7. However, beie ells are rarely observed in viseral fat. The strikin but appreiated brownin ability of subutaneous has aused an explosion of interest in the funtion of this adipose tissue. Here, usin a -h fastin stimulus, we found that fastin stimulated a set of viseralseletive ene transripts but dereased the expression of enes related to the thermoeni proramme (Fi. ). This whitenin of subutaneous adipoytes intuitively makes sense, beause it not only redues heat prodution but also reserves enery to supplement viseral fat durin fastin. Therefore, old exposure and fastin, two different physioloial stimuli, lead to nearly opposite phenotypi and funtional hanes in subutaneous adipoytes to maintain the enery balane (Fi. 9). This extraordinary plastiity of subutaneous adipoytes suests that this adipose tissue miht play even broader roles in the physioloy and homeostasis of animals, partiularly in humans. mir-9-p has rarely been investiated. Our study demonstrated that mir-9-p diretly tarets and neatively reulates Prdm6 and that inhibition of mir-9-p promotes the differentiation of preursors from subutaneous to beie ells, thereby leadin to inreased mitohondrial ativity (Fis and ). However, neither of these alterations was observed in mir-9- p-depleted epididymal adipoytes, suestin that mir-9-p miht have tissue-speifi roles. This miht be beause the expression of Prdm6 is muh lower in epiwat than in inwat. In addition, the manipulation of fat stores is an obvious therapeuti objetive, but disruption of the normal differentiation or development of WAT auses lipodystrophy in both humans and experimental animals. Here, we demonstrated that subutaneous inhibition by anti-mir-9-p-ativated beie ell development in inwat and subsequently inreased whole-body enery expenditure without ausin dysfuntion in other tissues, whih miht be a potential stratey to ounterat obesity (Fi. 7). We are still in the proess of understandin the similarities and differenes between subutaneous and viseral adipose tissue. Here, we show that in addition to the apability of brownin to defend aainst hypothermia durin old exposure, subutaneous WAT aquires many harateristis of viseral WAT to preserve enery durin fastin via mirna-mediated reulation of PRDM6. These data suest an important role for subutaneous SubQ WAT Mobilize h-fastin h-old mir-9-p mir-9-p VISC WAT Supplement Prdm6 Prdm6 Supplement BAT Viseral swith Brownin Viseral-seletive enes Enery storae Enery balane Thermoeni enes Eneny onsumption Fiure 9 Subutaneous WAT links enery balane throuh mir-9-p-mediated reulation of Prdm6. After fastin for h, subutaneous inwat takes on many of the morpholoial and moleular harateristis of viseral fat to preserve enery via mir-9-p-mediated suppression of PRDM6. By ontrast, -h old exposure dereased mir-9-p and led to inreased PRDM6 protein levels and adaptive thermoenesis in inwat. These findins unravel the extraordinary plastiity of subutaneous WAT and its ritial role in reulatin enery homeostasis, espeially in response to different physioloial hanes. BAT, brown adipose tissue; SubQ, subutaneous; VISC, viseral; WAT, white adipose tissue. NATURE COMMUNICATIONS 7: DOI:.8/nomms
Supplemental Table 1. Primers used for real-time quantitative RT-PCR assay. Nucleotide sequence
Supplemental Table 1. Primers used for real-time quantitative RT-PCR assay Name FoxO1 forward FoxO1 reverse GK forward GK reverse INS-1 forward INS-1 reverse INS-2 forward INS-2 reverse Glut2 forward Glut2
More informationUnit 02 - The Inside Story about Nutrition and Health. True / False
True / False 1. Geneti traits exert the strongest overall influene on health and longevity. False 2. The bodies of modern humans adapted to exist on a diet of wild game, fish, fruits, nuts, seeds, roots,
More informationSUPPLEMENTARY INFORMATION
-. -. SUPPLEMENTARY INFORMATION DOI: 1.1/ncb86 a WAT-1 WAT- BAT-1 BAT- sk-muscle-1 sk-muscle- mir-133b mir-133a mir-6 mir-378 mir-1 mir-85 mir-378 mir-6a mir-18 mir-133a mir- mir- mir-341 mir-196a mir-17
More information% of Nestin-EGFP (+) cells
8 7 6 3 Nestin CD % of Nestin-EGFP (+) ells 8 6 Nestin-EGFP Marge Nestin-EGFP Marge Expression levels of Expression levels of Tumorigeniity y stemness markers ifferentiation markers limiting ilution assay
More informationFunctional GI disorders: from animal models to drug development
