Estrogen receptor beta regulates locus-specific DNA methylation a possible mechanism for epigenetic effects of endocrine disrupters
|
|
- Daniella May
- 5 years ago
- Views:
Transcription
1 Estrogen receptor beta regulates locus-specific DNA methylation a possible mechanism for epigenetic effects of endocrine disrupters Joëlle Rüegg Swedish Toxicology Science Research Center, Swetox Karolinska Institutet
2 EDCs and human health Bisphenol A Epigenetic mechanisms Behavioural and psychiatric disorders Phthalates DNA methylation Cancer Methoxychlor Histone code Impaired sexual development Decreased fertility Dioxins The study of heritable changes in gene function that cannot be explained by changes in the genetic sequence Obesity and diabetes II
3 Regulation of DNA methylation 5mC C + BER 5caC 5fC 5hmC But how are these factors targeted? February 15, 16 Reik and Walter, Nature Reviews, 1
4 EDC targets bind to specific genomic loci Nucleus ER ER ERE Estrogen receptor alpha & beta Androgen receptor Glucocortiocoid receptor Thyroid hormone receptor Retinoic acid receptors Arylhydrocarbon receptor Can ERs (and other nuclear receptors) regulate DNA methylation? Is this a mechanism underlying epigenetic effects of EDCs?
5 % methylation relative enrichment relative relative enrichment 5 1 ERb is involved in 5 regulation of DNA methylation CpG CpG HoxA 9 HoxA 9 CpG CpG wt wt berko berkoherb berkoherb 1 1 HKm HoxA9 HoxA9 HKm wt wt berko berko berkoherb berkoherb HKm HKm 55 hypermethylated loci 16 hypomethylated loci HK7m HK7m HoxA9 HoxA9 K7m HK7m HK9m HK9m HK9m HK9m wt wt berko berkoherb berkoherb wt wt berko berko berkoherb berkoherb Liu et al., in revision
6 6 ERbeta interacts with relative enrichment 5mC Far western blot analysis C 5hmC + BER 5caC 5fC ChIP in MEFs wt berko berkoherb Liu et al., in revision ERb interacts with and recruits it to regions that are differentially methylated in the absence of ERb HoxA1 Tnfaip Pitx1
7 7 Working model ESC Differentiation Neuron TET EDCs ER DNMT ER C 5mC 5hmC 5fC 5caC HT mouse hippocampal cells Change to medium w/o BPA Fkbp5 Harvest days days Differentiation +/- BPA
8 Fkbp51/actin ratio relative expression relative expression relative expression D 8 ERbeta mediates effects of BPA on DNA methylation CpG 5 DNA methylation at Fkbp5 CpG 6 Fkbp5 methylation # no BPA 1 nm BPA B C B C Fkbp5 expression sh 1 nm BPA ERb expression 1 nm BPA 1 nm BPA sherbeta Fkbp5 expression ### # sh sherb.5. sh sherb Kitraki et al., MCE 15 shc
9 9 Summary ESC Differentiation Neuron TET EDCs ER DNMT ER C 5mC 5hmC 5fC 5caC ERb ko leads to differentially methylated loci ERb interacts with is ERb-dependently recruited to genes whose methylation is regulated by ERb BPA exposure during differentiation/development affects methylation of Fkbp5 ERb is involved in mediating BPA s effect on Fkbp5 methylation
10 1 Thanks to All my colleagues at My collaborators and former colleagues Group Ekström National and Kapodistrian University of Athens: Efthymia Kitraki Group Schär Genomatix GmbH: Nancy Bretschneider Martin Seifert you for your attention! Fonds zur Förderung des akademischen Nachwuchses
11 11
12 relative expression Fkbp51/ Gapdh ratio Fkbp51/ Gapdh ratio Fkbp51/actin Fkbp nm BPA 1 nm BPA 1 nm BPA..5 Connecting Figure in vitro and in vivo results Figure 1 (small basal column size) a. BPA a. In utero exposure to BPA BPA HT cells undifferentiated Change differentiated to medium BPA w/o BPA/ICI Harvest B d BPA d days days h rfkbp5 intron 5 1 Differentiation +/- BPA, +/- ICI rfkbp5 intron 5 Dex treatment mfkbp5 intron 5 rfkbp5 intron 5 69 bp mfkbp5 intron 5 mfkbp5 intron 5 68 bp Fkbp5 expression e e CpG 5 Liu et al., Life Sciences, DNA methylation at Fkbp5 CpG 5 CpG 6 b no BPA nm BPA 1. CpG CpG1 CpG basal CpG b no BPA 1 nm BPA CpG CpG CpG6 CpG1. post stress CpG basal CpG CpG Fkbp51 expression CpG7 C BPA Kitraki et al., MCE 15 CpG5 1 CpG6 post stress CpG1 CpG7 DNA methylation male at Fkbp5 CpG CpG BPA CpG CpG5 post stress Panagiotidou et al., J. Endo 1 CpG6 CpG7
