Estrogen receptor beta regulates locus-specific DNA methylation a possible mechanism for epigenetic effects of endocrine disrupters

Size: px
Start display at page:

Download "Estrogen receptor beta regulates locus-specific DNA methylation a possible mechanism for epigenetic effects of endocrine disrupters"

Transcription

1 Estrogen receptor beta regulates locus-specific DNA methylation a possible mechanism for epigenetic effects of endocrine disrupters Joëlle Rüegg Swedish Toxicology Science Research Center, Swetox Karolinska Institutet

2 EDCs and human health Bisphenol A Epigenetic mechanisms Behavioural and psychiatric disorders Phthalates DNA methylation Cancer Methoxychlor Histone code Impaired sexual development Decreased fertility Dioxins The study of heritable changes in gene function that cannot be explained by changes in the genetic sequence Obesity and diabetes II

3 Regulation of DNA methylation 5mC C + BER 5caC 5fC 5hmC But how are these factors targeted? February 15, 16 Reik and Walter, Nature Reviews, 1

4 EDC targets bind to specific genomic loci Nucleus ER ER ERE Estrogen receptor alpha & beta Androgen receptor Glucocortiocoid receptor Thyroid hormone receptor Retinoic acid receptors Arylhydrocarbon receptor Can ERs (and other nuclear receptors) regulate DNA methylation? Is this a mechanism underlying epigenetic effects of EDCs?

5 % methylation relative enrichment relative relative enrichment 5 1 ERb is involved in 5 regulation of DNA methylation CpG CpG HoxA 9 HoxA 9 CpG CpG wt wt berko berkoherb berkoherb 1 1 HKm HoxA9 HoxA9 HKm wt wt berko berko berkoherb berkoherb HKm HKm 55 hypermethylated loci 16 hypomethylated loci HK7m HK7m HoxA9 HoxA9 K7m HK7m HK9m HK9m HK9m HK9m wt wt berko berkoherb berkoherb wt wt berko berko berkoherb berkoherb Liu et al., in revision

6 6 ERbeta interacts with relative enrichment 5mC Far western blot analysis C 5hmC + BER 5caC 5fC ChIP in MEFs wt berko berkoherb Liu et al., in revision ERb interacts with and recruits it to regions that are differentially methylated in the absence of ERb HoxA1 Tnfaip Pitx1

7 7 Working model ESC Differentiation Neuron TET EDCs ER DNMT ER C 5mC 5hmC 5fC 5caC HT mouse hippocampal cells Change to medium w/o BPA Fkbp5 Harvest days days Differentiation +/- BPA

8 Fkbp51/actin ratio relative expression relative expression relative expression D 8 ERbeta mediates effects of BPA on DNA methylation CpG 5 DNA methylation at Fkbp5 CpG 6 Fkbp5 methylation # no BPA 1 nm BPA B C B C Fkbp5 expression sh 1 nm BPA ERb expression 1 nm BPA 1 nm BPA sherbeta Fkbp5 expression ### # sh sherb.5. sh sherb Kitraki et al., MCE 15 shc

9 9 Summary ESC Differentiation Neuron TET EDCs ER DNMT ER C 5mC 5hmC 5fC 5caC ERb ko leads to differentially methylated loci ERb interacts with is ERb-dependently recruited to genes whose methylation is regulated by ERb BPA exposure during differentiation/development affects methylation of Fkbp5 ERb is involved in mediating BPA s effect on Fkbp5 methylation

10 1 Thanks to All my colleagues at My collaborators and former colleagues Group Ekström National and Kapodistrian University of Athens: Efthymia Kitraki Group Schär Genomatix GmbH: Nancy Bretschneider Martin Seifert you for your attention! Fonds zur Förderung des akademischen Nachwuchses