1 UCLA Center for Neuroviseral Sienes & Women s Health, Departments of Mediine, Physiology and Psyhiatry, David Geffen Shool of Mediine at UCLA, Los Angeles, CA, USA; 2 UCLA Center for Neuroviseral Sienes
More information100 μm. Axon growth cones. Tubulin (red) + scr (green)
Supplementary Figures mirorna-9 regulates axon extension an ranhing y targeting Map1 in mouse ortial neurons Dajas-Bailaor, F., Bonev, B., Garez, P., Stanley, P., Guillemot, F., Papalopulu, N. a 2 μm 1
More informationReading a Textbook Chapter
HENR.546x.APPBpp001-013 7/21/04 9:37 AM Page 1 APPENDIX B Reading a Textbook Chapter Copyright 2005 Pearson Eduation, In. 1 2 Read the following hapter from the ollege textbook Total Fitness: Exerise,
More informationA synergistic anti-obesity effect by a combination of capsinoids and cold temperature through the promotion of beige adipocyte biogenesis
A synergistic anti-obesity effect by a combination of capsinoids and cold temperature through the promotion of beige adipocyte biogenesis Kana Ohyama, 1,2 Yoshihito Nogusa, 1 Kosaku Shinoda, 2 Katsuya
More informationSupplementary Figure 1. Verification of drug infusions into the IPN. a. Representative
Supplementary Figure 1. Verifiation of drug infusions into the IPN. a. Representative neutral red-stained oronal setion from a mouse with a guide annula targeting the IPN. The guide annula sar is irled
More informationEffect of Curing Conditions on Hydration Reaction and Compressive Strength Development of Fly Ash-Cement Pastes
Effet of Curing Conditions on Hydration Reation and Development of Fly Ash-Cement Pastes Warangkana Saengsoy Candidate for the degree of Dotor of Philosophy Supervisor: Prof. Dr. Toyoharu Nawa Division
More informationSpleen VAT FMO. Nature Immunology: doi: /ni Ki67 DX5 CD27. CD11b 2B4 KLRG1 CD69 NKG2D CXCR3 CD44 NKG2A/C/E CD62L CD103 CD94 CD48.
IFN (% of ells) CD7 Marophages Medium NCR LPS PMA/Ionomyin CD IFN (% of ells) T ells Marophages B ells DX CD9 KLRG NKGD B CDL CD CD CXCR CD9 CD NKGA/C/E NCR Ly9h Ly9G Ly9d Ly9i Ly9/i/h FMO CD7 CD9a CD7
More informationMiles Fisher. Coronary disease DIABETES AND ATHEROGENESIS RESISTANCE AND THE METABOLIC SYNDROME
336 Correspondene to: Dr Miles Fisher, Wards 4 & 5, Glasgow Royal Infirmary, Glasgow, G4 0SF, UK; miles.fisher@northglasgow. sot.nhs.uk Coronary disease DIABETES AND ATHEROGENESIS INSULIN T Miles Fisher
More informationMeasurement of Dose Rate Dependence of Radiation Induced Damage to the Current Gain in Bipolar Transistors 1
Measurement of Dose Rate Dependene of Radiation Indued Damage to the Current Gain in Bipolar Transistors 1 D. Dorfan, T. Dubbs, A. A. Grillo, W. Rowe, H. F.-W. Sadrozinski, A. Seiden, E. Spener, S. Stromberg,
More informationdescribing DNA reassociation* (renaturation/nucleation inhibition/single strand ends)
Pro. Nat. Aad. Si. USA Vol. 73, No. 2, pp. 415-419, February 1976 Biohemistry Studies on nulei aid reassoiation kinetis: Empirial equations desribing DNA reassoiation* (renaturation/nuleation inhibition/single
More informationImpaired thermogenesis and adipose tissue development in mice with fat-specific disruption of insulin and IGF-1 signalling
Reeived 7 Fe 1 Aepted 14 May 1 Pulished 1 Jun 1 DOI: 1.138/nomms195 Impaired thermogenesis and adipose tissue development in mie with fat-speifi disruption of insulin and IGF-1 signalling Jeremie Bouher
More informationPartial inactivation of Ankrd26 causes diabetes with enhanced insulin responsiveness of adipose tissue in mice
Diabetologia (11) :911 9 DOI.7/s-11-3-9 ARTICLE Partial inativation of Ankrd auses diabetes with enhaned insulin responsiveness of adipose tissue in mie G. A. Raiti & T. K. Bera & O. Gavrilova & I. Pastan
More informationMETHODS JULIO A. PANZA, MD, ARSHED A. QUYYUMI, MD, JEAN G. DIODATI, MD, TIMOTHY S. CALLAHAN, MS, STEPHEN E. EPSTEIN, MD, FACC
JACC Vol. 17. No.3 Marh 1. 1991 :657-63 657 METHODS Predition of the Frequeny and Duration of Ambulatory Myoardial Ishemia in Patients With Stable Coronary Artery Disease by Determination of the Ishemi
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2211 a! mir-143! b! mir-103/107! let-7a! mir-144! mir-122a! mir-126-3p! mir-194! mir-27a! mir-30c! Figure S1 Northern blot analysis of mir-143 expression dependent on feeding conditions.