Mechanisms underlying epigene2c effects of endocrine disrup2ve chemicals. Joëlle Rüegg
Mechanisms underlying epigene2c effects of endocrine disrup2ve chemicals Joëlle Rüegg 2 EDCs and human health Bisphenol A Epigenetic mechanisms Behavioural and psychiatric disorders Phthalates DNA methylation
More informationDOHaD: Role of environmental chemical exposures
DOHaD: Role of environmental chemical exposures Linda S. Birnbaum, Ph.D., D.A.B.T., A.T.S. Director, National Institute of Environmental Health Sciences and National Toxicology Program PPTox-IV Boston,
More informationEndocrine Disrupters as Obesogens
Endocrine Disrupters as Obesogens Is the environment making us fat? Bruce Blumberg, Ph.D. Department of Developmental and Cell Biology Department of Pharmaceutical Sciences Developmental Biology Center
More informationNot IN Our Genes - A Different Kind of Inheritance.! Christopher Phiel, Ph.D. University of Colorado Denver Mini-STEM School February 4, 2014
Not IN Our Genes - A Different Kind of Inheritance! Christopher Phiel, Ph.D. University of Colorado Denver Mini-STEM School February 4, 2014 Epigenetics in Mainstream Media Epigenetics *Current definition:
More informationDominic J Smiraglia, PhD Department of Cancer Genetics. DNA methylation in prostate cancer
Dominic J Smiraglia, PhD Department of Cancer Genetics DNA methylation in prostate cancer Overarching theme Epigenetic regulation allows the genome to be responsive to the environment Sets the tone for
More informationPOLICY BRIEF. EDC-MixRisk
EDC-MixRisk POLICY BRIEF The endocrine disrupting properties of chemicals, and mixtures thereof, have become a global concern. A normally functioning healthy endocrine system is essential for our ability
More informationThe Big Picture of Trace chemicals
Impacts of Trace Chemicals on the Environment David O. Norris Integrative Physiology University of Colorado at Boulder david.norris@colorado.edu The Big Picture of Trace chemicals And how we all fit into
More informationFigure S1A. Blood glucose levels in mice after glucose injection
## Figure S1A. Blood glucose levels in mice after glucose injection Blood glucose (mm/l) 25 2 15 1 5 # 15 3 6 3+3 Time after glucose injection (min) # Figure S1B. α-kg levels in mouse livers after glucose
More informationExposures and Heritable Health Effects
Exposures and Heritable Health Effects Thaddeus T. Schug Population Health Branch National Institute of Environmental Health Sciences November 30, 2017 Outline Developmental exposures and health effects
More informationEffects of TBCO on the Reproductive Capacity of 2 Generations of Japanese Medaka (Oryzias latipes)
Effects of on the Reproductive Capacity of 2 Generations of Japanese Medaka (Oryzias latipes) Br Br Br Br Steve Wiseman University of Saskatchewan Multigenerational Effects Pesticides Vinclozolin (anti-androgen)
More informationSUPPLEMENTARY FIGURES: Supplementary Figure 1
SUPPLEMENTARY FIGURES: Supplementary Figure 1 Supplementary Figure 1. Glioblastoma 5hmC quantified by paired BS and oxbs treated DNA hybridized to Infinium DNA methylation arrays. Workflow depicts analytic
More informationBisphenol A Exposure Disrupts Genomic Imprinting in the Mouse
Bisphenol A Exposure Disrupts Genomic Imprinting in the Mouse Martha Susiarjo 1,2, Isaac Sasson 3, Clementina Mesaros 4, Marisa S. Bartolomei 1,2 * 1 Department of Cell and Developmental Biology, University
More informationEpigenetic Pathways Linking Parental Effects to Offspring Development. Dr. Frances A. Champagne Department of Psychology, Columbia University
Epigenetic Pathways Linking Parental Effects to Offspring Development Dr. Frances A. Champagne Department of Psychology, Columbia University Prenatal & Postnatal Experiences Individual differences in brain
More informationGCATCCATCTTGGGGCGTCCCAATTGCTGAGTAACAAATGAGACGC TGTGGCCAAACTCAGTCATAACTAATGACATTTCTAGACAAAGTGAC TTCAGATTTTCAAAGCGTACCCTGTTTACATCATTTTGCCAATTTCG
Lecture 6 GCATCCATCTTGGGGCGTCCCAATTGCTGAGTAACAAATGAGACGC TGTGGCCAAACTCAGTCATAACTAATGACATTTCTAGACAAAGTGAC TTCAGATTTTCAAAGCGTACCCTGTTTACATCATTTTGCCAATTTCG CGTACTGCAACCGGCGGGCCACGCCCCCGTGAAAAGAAGGTTGTT TTCTCCACATTTCGGGGTTCTGGACGTTTCCCGGCTGCGGGGCGG