11 11

12 relative expression Fkbp51/ Gapdh ratio Fkbp51/ Gapdh ratio Fkbp51/actin Fkbp nm BPA 1 nm BPA 1 nm BPA..5 Connecting Figure in vitro and in vivo results Figure 1 (small basal column size) a. BPA a. In utero exposure to BPA BPA HT cells undifferentiated Change differentiated to medium BPA w/o BPA/ICI Harvest B d BPA d days days h rfkbp5 intron 5 1 Differentiation +/- BPA, +/- ICI rfkbp5 intron 5 Dex treatment mfkbp5 intron 5 rfkbp5 intron 5 69 bp mfkbp5 intron 5 mfkbp5 intron 5 68 bp Fkbp5 expression e e CpG 5 Liu et al., Life Sciences, DNA methylation at Fkbp5 CpG 5 CpG 6 b no BPA nm BPA 1. CpG CpG1 CpG basal CpG b no BPA 1 nm BPA CpG CpG CpG6 CpG1. post stress CpG basal CpG CpG Fkbp51 expression CpG7 C BPA Kitraki et al., MCE 15 CpG5 1 CpG6 post stress CpG1 CpG7 DNA methylation male at Fkbp5 CpG CpG BPA CpG CpG5 post stress Panagiotidou et al., J. Endo 1 CpG6 CpG7

Mechanisms underlying epigene2c effects of endocrine disrup2ve chemicals. Joëlle Rüegg

Mechanisms underlying epigene2c effects of endocrine disrup2ve chemicals. Joëlle Rüegg Mechanisms underlying epigene2c effects of endocrine disrup2ve chemicals Joëlle Rüegg 2 EDCs and human health Bisphenol A Epigenetic mechanisms Behavioural and psychiatric disorders Phthalates DNA methylation

More information

DOHaD: Role of environmental chemical exposures

DOHaD: Role of environmental chemical exposures DOHaD: Role of environmental chemical exposures Linda S. Birnbaum, Ph.D., D.A.B.T., A.T.S. Director, National Institute of Environmental Health Sciences and National Toxicology Program PPTox-IV Boston,

More information

Endocrine Disrupters as Obesogens

Endocrine Disrupters as Obesogens Endocrine Disrupters as Obesogens Is the environment making us fat? Bruce Blumberg, Ph.D. Department of Developmental and Cell Biology Department of Pharmaceutical Sciences Developmental Biology Center

More information

Not IN Our Genes - A Different Kind of Inheritance.! Christopher Phiel, Ph.D. University of Colorado Denver Mini-STEM School February 4, 2014

Not IN Our Genes - A Different Kind of Inheritance.! Christopher Phiel, Ph.D. University of Colorado Denver Mini-STEM School February 4, 2014 Not IN Our Genes - A Different Kind of Inheritance! Christopher Phiel, Ph.D. University of Colorado Denver Mini-STEM School February 4, 2014 Epigenetics in Mainstream Media Epigenetics *Current definition:

More information

Dominic J Smiraglia, PhD Department of Cancer Genetics. DNA methylation in prostate cancer

Dominic J Smiraglia, PhD Department of Cancer Genetics. DNA methylation in prostate cancer Dominic J Smiraglia, PhD Department of Cancer Genetics DNA methylation in prostate cancer Overarching theme Epigenetic regulation allows the genome to be responsive to the environment Sets the tone for

More information

POLICY BRIEF. EDC-MixRisk

POLICY BRIEF. EDC-MixRisk EDC-MixRisk POLICY BRIEF The endocrine disrupting properties of chemicals, and mixtures thereof, have become a global concern. A normally functioning healthy endocrine system is essential for our ability

More information

The Big Picture of Trace chemicals

The Big Picture of Trace chemicals Impacts of Trace Chemicals on the Environment David O. Norris Integrative Physiology University of Colorado at Boulder david.norris@colorado.edu The Big Picture of Trace chemicals And how we all fit into

More information

Figure S1A. Blood glucose levels in mice after glucose injection

Figure S1A. Blood glucose levels in mice after glucose injection ## Figure S1A. Blood glucose levels in mice after glucose injection Blood glucose (mm/l) 25 2 15 1 5 # 15 3 6 3+3 Time after glucose injection (min) # Figure S1B. α-kg levels in mouse livers after glucose

More information

Exposures and Heritable Health Effects

Exposures and Heritable Health Effects Exposures and Heritable Health Effects Thaddeus T. Schug Population Health Branch National Institute of Environmental Health Sciences November 30, 2017 Outline Developmental exposures and health effects

More information

Effects of TBCO on the Reproductive Capacity of 2 Generations of Japanese Medaka (Oryzias latipes)