More informationclinical conditions using a tape recorder system
Thorax (1964), 19, 125 Objetive assessment of ough suppressants under linial onditions using a tape reorder system C. R. WOOLF AND A. ROSENBERG From the Respiratory Unit, Sunnybrook Hospital (Department
More informationChemotherapy triggers HIF-1 dependent glutathione synthesis and copper chelation that induces the breast cancer stem cell phenotype
hemotherapy triggers HIF-1 dependent glutathione synthesis and opper helation that indues the breast aner stem ell phenotype Haiquan Lu a, ebangshu Samanta a, Lisha Xiang a, Huimin Zhang a, Hongxia Hu
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature12652 Supplementary Figure 1. PRDM16 interacts with endogenous EHMT1 in brown adipocytes. Immunoprecipitation of PRDM16 complex by flag antibody (M2) followed by Western blot analysis
More informationUbiquitin-dependent degradation of TGF-β-activated Smad2
Ubiquitin-dependent degradation of -ativated Roger S. Lo* and Joan Massagué* *Cell Biology Program, Howard Hughes Medial Institute, Memorial Sloan-Kettering Caner Center, New York, New York 10021, USA
More informationSystematic Review of Trends in Fish Tissue Mercury Concentrations
Systemati Review of Trends in Fish Tissue Merury Conentrations Tom Grieb 1, Roxanne Karimi 2, Niholas Fisher 2, Leonard Levin 3 (1) Tetra Teh, In., Lafayette, CA, USA; (2) State University of New York,
More informationMicroRNA-494 promotes cancer progression and targets adenomatous polyposis coli in colorectal cancer
Zhang et al. Moleular Caner (8) 7: DOI.86/s94-7-75- RESEARCH Open Aess MiroRNA-494 promotes aner progression and targets adenomatous polyposis oli in oloretal aner Ying Zhang, Lu Guo,, Yuhuan Li,, Gui-Hai
More informationSupplementary Figure 1. Schematic illustrating major conclusions of this study.
ORNs GABA A GABA B glomeruli LN PNs Supplementary Figure 1. Shemati illustrating major onlusions of this study. This study represents the most diret evidene to date of inhiitory interations etween olfatory
More informationStefan D Anker, Stephan von Haehling
464 See end of artile for authors affiliations Correspondene to: Dr Stefan D Anker, National Heart and Lung Institute, Department of Clinial Cardiology, Dovehouse Street, London SW3 6LY, UK; s.anker@imperial.a.uk
More informationSexual and marital trajectories and HIV infection among ever-married women in rural Malawi
1 Cartagene, Montreal, Canada; 2 MGill University, Montreal, Canada; 3 Université de Montréal, Montreal, Canada; 4 Brown University, Providene, USA; 5 University of Colorado at Boulder, Boulder, USA; 6
More informationStudy of Necrosis in the Liver of Formaldehyde and Benzo(α)Pyrene Exposured-Mice
THE JOURNAL OF TROPICAL LIFE SCIENCE OPEN ACCESS Freely available online VOL. 3, NO. 1, pp. 58 62, January, 2013 Study of Nerosis in the Liver of Formaldehyde and Benzo(α)Pyrene Exposured-Mie Ahmad Soni,
More informationSequence Analysis using Logic Regression
Geneti Epidemiology (Suppl ): S66 S6 (00) Sequene Analysis using Logi Regression Charles Kooperberg Ingo Ruzinski, Mihael L. LeBlan, and Li Hsu Division of Publi Health Sienes, Fred Huthinson Caner Researh
More informationTHE ATP-DEPENDENT CONCENTRATION OF CALCIUM BY A GOLGI APPARATUS-RICH FRACTION ISOLATED FROM RAT LIVER
J. Cell Si. 30, 117-128 (1978) Printed in Great Britain Company of Biologists Limited igys THE ATP-DEPENDENT CONCENTRATION OF CALCIUM BY A GOLGI APPARATUS-RICH FRACTION ISOLATED FROM RAT LIVER STUART HODSON
More informationHistometry of lymphoid infiltrate in the thyroid of primary thyrotoxicosis patients
J. /in. Path., 1976, 29, 398*402 Histometry of lymphoid infiltrate in the thyroid of primary thyrotoxiosis patients Relation of extent of thyroiditis to preoperative drug treatment and postoperative hypothyroidism
More informationCoupled feedback loops maintain synaptic long-term. potentiation: A computational model of PKMzeta