More informationI have no financial disclosures
The Environment and Reproductive Health: Why What We Eat, Breath and Touch Matters Susan.Davidson@SSMHealth.com Susan Davidson, MD Dean Medical Center I have no financial disclosures 1 Many Complex Factors
More informationEndocrine Disrupter Chemicals: Universal Access to Healthcare
Endocrine Disrupter Chemicals: the right to know Riana Bornman, School of Health Systems and Public Health, University of Pretoria SAMA Conference 2016 Universal Access to Healthcare Concern started SOS-EDCs
More informationBisphenol A (BPA) and Cardiovascular diseases in Lebanon
Bisphenol A (BPA) and Cardiovascular diseases in Lebanon Mona Nasrallah M.D Internal Medicine, Endocrinology Second Annual VMP Research Retreat American University of Beirut August 24, 2013 Assessment
More informationDNA methylation & demethylation
DNA methylation & demethylation Lars Schomacher (Group Christof Niehrs) What is Epigenetics? Epigenetics is the study of heritable changes in gene expression (active versus inactive genes) that do not
More informationEnvironmental and Developmental Origins of Ovarian Reserve. Nick Macklon Professor of Obstetrics and Gynaecology, University of Southampton, UK.
Environmental and Developmental Origins of Ovarian Reserve Nick Macklon Professor of Obstetrics and Gynaecology, University of Southampton, UK. Why worry? Women delaying childbirth Diminished ovarian
More informationEpigenetics: The Future of Psychology & Neuroscience. Richard E. Brown Psychology Department Dalhousie University Halifax, NS, B3H 4J1
Epigenetics: The Future of Psychology & Neuroscience Richard E. Brown Psychology Department Dalhousie University Halifax, NS, B3H 4J1 Nature versus Nurture Despite the belief that the Nature vs. Nurture
More informationDNA Methylation and Cancer
DNA Methylation and Cancer October 25, 2016 Dominic Smiraglia, Ph.D. Department of Cancer Genetics From Alan Wolffe, Science and Medicine, 1999 Vital Statistics Human genome contains 3 billion bp ~ 50,000
More informationEpigenetics DNA methylation. Biosciences 741: Genomics Fall, 2013 Week 13. DNA Methylation
Epigenetics DNA methylation Biosciences 741: Genomics Fall, 2013 Week 13 DNA Methylation Most methylated cytosines are found in the dinucleotide sequence CG, denoted mcpg. The restriction enzyme HpaII
More informationSupplemental Figure 1. Genes showing ectopic H3K9 dimethylation in this study are DNA hypermethylated in Lister et al. study.
mc mc mc mc SUP mc mc Supplemental Figure. Genes showing ectopic HK9 dimethylation in this study are DNA hypermethylated in Lister et al. study. Representative views of genes that gain HK9m marks in their
More informationSession 2: Biomarkers of epigenetic changes and their applicability to genetic toxicology
Session 2: Biomarkers of epigenetic changes and their applicability to genetic toxicology Bhaskar Gollapudi, Ph.D The Dow Chemical Company Workshop: Genetic Toxicology: Opportunities to Integrate New Approaches
More informationThe role of DNMT3A and HOXA9 hypomethylation in acute myeloid leukemia (AML)
Campbell Drohan BIOL 463 December 2016 The role of DNMT3A and HOXA9 hypomethylation in acute myeloid leukemia (AML) Introduction Epigenetic modifications of DNA and histones are key to gene regulation
More informationTowards 2020: Linda S. Birnbaum, Ph.D., D.A.B.T., A.T.S. Director National Institute of Environmental Health Sciences National Toxicology Program
Towards 2020: What are the Critical Environmental Health Challenges? Linda S. Birnbaum, Ph.D., D.A.B.T., A.T.S. Director National Institute of Environmental Health Sciences National Toxicology Program
More informationStem Cell Epigenetics
Stem Cell Epigenetics Philippe Collas University of Oslo Institute of Basic Medical Sciences Norwegian Center for Stem Cell Research www.collaslab.com Source of stem cells in the body Somatic ( adult )
More informationDissecting the role of H3K64me3 in mouse pericentromeric heterochromatin.