Effects of TBCO on the Reproductive Capacity of 2 Generations of Japanese Medaka (Oryzias latipes) Effects of on the Reproductive Capacity of 2 Generations of Japanese Medaka (Oryzias latipes) Br Br Br Br Steve Wiseman University of Saskatchewan Multigenerational Effects Pesticides Vinclozolin (anti-androgen)

More information

SUPPLEMENTARY FIGURES: Supplementary Figure 1

SUPPLEMENTARY FIGURES: Supplementary Figure 1 SUPPLEMENTARY FIGURES: Supplementary Figure 1 Supplementary Figure 1. Glioblastoma 5hmC quantified by paired BS and oxbs treated DNA hybridized to Infinium DNA methylation arrays. Workflow depicts analytic

More information

Bisphenol A Exposure Disrupts Genomic Imprinting in the Mouse

Bisphenol A Exposure Disrupts Genomic Imprinting in the Mouse Bisphenol A Exposure Disrupts Genomic Imprinting in the Mouse Martha Susiarjo 1,2, Isaac Sasson 3, Clementina Mesaros 4, Marisa S. Bartolomei 1,2 * 1 Department of Cell and Developmental Biology, University

More information

Epigenetic Pathways Linking Parental Effects to Offspring Development. Dr. Frances A. Champagne Department of Psychology, Columbia University

Epigenetic Pathways Linking Parental Effects to Offspring Development. Dr. Frances A. Champagne Department of Psychology, Columbia University Epigenetic Pathways Linking Parental Effects to Offspring Development Dr. Frances A. Champagne Department of Psychology, Columbia University Prenatal & Postnatal Experiences Individual differences in brain

More information

GCATCCATCTTGGGGCGTCCCAATTGCTGAGTAACAAATGAGACGC TGTGGCCAAACTCAGTCATAACTAATGACATTTCTAGACAAAGTGAC TTCAGATTTTCAAAGCGTACCCTGTTTACATCATTTTGCCAATTTCG

GCATCCATCTTGGGGCGTCCCAATTGCTGAGTAACAAATGAGACGC TGTGGCCAAACTCAGTCATAACTAATGACATTTCTAGACAAAGTGAC TTCAGATTTTCAAAGCGTACCCTGTTTACATCATTTTGCCAATTTCG Lecture 6 GCATCCATCTTGGGGCGTCCCAATTGCTGAGTAACAAATGAGACGC TGTGGCCAAACTCAGTCATAACTAATGACATTTCTAGACAAAGTGAC TTCAGATTTTCAAAGCGTACCCTGTTTACATCATTTTGCCAATTTCG CGTACTGCAACCGGCGGGCCACGCCCCCGTGAAAAGAAGGTTGTT TTCTCCACATTTCGGGGTTCTGGACGTTTCCCGGCTGCGGGGCGG

More information

I have no financial disclosures

I have no financial disclosures The Environment and Reproductive Health: Why What We Eat, Breath and Touch Matters Susan.Davidson@SSMHealth.com Susan Davidson, MD Dean Medical Center I have no financial disclosures 1 Many Complex Factors

More information

Endocrine Disrupter Chemicals: Universal Access to Healthcare

Endocrine Disrupter Chemicals: Universal Access to Healthcare Endocrine Disrupter Chemicals: the right to know Riana Bornman, School of Health Systems and Public Health, University of Pretoria SAMA Conference 2016 Universal Access to Healthcare Concern started SOS-EDCs

More information

Bisphenol A (BPA) and Cardiovascular diseases in Lebanon

Bisphenol A (BPA) and Cardiovascular diseases in Lebanon Bisphenol A (BPA) and Cardiovascular diseases in Lebanon Mona Nasrallah M.D Internal Medicine, Endocrinology Second Annual VMP Research Retreat American University of Beirut August 24, 2013 Assessment

More information

DNA methylation & demethylation

DNA methylation & demethylation DNA methylation & demethylation Lars Schomacher (Group Christof Niehrs) What is Epigenetics? Epigenetics is the study of heritable changes in gene expression (active versus inactive genes) that do not

More information

Environmental and Developmental Origins of Ovarian Reserve. Nick Macklon Professor of Obstetrics and Gynaecology, University of Southampton, UK.