1 Draft version 28, 2018-04-30. This paper has not been peer reviewed. Please do not opy or ite without author's permission. Coupled feedbak loops maintain synapti long-term potentiation: omputational
More informationoriginal article Chao-Lien Liu 1, Peiqing Ye 1, Benjamin C Yen 1 and Carol H Miao 1,2
The Amerian Soiety of Gene & Cell Therapy original artile In Vivo Expansion of Regulatory T ells With IL-2/IL-2 mab Complexes Prevents Anti-fator VIII Immune Responses in Hemophilia A Mie Treated With
More informationKeywords: congested heart failure,cardiomyopathy-targeted areas, Beck Depression Inventory, psychological distress. INTRODUCTION:
International Journal of Medial Siene and Eduation An offiial Publiation of Assoiation for Sientifi and Medial Eduation (ASME) Original Researh Artile ASSOCIATION BETWEEN QUALITY OF LIFE AND ANXIETY, DEPRESSION,
More informationEvaluation and Management of Youth-Onset Type 2 Diabetes: A Position Statement by the American Diabetes Association
Diabetes Care 1 Evaluation and Management of Youth-Onset Type 2 Diabetes: A Position Statement by the Amerian Diabetes Assoiation https://doi.org/10.2337/di18-0052 Silva Arslanian, 1,2 Fida Baha, 3 Margaret
More informationcontrol kda ATGL ATGLi HSL 82 GAPDH * ** *** WT/cTg WT/cTg ATGLi AKO/cTg AKO/cTg ATGLi WT/cTg WT/cTg ATGLi AKO/cTg AKO/cTg ATGLi iwat gwat ibat
body weight (g) tissue weights (mg) ATGL protein expression (relative to GAPDH) HSL protein expression (relative to GAPDH) ### # # kda ATGL 55 HSL 82 GAPDH 37 2.5 2. 1.5 1..5 2. 1.5 1..5.. Supplementary
More informationSafe and Efficient Gene Therapy for Pyruvate Kinase Deficiency
The Amerian Soiety of Gene & Cell Therapy original artile Safe and Effiient Gene Therapy for Pyruvate Kinase Defiieny Maria Garia-Gomez 1,2, Andrea Calabria 3, Maria Garia-Bravo 1,2, Fabrizio Benedienti
More informationEvaluation of a prototype for a reference platelet
932 Royal Postgraduate Medial Shool, Duane Road, London W12 ONN S M Lewis Western Infirmary, Glasgow R M Rowan Toa Medial Eletronis, Kobe, Japan F Kubota Correspondene to: Dr S M Lewis Aepted for publiation
More informationCytomegalovirus and tumor stress-surveillance by human γδ T cell receptor binding to Endothelial Protein C Receptor
Cytomegalovirus and tumor stress-surveillane y human γδ T ell reeptor inding to Endothelial Protein C Reeptor Carrie R. Willox, Vinent Pitard, Sonia Netzer, Lionel Couzi, Mahoo Salim, Toias Silerzahn,
More informationThe impact of smoking and quitting on household expenditure patterns and medical care costs in China
Researh paper Appendies are published online only at http:// tobaoontrol.bmj.om/ ontent/vol18/issue2 1 Center for Health Statistis and Information, Ministry of Health, Beijing, PR China; 2 International
More informationRho-kinase Regulates Energy Balance by Targeting Hypothalamic Leptin Receptor Signaling
Rho-kinase Regulates Energy Balane y Targeting Hypothalami Leptin Reeptor Signaling Hu Huang 1, Dong Kong 1, Kyung Hee Byun 2, Chianping Ye 1, Shuihi Koda 1, Dae Ho Lee 1, Byung-Chul Oh 2, Sam W Lee 3,
More informationSupplementary Figure 1. Implants derived from human embryoid body preparations contain non-cardiac structures. In early studies, infarcted hearts
a Supplementary Figure 1. Implants derived from human emryoid ody preparations ontain non-ardia strutures. In early studies, infarted hearts reeived ell preparations of low ardia purity (
More informationDetection and Classification of Brain Tumor in MRI Images
PrahiGadpayle and Prof.P.S.Mahajani 45 Detetion and Classifiation of Brain Tumor in MRI Images PrahiGadpayleand Prof.P.S.Mahajani Abstrat Brain tumor detetion in Magneti Resonane Imaging (MRI) is important
More informationDepartment of Virology, Wellcome Research Laboratories, Langley Court, Beckenham, Kent BR3 3BS, U.K. and heterologous virus challenge.