Supplementary Information Dissecting the role of H3K64me3 in mouse pericentromeric heterochromatin. Ulrike C. Lange 1, Stéphanie Siebert 2, Mark Wossidlo 3,4, Thomas Weiss 1, Céline Ziegler- Birling 2,
More informationGenomic Methods in Cancer Epigenetic Dysregulation
Genomic Methods in Cancer Epigenetic Dysregulation Clara, Lyon 2018 Jacek Majewski, Associate Professor Department of Human Genetics, McGill University Montreal, Canada A few words about my lab Genomics
More informationSupplementary Figures
Supplementary Figures Supplementary Figure 1. Confirmation of Dnmt1 conditional knockout out mice. a, Representative images of sorted stem (Lin - CD49f high CD24 + ), luminal (Lin - CD49f low CD24 + )
More informationFragile X Syndrome. Genetics, Epigenetics & the Role of Unprogrammed Events in the expression of a Phenotype
Fragile X Syndrome Genetics, Epigenetics & the Role of Unprogrammed Events in the expression of a Phenotype A loss of function of the FMR-1 gene results in severe learning problems, intellectual disability
More informationEpigenetics. Lyle Armstrong. UJ Taylor & Francis Group. f'ci Garland Science NEW YORK AND LONDON
... Epigenetics Lyle Armstrong f'ci Garland Science UJ Taylor & Francis Group NEW YORK AND LONDON Contents CHAPTER 1 INTRODUCTION TO 3.2 CHROMATIN ARCHITECTURE 21 THE STUDY OF EPIGENETICS 1.1 THE CORE
More informationEveryday Chemical Exposures and Breast Cancer: Why are we concerned? What can we do? Janet M. Gray, Ph.D. Vassar College Breast Cancer Fund
Everyday Chemical Exposures and Breast Cancer: Why are we concerned? What can we do? Janet M. Gray, Ph.D. Vassar College Breast Cancer Fund General Risks Factors Associated with Cancer Genes Primary mutations
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2607 Figure S1 Elf5 loss promotes EMT in mammary epithelium while Elf5 overexpression inhibits TGFβ induced EMT. (a, c) Different confocal slices through the Z stack image. (b, d) 3D rendering
More informationTrace Metals and Placental Methylation
Trace Metals and Placental Methylation Carmen J. Marsit, PhD Pharmacology & Toxicology Epidemiology Geisel School of Medicine at Dartmouth Developmental Origins Environmental Exposure Metabolic Cardiovascular
More information3.D- Cell Communication
3.D- Cell Communication Big Idea 3: Living systems store, retrieve, transmit and respond to information essential to life processes. EU 3.A: Heritable information provides for continuity of life. EU 3.B:
More informationAllelic reprogramming of the histone modification H3K4me3 in early mammalian development
Allelic reprogramming of the histone modification H3K4me3 in early mammalian development 张戈 Method and material STAR ChIP seq (small-scale TELP-assisted rapid ChIP seq) 200 mouse embryonic stem cells PWK/PhJ
More informationEndocrine Disrupting Chemicals: New considerations in the toxics space TURI Annual Meeting
Endocrine Disrupting Chemicals: New considerations in the toxics space TURI Annual Meeting Laura N. Vandenberg, PhD UMass Amherst School of Public Health April 25, 2018 Disclosure statement I am funded
More informationEpigenetics: A historical overview Dr. Robin Holliday
Epigenetics 1 Rival hypotheses Epigenisis - The embryo is initially undifferentiated. As development proceeds, increasing levels of complexity emerge giving rise to the larval stage or to the adult organism.