Environmental and Developmental Origins of Ovarian Reserve. Nick Macklon Professor of Obstetrics and Gynaecology, University of Southampton, UK. Environmental and Developmental Origins of Ovarian Reserve Nick Macklon Professor of Obstetrics and Gynaecology, University of Southampton, UK. Why worry? Women delaying childbirth Diminished ovarian

More information

Epigenetics: The Future of Psychology & Neuroscience. Richard E. Brown Psychology Department Dalhousie University Halifax, NS, B3H 4J1

Epigenetics: The Future of Psychology & Neuroscience. Richard E. Brown Psychology Department Dalhousie University Halifax, NS, B3H 4J1 Epigenetics: The Future of Psychology & Neuroscience Richard E. Brown Psychology Department Dalhousie University Halifax, NS, B3H 4J1 Nature versus Nurture Despite the belief that the Nature vs. Nurture

More information

DNA Methylation and Cancer

DNA Methylation and Cancer DNA Methylation and Cancer October 25, 2016 Dominic Smiraglia, Ph.D. Department of Cancer Genetics From Alan Wolffe, Science and Medicine, 1999 Vital Statistics Human genome contains 3 billion bp ~ 50,000

More information

Epigenetics DNA methylation. Biosciences 741: Genomics Fall, 2013 Week 13. DNA Methylation

Epigenetics DNA methylation. Biosciences 741: Genomics Fall, 2013 Week 13. DNA Methylation Epigenetics DNA methylation Biosciences 741: Genomics Fall, 2013 Week 13 DNA Methylation Most methylated cytosines are found in the dinucleotide sequence CG, denoted mcpg. The restriction enzyme HpaII

More information

Supplemental Figure 1. Genes showing ectopic H3K9 dimethylation in this study are DNA hypermethylated in Lister et al. study.

Supplemental Figure 1. Genes showing ectopic H3K9 dimethylation in this study are DNA hypermethylated in Lister et al. study. mc mc mc mc SUP mc mc Supplemental Figure. Genes showing ectopic HK9 dimethylation in this study are DNA hypermethylated in Lister et al. study. Representative views of genes that gain HK9m marks in their

More information

Session 2: Biomarkers of epigenetic changes and their applicability to genetic toxicology

Session 2: Biomarkers of epigenetic changes and their applicability to genetic toxicology Session 2: Biomarkers of epigenetic changes and their applicability to genetic toxicology Bhaskar Gollapudi, Ph.D The Dow Chemical Company Workshop: Genetic Toxicology: Opportunities to Integrate New Approaches

More information

The role of DNMT3A and HOXA9 hypomethylation in acute myeloid leukemia (AML)

The role of DNMT3A and HOXA9 hypomethylation in acute myeloid leukemia (AML) Campbell Drohan BIOL 463 December 2016 The role of DNMT3A and HOXA9 hypomethylation in acute myeloid leukemia (AML) Introduction Epigenetic modifications of DNA and histones are key to gene regulation

More information

Towards 2020: Linda S. Birnbaum, Ph.D., D.A.B.T., A.T.S. Director National Institute of Environmental Health Sciences National Toxicology Program

Towards 2020: Linda S. Birnbaum, Ph.D., D.A.B.T., A.T.S. Director National Institute of Environmental Health Sciences National Toxicology Program Towards 2020: What are the Critical Environmental Health Challenges? Linda S. Birnbaum, Ph.D., D.A.B.T., A.T.S. Director National Institute of Environmental Health Sciences National Toxicology Program

More information

Stem Cell Epigenetics

Stem Cell Epigenetics Stem Cell Epigenetics Philippe Collas University of Oslo Institute of Basic Medical Sciences Norwegian Center for Stem Cell Research www.collaslab.com Source of stem cells in the body Somatic ( adult )

More information

Dissecting the role of H3K64me3 in mouse pericentromeric heterochromatin.