Journal of General Virology (1992), 73, 727-731. Printed in Great Britain 727 Comparison between in vitro neutralization titres and in vivo protetion against homologous and heterologous hallenge indued
More informationReversal of ammonia coma in rats by L-dopa: a peripheral effect
Gut, 1979, 2, 28-32 Reversal of ammonia oma in rats by L-dopa: a peripheral effet L. ZV1, W. M. DOZAK, AND R. F. DRR From the Department of Mediine, Hennepin ounty Medial enter and Minneapolis Veterans
More informationGranulocytosis and Lymphocytopenia in the Blood as Indicators for Drug Adverse Reaction during Calcitonin
Ata Media et Biologia Vol. 44, No.4, 209-213, 1996 Granuloytosis and Lymphoytopenia in the Blood as Indiators for Drug Adverse Reation during Calitonin Therapy in Patients with Osteoporosis after Gastretomy
More informationLearned spatiotemporal sequence recognition and prediction in primary visual cortex
Supplementary Materials for Learned spatiotemporal sequene reognition and predition in primary visual ortex Jeffrey P. Gavornik and Mark F. Bear Howard Hughes Medial Institute Piower Institute for Learning
More informationMethylglyoxal impairs insulin signalling and insulin action on glucose-induced insulin secretion in the pancreatic beta cell line INS-1E
Diabetologia () 5:9 95 DOI.7/s5--8-8 ARTICLE Methylglyoxal impairs insulin signalling and insulin ation on gluose-indued insulin seretion in the panreati beta ell line INS-E F. Fiory & A. Lombardi & C.
More informationThe comparison of psychological evaluation between military aircraft noise and civil aircraft noise
The omparison of psyhologial evaluation between military airraft noise and ivil airraft noise Makoto MORINAGA ; Ippei YAMAMOTO ; Hidebumi TSUKIOKA ; Koihi MAKINO 2, Sonoko KUWANO 3, Mitsuo MATSUMOTO 4
More informationThe metabolic syndrome: common origins of a multifactorial disorder
Review Endorinology and Metabolism Unit, DOHaD Division, Institute of developmental Sienes, Southampton General Hospital, Southampton, UK Correspondene to: Professor C D Byrne, Endorinology and Metabolism
More informationOnset, timing, and exposure therapy of stress disorders: mechanistic insight from a mathematical model of oscillating neuroendocrine dynamics
Kim et al. RESEARCH arxiv:63.2773v [q-bio.nc] 9 Mar 26 Onset, timing, and exposure therapy of stress disorders: mehanisti insight from a mathematial model of osillating neuroendorine dynamis Lae Kim, Maria
More informationUrbanization and childhood leukaemia in Taiwan
C International Epidemlologial Assoiation 1998 Printed in Great Britain International Journal of Epidemiology 199827:587-591 Urbanization and hildhood leukaemia in Taiwan Chung-Yi Li, a Ruey S Iin b and
More informationhcg PREPARATIONS have been used extensively
001-97X/8/5501-007$0.00/0 Journal of Clinial Endorinology and Metabolism Copyright 198 by The Endorine Soiety Vol. 55, No. 1 Printed in U.S.A. Testiular Responsiveness to Chroni Human Chorioni Gonadotropin
More informationInterrelationships of Chloride, Bicarbonate, Sodium, and Hydrogen Transport in the Human Ileum
Interrelationships of Chloride, Biarbonate, Sodium, and Hydrogen Transport in the Human Ileum LEsLE A. TURNBERG, FREDERICK A. BIEBERDORF, STEPHEN G. MORAWSKI, and JOHN S. FORDTRAN From the Department of
More informationDefective neutrophil function in low-birth-weight,
J Clin Pathol 1981 ;34:366-37 Defetive neutrophil funtion in low-birth-weight, premature infants H AL-HADITHY, IE ADDISON, AH GOLDSTONE, JC CAWLEY, AND JC SHAW From the Departments of Haematology and Paediatris,
More informationThe effects of bilingualism on stuttering during late childhood
Additional information is published online only at http:// ad.bmj.om/ontent/vol93/ issue11 1 Division of Psyhology and Language Sienes, University College London, London, UK; 2 Department of Language and
More informationModel of α-linolenic acid metabolism
Model of α-linoleni aid metabolism N.Kokulan, C.-H. Lai Shool of Computing and Mathematial Sienes University of Greenwih London, UK RAE2012 Competitive Grant with Shool of Siene Projet progress meeting
More informationWhat causes the spacing effect? Some effects ofrepetition, duration, and spacing on memory for pictures
Memory & Cognition 1975, Vol. 3 (3), 287 294 What auses the spaing effet? Some effets ofrepetition, duration, and spaing on memory for pitures DOUGLAS 1. HNTZMAN, JEFFERY J. SUMMERS, and RCHARD A. BLOCK
More informationDepartment of Medicine, University of California, Irvine, California, U.S.A.