More informationDecoding UCMR3: Clear Communication about Drinking Water Contaminants
Decoding UCMR3: Clear Communication about Drinking Water Contaminants Christopher P Weis, Ph.D., D.A.B.T. Office of the Director National Institute of Environmental Health Science and National Toxicology
More informationSAB Report to the Board of the Glass Packaging Institute
SAB Report to the Board of the Glass Packaging Institute A Brief Overview of Significant Studies on BPA During 2013 November, 2013 Glass is ENDLESSLY Recyclable Introduction Number and diversity of studies
More informationR. Piazza (MD, PhD), Dept. of Medicine and Surgery, University of Milano-Bicocca EPIGENETICS
R. Piazza (MD, PhD), Dept. of Medicine and Surgery, University of Milano-Bicocca EPIGENETICS EPIGENETICS THE STUDY OF CHANGES IN GENE EXPRESSION THAT ARE POTENTIALLY HERITABLE AND THAT DO NOT ENTAIL A
More informationDioxin induces Ahr-dependent robust DNA demethylation of the Cyp1a1 promoter via Tdg in the mouse liver
Dioxin induces Ahr-dependent robust DNA demethylation of the Cypa promoter via Tdg in the mouse liver Hesbon Z. Amenya, Chiharu Tohyama, Seiichiroh Ohsako Laboratory of Environmental Health Sciences, Center
More informationEpigenetic Variation in Human Health and Disease
Epigenetic Variation in Human Health and Disease Michael S. Kobor Centre for Molecular Medicine and Therapeutics Department of Medical Genetics University of British Columbia www.cmmt.ubc.ca Understanding
More informationBisphenol A (BPA) Affects Reproductive Formation across Generations in Mice
NOTE Anatomy Bisphenol A (BPA) Affects Reproductive Formation across Generations in Mice Masato HIYAMA 1), Ehn-Kyong CHOI 2), Shoichi WAKITANI 1), Toru TACHIBANA 1), Hamayun KHAN 1), Ken Takeshi KUSAKABE
More informationSupplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity.
Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity. (a) Relative amounts of adiponectin, Ppar 2, C/ebp, and Tnf mrna
More informationEpigenetics Armstrong_Prelims.indd 1 04/11/2013 3:28 pm
Epigenetics Epigenetics Lyle Armstrong vi Online resources Accessible from www.garlandscience.com, the Student and Instructor Resource Websites provide learning and teaching tools created for Epigenetics.
More informationNature Structural & Molecular Biology: doi: /nsmb.2419
Supplementary Figure 1 Mapped sequence reads and nucleosome occupancies. (a) Distribution of sequencing reads on the mouse reference genome for chromosome 14 as an example. The number of reads in a 1 Mb
More informationGene Expression DNA RNA. Protein. Metabolites, stress, environment
Gene Expression DNA RNA Protein Metabolites, stress, environment 1 EPIGENETICS The study of alterations in gene function that cannot be explained by changes in DNA sequence. Epigenetic gene regulatory
More informationEndocrine Disrupted By Darlene M, Rose HHP READ ONLINE
Endocrine Disrupted By Darlene M, Rose HHP READ ONLINE 1.2 What is the definition of endocrine disruptors? Endocrine disruption is not, in itself, a measure of toxicity the occurrence of adverse health
More informationEndocrine Disruptors, Crustacean Molting and Bivalve Populations. Peter L. defur Virginia Commonwealth University Richmond VA
Endocrine Disruptors, Crustacean Molting and Bivalve Populations Peter L. defur Virginia Commonwealth University Richmond VA Not so long ago, and not so far away We are certain of the following: a large
More informationEndocrine disrupting activity of chemicals used in hydraulic fracturing for natural gas and oil
Endocrine disrupting activity of chemicals used in hydraulic fracturing for natural gas and oil Susan C. Nagel, PhD, Associate Professor Obstetrics, Gynecology and Women s Health University of Missouri
More informationI) Development: tissue differentiation and timing II) Whole Chromosome Regulation
Epigenesis: Gene Regulation Epigenesis : Gene Regulation I) Development: tissue differentiation and timing II) Whole Chromosome Regulation (X chromosome inactivation or Lyonization) III) Regulation during
More informationRALYL Hypermethylation: A Potential Diagnostic Marker of Esophageal Squamous Cell Carcinoma (ESCC) Junwei Liu, MD
RALYL Hypermethylation: A Potential Diagnostic Marker of Esophageal Squamous Cell Carcinoma (ESCC) Junwei Liu, MD Aurora Healthcare, Milwaukee, WI INTRODUCTION v Epigenetic aberration and genetic alteration
More informationHormonally active contaminants- Interactions and effects on food safety. Helen Håkansson
Hormonally active contaminants- Interactions and effects on food safety Contents EDC definition and effects Effects of dioxin-like compounds TEQ concept and TEF values for dioxin-like compound Need of
More informationEndometrio ed endometriosi: the same tissue?