Dissecting the role of H3K64me3 in mouse pericentromeric heterochromatin. Supplementary Information Dissecting the role of H3K64me3 in mouse pericentromeric heterochromatin. Ulrike C. Lange 1, Stéphanie Siebert 2, Mark Wossidlo 3,4, Thomas Weiss 1, Céline Ziegler- Birling 2,

More information

Genomic Methods in Cancer Epigenetic Dysregulation

Genomic Methods in Cancer Epigenetic Dysregulation Genomic Methods in Cancer Epigenetic Dysregulation Clara, Lyon 2018 Jacek Majewski, Associate Professor Department of Human Genetics, McGill University Montreal, Canada A few words about my lab Genomics

More information

Supplementary Figures

Supplementary Figures Supplementary Figures Supplementary Figure 1. Confirmation of Dnmt1 conditional knockout out mice. a, Representative images of sorted stem (Lin - CD49f high CD24 + ), luminal (Lin - CD49f low CD24 + )

More information

Fragile X Syndrome. Genetics, Epigenetics & the Role of Unprogrammed Events in the expression of a Phenotype

Fragile X Syndrome. Genetics, Epigenetics & the Role of Unprogrammed Events in the expression of a Phenotype Fragile X Syndrome Genetics, Epigenetics & the Role of Unprogrammed Events in the expression of a Phenotype A loss of function of the FMR-1 gene results in severe learning problems, intellectual disability

More information

Epigenetics. Lyle Armstrong. UJ Taylor & Francis Group. f'ci Garland Science NEW YORK AND LONDON

Epigenetics. Lyle Armstrong. UJ Taylor & Francis Group. f'ci Garland Science NEW YORK AND LONDON ... Epigenetics Lyle Armstrong f'ci Garland Science UJ Taylor & Francis Group NEW YORK AND LONDON Contents CHAPTER 1 INTRODUCTION TO 3.2 CHROMATIN ARCHITECTURE 21 THE STUDY OF EPIGENETICS 1.1 THE CORE

More information

Everyday Chemical Exposures and Breast Cancer: Why are we concerned? What can we do? Janet M. Gray, Ph.D. Vassar College Breast Cancer Fund

Everyday Chemical Exposures and Breast Cancer: Why are we concerned? What can we do? Janet M. Gray, Ph.D. Vassar College Breast Cancer Fund Everyday Chemical Exposures and Breast Cancer: Why are we concerned? What can we do? Janet M. Gray, Ph.D. Vassar College Breast Cancer Fund General Risks Factors Associated with Cancer Genes Primary mutations

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 10.1038/ncb2607 Figure S1 Elf5 loss promotes EMT in mammary epithelium while Elf5 overexpression inhibits TGFβ induced EMT. (a, c) Different confocal slices through the Z stack image. (b, d) 3D rendering

More information

Trace Metals and Placental Methylation

Trace Metals and Placental Methylation Trace Metals and Placental Methylation Carmen J. Marsit, PhD Pharmacology & Toxicology Epidemiology Geisel School of Medicine at Dartmouth Developmental Origins Environmental Exposure Metabolic Cardiovascular

More information

3.D- Cell Communication

3.D- Cell Communication 3.D- Cell Communication Big Idea 3: Living systems store, retrieve, transmit and respond to information essential to life processes. EU 3.A: Heritable information provides for continuity of life. EU 3.B:

More information

Allelic reprogramming of the histone modification H3K4me3 in early mammalian development

Allelic reprogramming of the histone modification H3K4me3 in early mammalian development Allelic reprogramming of the histone modification H3K4me3 in early mammalian development 张戈 Method and material STAR ChIP seq (small-scale TELP-assisted rapid ChIP seq) 200 mouse embryonic stem cells PWK/PhJ

More information

Endocrine Disrupting Chemicals: New considerations in the toxics space TURI Annual Meeting

Endocrine Disrupting Chemicals: New considerations in the toxics space TURI Annual Meeting Endocrine Disrupting Chemicals: New considerations in the toxics space TURI Annual Meeting Laura N. Vandenberg, PhD UMass Amherst School of Public Health April 25, 2018 Disclosure statement I am funded

More information

Epigenetics: A historical overview Dr. Robin Holliday

Epigenetics: A historical overview Dr. Robin Holliday Epigenetics 1 Rival hypotheses Epigenisis - The embryo is initially undifferentiated. As development proceeds, increasing levels of complexity emerge giving rise to the larval stage or to the adult organism.