PPR 16 RSTRUTON O LOO LOW N TRNSCNNTL MTTON R. VNN,.. WLSON, W.R. SMT, and M. MORTON epartment of Mediine, University of California, rvine, California, U.S.. Mar ked dereases in hepati and renal blood
More informationNormal Human Blood Glucose and Insulin Levels
Presented at the COMSOL Conferene 2010 Boston Normal Human Blood Gluose and Insulin Levels In healthy humans, blood gluose levels have to be maintained in a relatively narrow range (3.5 7.0 mm, 60 130
More informationThe burden of smoking-related ill health in the United Kingdom
The burden of smoking-related ill health in the United Kingdom S Allender, R Balakrishnan, P Sarborough, P Webster, M Rayner Researh paper Department of Publi Health, University of Oxford, Oxford, UK Correspondene
More informationa b Pml F/F Prrx1-cre f 1.4 n.s.
a b Pml F/F Prrx1-re X Prrx1-re-Pml F/F Relative CFU-F numbers 2. Prrx1-Cre-PML +/+ n.s. d early passages e f 1.4 n.s. Adsorbane Adsorbane.8.6.4.2.8.6.4.2 1 2 3 4 days in ulture late passages 2 4 6 8 1
More informationDiabetologia Springer-Verlag 1986
Diabetoloia (1986) 29:383-387 Diabetoloia Spriner-Verla 1986 In vivo quantifiation of removal of asialo-orosomuoid from the irulation in anaesthetized streptozotoin-diabeti rats M. Appel 1, P. Potrat 1,
More informationSupplementary Table 1. Primer Sequences Used for Quantitative Real-Time PCR
Supplementary Table 1. Primer Sequences Used for Quantitative Real-Time PCR Gene Forward Primer (5-3 ) Reverse Primer (5-3 ) cadl CTTGGGGGCGCGTCT CTGTTCTTTTGTGCCGTTTCG cyl-coenzyme Dehydrogenase, very
More informationWT;ATTAC-5 ** ** SkM
SUPPLEMENTARY INFORMATION doi:.3/nature a WT;ATTAC- H/H;ATTAC- WT;ATTAC- H/H;ATTAC- 3 weeks months GFP p Inka relative expression 3 SkM Skel. Mus. FKBP- relative expression SkM Skel. Mus. relative expression
More informationSupplementary Table 2. Plasma lipid profiles in wild type and mutant female mice submitted to a HFD for 12 weeks wt ERα -/- AF-1 0 AF-2 0
Supplementary Table 1. List of specific primers used for gene expression analysis. Genes Primer forward Primer reverse Hprt GCAGTACAGCCCCAAAATGG AACAAAGTCTGGCCTGTATCCA Srebp-1c GGAAGCTGTCGGGGTAGCGTC CATGTCTTCAAATGTGCAATCCAT
More informationRecent advances in basic science BACTERIAL INTERACTIONS WITH CELLS OF THE INTESTINAL MUCOSA: TOLL- LIKE RECEPTORS AND NOD2
1182 Reent advanes in basi siene BACTERIAL INTERACTIONS WITH CELLS OF THE INTESTINAL MUCOSA: TOLL- LIKE RECEPTORS AND NOD2 Published online first 19 April 2005 Correspondene to: Dr E Cario, University
More informationFilippo Crea, Gaetano A Lanza
See end of artile for authors affiliations Correspondene to: Professor Filippo Crea, Istituto di Cardiologia, Università Cattolia del Saro Cuore, Largo A. Gemelli, 8, 00168 Roma, Italy; f.rea@tisalinet.it
More informationRole of the actin cytoskeleton on epithelial Na
Kidney International, Vol. 48 (1995), pp. 970 984 Role of the atin ytoskeleton on epithelial Na hannel regulation Hoiio F. ANTIELLO Renal Unit, Massahusetts General Hospital and Department of Mediine,
More informationPARKINSON S DISEASE: MODELING THE TREMOR AND OPTIMIZING THE TREATMENT. Keywords: Medical, Optimization, Modelling, Oscillation, Noise characteristics.