Endometrio ed endometriosi: the same tissue? Valentino Remorgida Clinica Ostetrica e Ginecologica IRCCS Azienda Ospedaliera Universitaria San Martino IST Istituto Nazionale per la Ricerca sul Cancro, Università
More informationEPIGENOMICS PROFILING SERVICES
EPIGENOMICS PROFILING SERVICES Chromatin analysis DNA methylation analysis RNA-seq analysis Diagenode helps you uncover the mysteries of epigenetics PAGE 3 Integrative epigenomics analysis DNA methylation
More informationA fully Bayesian approach for the analysis of Whole-Genome Bisulfite Sequencing Data
A fully Bayesian approach for the analysis of Whole-Genome Bisulfite Sequencing Data Leonardo Bottolo 1,2,3 1 Department of Medical Genetics, University of Cambridge, UK 2 The Alan Turing Institute, London,
More informationSynthetic EDCs at the present human exposure ARE NO RISK for human health Prof. Dan Dietrich University of Konstanz 1
Synthetic EDCs at the present human exposure ARE NO RISK for human health 21.03.18 Prof. Dan Dietrich University of Konstanz 1 What are EDCs 2013 Berlaymont Declaration defines EDC Makes NO distinction
More informationNature Immunology: doi: /ni Supplementary Figure 1. Characteristics of SEs in T reg and T conv cells.
Supplementary Figure 1 Characteristics of SEs in T reg and T conv cells. (a) Patterns of indicated transcription factor-binding at SEs and surrounding regions in T reg and T conv cells. Average normalized
More informationDynamic reprogramming of DNA methylation in SETD2- deregulated renal cell carcinoma
/, Vol. 7, No. 2 Dynamic reprogramming of DNA methylation in SETD2- deregulated renal cell carcinoma Rochelle L. Tiedemann 1, Ryan A. Hlady 2, Paul D. Hanavan 3, Douglas F. Lake 3, Raoul Tibes 4,5, Jeong-Heon
More informationEnvironmental Health Sciences
Make vampire food safe for vampires, again. Hormone-related cancers Pre-term birth Autoimmunity ADHD Endometriosis Degenerative diseases Fibroids Allergies Obesity Asthma Learning disabilities Infertility
More informationAlpha thalassemia mental retardation X-linked. Acquired alpha-thalassemia myelodysplastic syndrome
Alpha thalassemia mental retardation X-linked Acquired alpha-thalassemia myelodysplastic syndrome (Alpha thalassemia mental retardation X-linked) Acquired alpha-thalassemia myelodysplastic syndrome Schematic
More informationXenoestrogen-induced Regulation of EZH2 and Histone Methylation via Non-Genomic Estrogen
Xenoestrogen-induced Regulation of EZH2 and Histone Methylation via Non-Genomic Estrogen Receptor Signaling to PI3K/AKT Tiffany G. Bredfeldt, Kristen L. Greathouse, Stephen H. Safe, Mien-Chie Hung, Mark
More informationExamining environmental contributors to autism spectrum disorder
Examining environmental contributors to autism spectrum disorder Valerie Hu, Ph.D. Dept. of Biochemistry and Molecular Medicine School of Medicine and Health Sciences The George Washington University E-mail:
More informationEpigenetic Markers for Transplacental Exposure to Airborne Polycyclic Aromatic Hydrocarbons (PAHs( PAHs) ) and Childhood Asthma.
Epigenetic Markers for Transplacental Exposure to Airborne Polycyclic Aromatic Hydrocarbons (PAHs( PAHs) ) and Childhood Asthma Winnie Wan-yee Tang, Ph.D Department of Environmental Health University of
More informationSUPPLEMENTAL FILE. mir-22 and mir-29a are members of the androgen receptor cistrome modulating. LAMC1 and Mcl-1 in prostate cancer
1 SUPPLEMENTAL FILE 2 3 mir-22 and mir-29a are members of the androgen receptor cistrome modulating LAMC1 and Mcl-1 in prostate cancer 4 5 6 Lorenza Pasqualini 1, Huajie Bu 1,2, Martin Puhr 1, Narisu Narisu
More informationThe agouti mouse model: an epigenetic biosensor for nutritional and environmental alterations on the fetal epigenome
The agouti mouse model: an epigenetic biosensor for nutritional and environmental alterations on the fetal epigenome Dana C Dolinoy 2008 International Life Sciences Institute The ability of environmental
More informationExploring Environmental Chemicals and Risk of Breast Cancer During the Menopausal Transition
Exploring Environmental Chemicals and Risk of Breast Cancer During the Menopausal Transition Susan L. Neuhausen, Ph.D Morris and Horowitz Families Endowed Professor Beckman Research Institute of City of
More informationAnalysis of shotgun bisulfite sequencing of cancer samples
Analysis of shotgun bisulfite sequencing of cancer samples Kasper Daniel Hansen Postdoc with Rafael Irizarry Johns Hopkins Bloomberg School of Public Health Brixen, July 1st, 2011 The
More informationEpigenetic Regulation of Health and Disease Nutritional and environmental effects on epigenetic regulation
Epigenetic Regulation of Health and Disease Nutritional and environmental effects on epigenetic regulation Robert FEIL Director of Research CNRS & University of Montpellier, Montpellier, France. E-mail:
More informationTITLE: Identification of Estrogen Receptor Beta Binding Sites in the Human Genomes
AD Award Number: W81XWH-09-1-0297 TITLE: Identification of Estrogen Receptor Beta Binding Sites in the Human Genomes PRINCIPAL INVESTIGATOR: Thien Le CONTRACTING ORGANIZATION: University of Chicago, Chicago,
More informationSpermatogenesis. What is it and what does it look like? How do hormones regulate spermatogenesis?