More information

Decoding UCMR3: Clear Communication about Drinking Water Contaminants

Decoding UCMR3: Clear Communication about Drinking Water Contaminants Decoding UCMR3: Clear Communication about Drinking Water Contaminants Christopher P Weis, Ph.D., D.A.B.T. Office of the Director National Institute of Environmental Health Science and National Toxicology

More information

SAB Report to the Board of the Glass Packaging Institute

SAB Report to the Board of the Glass Packaging Institute SAB Report to the Board of the Glass Packaging Institute A Brief Overview of Significant Studies on BPA During 2013 November, 2013 Glass is ENDLESSLY Recyclable Introduction Number and diversity of studies

More information

R. Piazza (MD, PhD), Dept. of Medicine and Surgery, University of Milano-Bicocca EPIGENETICS

R. Piazza (MD, PhD), Dept. of Medicine and Surgery, University of Milano-Bicocca EPIGENETICS R. Piazza (MD, PhD), Dept. of Medicine and Surgery, University of Milano-Bicocca EPIGENETICS EPIGENETICS THE STUDY OF CHANGES IN GENE EXPRESSION THAT ARE POTENTIALLY HERITABLE AND THAT DO NOT ENTAIL A

More information

Dioxin induces Ahr-dependent robust DNA demethylation of the Cyp1a1 promoter via Tdg in the mouse liver

Dioxin induces Ahr-dependent robust DNA demethylation of the Cyp1a1 promoter via Tdg in the mouse liver Dioxin induces Ahr-dependent robust DNA demethylation of the Cypa promoter via Tdg in the mouse liver Hesbon Z. Amenya, Chiharu Tohyama, Seiichiroh Ohsako Laboratory of Environmental Health Sciences, Center

More information

Epigenetic Variation in Human Health and Disease

Epigenetic Variation in Human Health and Disease Epigenetic Variation in Human Health and Disease Michael S. Kobor Centre for Molecular Medicine and Therapeutics Department of Medical Genetics University of British Columbia www.cmmt.ubc.ca Understanding

More information

Bisphenol A (BPA) Affects Reproductive Formation across Generations in Mice

Bisphenol A (BPA) Affects Reproductive Formation across Generations in Mice NOTE Anatomy Bisphenol A (BPA) Affects Reproductive Formation across Generations in Mice Masato HIYAMA 1), Ehn-Kyong CHOI 2), Shoichi WAKITANI 1), Toru TACHIBANA 1), Hamayun KHAN 1), Ken Takeshi KUSAKABE

More information

Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity.

Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity. Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity. (a) Relative amounts of adiponectin, Ppar 2, C/ebp, and Tnf mrna

More information

Epigenetics Armstrong_Prelims.indd 1 04/11/2013 3:28 pm

Epigenetics Armstrong_Prelims.indd 1 04/11/2013 3:28 pm Epigenetics Epigenetics Lyle Armstrong vi Online resources Accessible from www.garlandscience.com, the Student and Instructor Resource Websites provide learning and teaching tools created for Epigenetics.

More information

Nature Structural & Molecular Biology: doi: /nsmb.2419

Nature Structural & Molecular Biology: doi: /nsmb.2419 Supplementary Figure 1 Mapped sequence reads and nucleosome occupancies. (a) Distribution of sequencing reads on the mouse reference genome for chromosome 14 as an example. The number of reads in a 1 Mb

More information

Gene Expression DNA RNA. Protein. Metabolites, stress, environment

Gene Expression DNA RNA. Protein. Metabolites, stress, environment Gene Expression DNA RNA Protein Metabolites, stress, environment 1 EPIGENETICS The study of alterations in gene function that cannot be explained by changes in DNA sequence. Epigenetic gene regulatory

More information

Endocrine Disrupted By Darlene M, Rose HHP READ ONLINE

Endocrine Disrupted By Darlene M, Rose HHP READ ONLINE Endocrine Disrupted By Darlene M, Rose HHP READ ONLINE 1.2 What is the definition of endocrine disruptors? Endocrine disruption is not, in itself, a measure of toxicity the occurrence of adverse health

More information

Endocrine Disruptors, Crustacean Molting and Bivalve Populations. Peter L. defur Virginia Commonwealth University Richmond VA