PARKINSON S DISEASE: MODELING THE TREMOR AND OPTIMIZING THE TREATMENT Mohammad Haeri, Yashar Sarbaz and Shahriar Gharibzadeh Advaned Control System Lab, Eletrial Engineering Department, Sharif University
More informationA microrna-34a/fgf21 Regulatory Axis and Browning of White Fat
A microrna-34a/fgf21 Regulatory Axis and Browning of White Fat Jongsook Kim Kemper, Ph.D Department of Molecular and Integrative Physiology, University of Illinois at Urbana-Champaign, USA 213 International
More informationTNFa-induced GM-CSF release from human airway smooth muscle cells depends on activation of an ET-1 autoregulatory positive feedback mechanism
Additional details of the methods and results, and an additional figure are published online only at http://thorax.bmj. om/ontent/vol64/issue12 1 Department of Pneumology, Clini III for Internal Mediine,
More informationGPR120 *** * * Liver BAT iwat ewat mwat Ileum Colon. UCP1 mrna ***
a GPR120 GPR120 mrna/ppia mrna Arbitrary Units 150 100 50 Liver BAT iwat ewat mwat Ileum Colon b UCP1 mrna Fold induction 20 15 10 5 - camp camp SB202190 - - - H89 - - - - - GW7647 Supplementary Figure
More informationStress is an essential component of an organism s attempt
Timing and bistability in the hypothalami-pituitary-adrenal axis: a model for onset and exposure therapy of stress disorders Lae Un Kim, Maria D Orsogna, Tom Chou Department of iomathematis, UCL, Los ngeles,
More informationEFFECT OF DIFFERENT METHODS OF PRESERVATION ON THE QUALITY OF CATTLE AND GOAT MEAT. Abstract
Bang. J. Anim. Si. 2009, 38(1&2) : 86 91 ISSN 0003-3588 EFFECT OF DIFFERENT METHODS OF PRESERVATION ON THE QUALITY OF CATTLE AND GOAT MEAT S. Bin. Faisal, S. Akhter 1 and M. M. Hossain Abstrat The study
More informationIdentification of an adipose tissue-like lipoprotein lipase in perfusates of chicken liver
Identifiation of an adipose tissue-like lipoprotein lipase in perfusates of hiken liver Andre Bensadoun and Tung Liu Koh Division of Nutritional Sienes and Division of Biologial Sienes, Cornel1 University,
More informationM E Guicciardi, G J Gores
1024 RECENT ADVANCES IN BASIC SCIENCE APOPTOSIS: A MECHANISM OF ACUTE AND CHRONIC LIVER INJURY See end of artile for authors affiliations Correspondene to: Dr G J Gores, Mayo Clini College of Mediine,
More informationConditioned inhibition in taste aversion learning: Testing methodology and empirical status
Animal Learning & Behavior 1986. 14 (1). 6-14 Conditioned inhibition in taste aversion learning: Testing methodology and empirial status ANDREW R. DELAMATER, JOHN M. KRUSE, STUART MARLIN, and VINCENT M.
More informationbetween normal children and children with primary
Arhives of Disease in Childhood, 1989, 64, 224-228 odium transport in erythroytes: differenes between normal hildren and hildren with primary and seondary hypertension M UCHIYAMA, V HAH, C E DAMAN WILLEM,
More informationIncentive Downshifts Evoke Search Repertoires in Rats
Journal of Experimental Psyhology: Animal Behavior Proesses 1999, Vol. 25, No. 2,153-167 Copyright 1999 by the Amerian Psyhologial Assoiation, In. 0097-7403/99/$3.00 Inentive Downshifts Evoke Searh Repertoires
More informationImpaired acetaldehyde oxidation in alcoholics*
Impaired aetaldehyde oxidation in aloholis* K R PALMR and W J JNKINSt From the Aademi Department of Mediine, Royal Free Hospital, London Gut, 1982, 23, 729-733 SUMMARY High blood aetaldehyde levels in
More informationCHROMATIC-CONTRAST THRESHOLD IMP AIRMENT IN DIABETES
CHROMATCCONTRAST THRESHOLD MP ARMENT N DABETES S. J. TREGEAR 1, P. J. KNOWLES 2, L. G. RPLEy 3 and A. G. CASSWELL 2 Glasow and Brihton SUMMARY A prospetive study was arried out to investiate aquired olourvision
More informationRegulation of spike timing in visual cortical circuits
Regulation of spike timing in visual ortial iruits Paul Tiesinga*, Jean-Mar Fellous and Terrene J. Sejnowski Abstrat A train of ation potentials (a spike train) an arry information in both the average
More informationPharmacological inhibition of S6K1 increases glucose metabolism and Akt signalling in vitro and in diet-induced obese mice
Diabetologia (6) 9:9 6 DOI.7/s--89-6 ARTICLE Pharmaologial inhibition of K inreases gluose metabolism and Akt signalling in vitro and in diet-indued obese mie Mihael Shum & Kerstin Bellmann & Philippe
More informationa-4/b-1 and a-l/b-2 integrins mediate cytokine induced lung leukocyte-epithelial adhesion and injury