Spermatogenesis What is it and what does it look like? How do hormones regulate spermatogenesis? FSH, androgens, growth factors Animal Physiology (Hill, Wise, Anderson): Ch. 15 435-438 1 Spermatogenesis:
More informationEpigenomics. Ivana de la Serna Block Health Science
Epigenomics Ivana de la Serna Block Health Science 388 383-4111 ivana.delaserna@utoledo.edu Outline 1. Epigenetics-definition and overview 2. DNA methylation/hydroxymethylation 3. Histone modifications
More informationCASCADE PUBLISHABLE FINAL ACTIVITY REPORT
Project no: FOOD-CT-2004-506319 Project acronym: CASCADE Project title: Chemicals as contaminants in the food chain: an NoE for research, risk assessment and education Instrument: Network of Excellence
More informationMohammad Husain Department of Biotechnology, Jamia Millia Islamia New Delhi
Role of Vitamin D receptor (VDR) in HIV induced tubular injury Mohammad Husain Department of Biotechnology, Jamia Millia Islamia New Delhi 07/10/2015 INTRODUCTION Vitamin D is technically not a Vitamin;
More informationHormones. Hormones. When you hear the word hormones, what do you think of? When you hear the word hormones, what do you think of?
When you hear the word hormones, what When you hear the word hormones, what When you hear the word hormones, what When you hear the word hormones, what Hormones As your body s chemical messengers, hormones
More informationFrederick vom Saal Division of Biological Sciences University of Missouri-Columbia, USA
INTERNATIONAL SEMINARS ON PLANETARY EMERGENCIES 49th Session SCIENCE FOR PEACE THE WORLD OVER (THE NEW MANHATTAN PROJECT) Erice 20-23 August 2016 SESSION 8: CHILDREN WELFARE DISRUPTION OF DEVELOPMENT BY
More informationPrenatal exposure to EDCs and obesity: combining toxicology and epidemiology
EDC Strategy, CHE partnership call, June 18, 2014 Prenatal exposure to EDCs and obesity: combining toxicology and epidemiology Prof. Juliette Legler Institute for Environmental Studies, VU University Amsterdam,
More informationEnvironmental Exposures and Immune Function
Environmental Exposures and Immune Function Presented by Dr. B Paige Lawrence Professor of Environmental Medicine and of Microbiology & Immunology University of Rochester School of Medicine and Dentistry
More informationPrenatal alcohol exposure and metabolic disease in adulthood
8 th International Research Conference on Adolescents and Adults with FASD Prenatal alcohol exposure and metabolic disease in adulthood Prof Karen Moritz Director Child Health Research Centre University
More informationTITLE: Examination of the Role of DNA Methylation Changes in Prostate Cancer using the Transgenic Adenocarcinoma of Mouse Prostate (TRAMP) Model
AD Award Number: W81XWH-07-1-0153 TITLE: Examination of the Role of DNA Methylation Changes in Prostate Cancer using the Transgenic Adenocarcinoma of Mouse Prostate (TRAMP) Model PRINCIPAL INVESTIGATOR:
More informationEpigenetics and trauma
Epigenetics and trauma Influence of trauma on mental health Patrick McGowan, PhD Biological Sciences, UTSC Cell and Systems Biology, Psychology University of Toronto patrick.mcgowan@utoronto.ca Leuven,
More informationGenetics and Genomics in Medicine Chapter 6 Questions
Genetics and Genomics in Medicine Chapter 6 Questions Multiple Choice Questions Question 6.1 With respect to the interconversion between open and condensed chromatin shown below: Which of the directions
More informationMeta-analysis of IDH-mutant cancers identifies EBF1 as a novel interaction partner for
Meta-analysis of IDH-mutant cancers identifies EBF1 as a novel interaction partner for TET2 Paul Guilhamon 1, Malihe Eskandarpour 2, Dina Halai 3, Gareth A. Wilson 1, Andrew Feber 1, Andrew E. Teschendorff
More informationA Bad Start Lasts a Lifetime: Need for Green Chemistry
A Bad Start Lasts a Lifetime: Need for Green Chemistry Jerrold J. Heindel, PhD Scientific Program Administrator Division of Extramural Research and Training National Institute of Environmental Health Sciences
More informationJoanna Hillman Michael Higgins Lab Oncology for Scientists I 10/29/2015