British Journal of Pharmaology (27) 152, 915 929 & 27 Nature Publishing Group All rights reserved 7 1188/7 $3. www.brjpharmaol.org RESEARCH PAPER a-4/b-1 and a-l/b-2 integrins mediate ytokine indued lung
More informationR E Clouse, P J Lustman
1332 Reent advanes in linial pratie USE OF PSYCHOPHARMACOLOGICAL AGENTS FOR FUNCTIONAL GASTROINTESTINAL DISORDERS See end of artile for authors affiliations Correspondene to: Professor R E Clouse, Division
More informationCaroline P D Wheeler-Jones
1366 Take the online multiple hoie questions assoiated with this artile (see page 1374) T Basi siene CELL SIGNALLING IN THE CARDIOVASCULAR SYSTEM: AN OVERVIEW Caroline P D Wheeler-Jones Heart 2005; 91:1366
More informationA novel approach to regulate cell membrane permeability for ATP and NADH. formations in Saccharomyces cerevisiae induced by air cold plasma 1
A novel approah to regulate ell membrane permeability for ATP and NADH formations in Saharomyes erevisiae indued by air old plasma 1 Xiaoyu DONG ( 董晓宇 ), Tingting LIU ( 刘婷婷 ), Yuqin XIONG ( 熊玉琴 ) Shool
More informationImmediate Effect of Shavasana on Cardiac Output and S ystemic Peripheral Resistance in Untrained Young Adults
ISSN 2231-4261 ORIGINAL ARTICLE Immediate Effet of Shavasana on Cardia Output and S ystemi Peripheral Resistane in Untrained Young Adults Department of Physiology, Saraswathi Institute of Medial Sienes,
More informationDaily Illness Characteristics and
Daily Illness Charateristis and Health Care Deisions of Older People Tom Hikey Hiroko Akiyama University of Mihigan William Rakowski Brown University Although investigations of health are deision making
More informationSupplementary Information
Supplementary Information Optial ontrolling reveals time-dependent roles for adult-orn dentate granule ells Yan Gu, Maithe Arruda-Carvalho 3,4, Jia Wang, Stephen Janoshka,, Sheena Josselyn 3-5, Paul Frankland
More informationOnset, timing, and exposure therapy of stress disorders: mechanistic insight from a mathematical model of oscillating neuroendocrine dynamics
Kim et al. RESEARCH Onset, timing, and exposure therapy of stress disorders: mehanisti insight from a mathematial model of osillating neuroendorine dynamis Lae Kim, Maria D Orsogna 2 and Tom Chou 3* *
More informationLung function studies before and after a work shift
British J6urnal ofindustrial Mediine 1983;40:153-159 Lung funtion studies before and after a work shift R G LOVE From the Institute of Oupational Mediine, Edinburgh EH8 9SU, UK ABSTRAT The lung funtion
More informationSUPPLEMENTARY INFORMATION
doi: 1.138/nature7221 Brown fat selective genes 12 1 Control Q-RT-PCR (% of Control) 8 6 4 2 Ntrk3 Cox7a1 Cox8b Cox5b ATPase b2 ATPase f1a1 Sirt3 ERRα Elovl3/Cig3 PPARα Zic1 Supplementary Figure S1. stimulates
More informationEpigenetic and transcriptional signatures of stable versus plastic differentiation of proinflammatory
Epigeneti and transriptional signatures of stable versus plasti differentiation of proinflammatory gd T ell subsets Nina Shmolka,5, Karine Serre,5, Ana R Grosso, Margarida Rei,2, Daniel J Pennington 2,
More informationM ore than 25% of the U.S. population
C O N S E N S U S R E P O R T Diabetes in Older Adults M. SUE KIRKMAN, MD 1 VANESSA JONES BRISCOE, PHD, NP, CDE 2 NATHANIEL CLARK, MD, MS, RD 3 HERMES FLOREZ, MD, MPH, PHD 4 LINDA B. HAAS, PHC, RN, CDE
More informationCyclic Fluctuations of the Alveolar Carbon Dioxide Tension during the Normal Menstrual Cycle
Cyli Flutuations of the Alveolar Carbon Dioxide Tension during the Normal Menstrual Cyle Ruth L. Goodland, M.S., and W. T. Pommerenke, Ph.D., M.D. THE SHORT spa~ of funtional life of the unfertilized human
More informationRATING SCALES FOR NEUROLOGISTS
iv22 RATING SCALES FOR NEUROLOGISTS Correspondene to: Dr Jeremy Hobart, Department of Clinial Neurosienes, Peninsula Medial Shool, Derriford Hospital, Plymouth PL6 8DH, UK; Jeremy.Hobart@ phnt.swest.nhs.uk
More informationShift work is a risk factor for increased total cholesterol level: a 14-year prospective cohort study in 6886 male workers
Original artile 1 Department of Oupational and Environmental Mediine, Graduate Shool of Mediine, Chiba University, Chiba, Japan; 2 Center for Preventive Medial Siene, Chiba University, Chiba, Japan; 3
More informationEffects of training to implement new working methods to reduce knee strain in floor layers. A twoyear
Department of Oupational Mediine, Region Hospital Skive, Denmark Correspondene to: Dr L K Jensen, Department of Oupational Mediine, Region Hospital Skive, Resenvej 25, DK- 7800 Skive, Denmark; lilli.kirkeskov.jensen@
More information