Joanna Hillman Michael Higgins Lab Oncology for Scientists I 10/29/2015 ! Define Epigenetics & Genomic Imprinting! Discovery! What is the imprint! Lifecycle of an Imprint DMRs and ICEs! 2 main mechanisms
More informationSupplementary Fig.S1. MeDIP RPKM distribution of 5kb windows. Relative expression of DNMT. Percentage of genome. (fold change)
Supplementary Fig.S1 Percentage of genome 10% 8% 6% 4% 2% 0 MeDIP RPKM distribution of 5kb windows 0 0. 0.5 0.75 >1 MeDIP RPKM value EC Relative expression of DNMT (fold change) 12 6 4 3 2 1 EC DNMT1 DNMT2
More informationThe silence of the genes: clinical applications of (colorectal) cancer epigenetics
The silence of the genes: clinical applications of (colorectal) cancer epigenetics Manon van Engeland, PhD Dept. of Pathology GROW - School for Oncology & Developmental Biology Maastricht University Medical
More informationDisruptores Metabólicos y Obesidad
Disruptores Metabólicos y Obesidad Ángel Nadal Institute of Bioengineering and CIBERDEM, Miguel Hernández University of Elche, Alicante, Spain nadal@umh.es Funded by: European Foundation for the Study
More informationCarcinogenesis in IBD
Oxford Inflammatory Bowel Disease MasterClass Carcinogenesis in IBD Dr Simon Leedham, Oxford, UK Oxford Inflammatory Bowel Disease MasterClass Carcinogenesis in Inflammatory Bowel Disease Dr Simon Leedham
More informationHypothalamus, pituitary, and subordinate glands
Endocrine System The endocrine system is the body s slow communication system relying on three main components Endocrine glands, such as hypothalamus, pituitary, thyroid, adrenal, pancreas, gonad Hormones
More informationTransgenerational Effects of Diet: Implications for Cancer Prevention Overview and Conclusions
Transgenerational Effects of Diet: Implications for Cancer Prevention Overview and Conclusions John Milner, Ph.D. Director, USDA Beltsville Human Nutrition Research Center Beltsville, MD 20705 john.milner@ars.usda.gov
More informationWhat further research do we need in order to prevent/manage the health impact of EDCs?
What further research do we need in order to prevent/manage the health impact of EDCs? Alberto Mantovani, Toxicologist, Research director, Istituto Superiore di Sanità Roma, Italy alberto.mantovani@iss.it
More informationLarge conserved domains of low DNA methylation maintained by Dnmt3a
Supplementary information Large conserved domains of low DNA methylation maintained by Dnmt3a Mira Jeong# 1, Deqiang Sun # 2, Min Luo# 1, Yun Huang 3, Grant A. Challen %1, Benjamin Rodriguez 2, Xiaotian
More informationEndocrine Disrupting Activity Associated With Oil and Natural Gas Extraction
Endocrine Disrupting Activity Associated With Oil and Natural Gas Extraction Susan C Nagel, PhD Associate Professor Obstetrics, Gynecology, and Women s Health University of Missouri NIH R21ES026395 and
More informationGenes, Aging and Skin. Helen Knaggs Vice President, Nu Skin Global R&D
Genes, Aging and Skin Helen Knaggs Vice President, Nu Skin Global R&D Presentation Overview Skin aging Genes and genomics How do genes influence skin appearance? Can the use of Genomic Technology enable
More informationRole of CpG deserts in the epigenetic transgenerational inheritance of differential DNA methylation regions
Skinner and Guerrero-Bosagna BMC Genomics 2014, 15:692 RESEARCH ARTICLE Open Access Role of CpG deserts in the epigenetic transgenerational inheritance of differential DNA methylation regions Michael K
More informationDevelopmental Basis of Disease: A New Paradigm in Environmental Health Sciences
Developmental Basis of Disease: A New Paradigm in Environmental Health Sciences Linda S. Birnbaum, PhD, DABT, ATS Director National Institute of Environmental Health Sciences and National Toxicology Program
More informationTo: National Toxicology Program (NTP); Center for the Evaluation of Risks to Human Reproduction (CERHR)
February 2, 2007 To: National Toxicology Program (NTP); Center for the Evaluation of Risks to Human Reproduction (CERHR) From: Natural Resources Defense Council These comments are submitted by Natural
More information