Endocrine Disruptors, Crustacean Molting and Bivalve Populations. Peter L. defur Virginia Commonwealth University Richmond VA Endocrine Disruptors, Crustacean Molting and Bivalve Populations Peter L. defur Virginia Commonwealth University Richmond VA Not so long ago, and not so far away We are certain of the following: a large

More information

Endocrine disrupting activity of chemicals used in hydraulic fracturing for natural gas and oil

Endocrine disrupting activity of chemicals used in hydraulic fracturing for natural gas and oil Endocrine disrupting activity of chemicals used in hydraulic fracturing for natural gas and oil Susan C. Nagel, PhD, Associate Professor Obstetrics, Gynecology and Women s Health University of Missouri

More information

I) Development: tissue differentiation and timing II) Whole Chromosome Regulation

I) Development: tissue differentiation and timing II) Whole Chromosome Regulation Epigenesis: Gene Regulation Epigenesis : Gene Regulation I) Development: tissue differentiation and timing II) Whole Chromosome Regulation (X chromosome inactivation or Lyonization) III) Regulation during

More information

RALYL Hypermethylation: A Potential Diagnostic Marker of Esophageal Squamous Cell Carcinoma (ESCC) Junwei Liu, MD

RALYL Hypermethylation: A Potential Diagnostic Marker of Esophageal Squamous Cell Carcinoma (ESCC) Junwei Liu, MD RALYL Hypermethylation: A Potential Diagnostic Marker of Esophageal Squamous Cell Carcinoma (ESCC) Junwei Liu, MD Aurora Healthcare, Milwaukee, WI INTRODUCTION v Epigenetic aberration and genetic alteration

More information

Hormonally active contaminants- Interactions and effects on food safety. Helen Håkansson

Hormonally active contaminants- Interactions and effects on food safety. Helen Håkansson Hormonally active contaminants- Interactions and effects on food safety Contents EDC definition and effects Effects of dioxin-like compounds TEQ concept and TEF values for dioxin-like compound Need of

More information

Endometrio ed endometriosi: the same tissue?

Endometrio ed endometriosi: the same tissue? Endometrio ed endometriosi: the same tissue? Valentino Remorgida Clinica Ostetrica e Ginecologica IRCCS Azienda Ospedaliera Universitaria San Martino IST Istituto Nazionale per la Ricerca sul Cancro, Università

More information

EPIGENOMICS PROFILING SERVICES

EPIGENOMICS PROFILING SERVICES EPIGENOMICS PROFILING SERVICES Chromatin analysis DNA methylation analysis RNA-seq analysis Diagenode helps you uncover the mysteries of epigenetics PAGE 3 Integrative epigenomics analysis DNA methylation

More information

A fully Bayesian approach for the analysis of Whole-Genome Bisulfite Sequencing Data

A fully Bayesian approach for the analysis of Whole-Genome Bisulfite Sequencing Data A fully Bayesian approach for the analysis of Whole-Genome Bisulfite Sequencing Data Leonardo Bottolo 1,2,3 1 Department of Medical Genetics, University of Cambridge, UK 2 The Alan Turing Institute, London,

More information

Synthetic EDCs at the present human exposure ARE NO RISK for human health Prof. Dan Dietrich University of Konstanz 1

Synthetic EDCs at the present human exposure ARE NO RISK for human health Prof. Dan Dietrich University of Konstanz 1 Synthetic EDCs at the present human exposure ARE NO RISK for human health 21.03.18 Prof. Dan Dietrich University of Konstanz 1 What are EDCs 2013 Berlaymont Declaration defines EDC Makes NO distinction

More information

Nature Immunology: doi: /ni Supplementary Figure 1. Characteristics of SEs in T reg and T conv cells.

Nature Immunology: doi: /ni Supplementary Figure 1. Characteristics of SEs in T reg and T conv cells. Supplementary Figure 1 Characteristics of SEs in T reg and T conv cells. (a) Patterns of indicated transcription factor-binding at SEs and surrounding regions in T reg and T conv cells. Average normalized

More information

Dynamic reprogramming of DNA methylation in SETD2- deregulated renal cell carcinoma

Dynamic reprogramming of DNA methylation in SETD2- deregulated renal cell carcinoma /, Vol. 7, No. 2 Dynamic reprogramming of DNA methylation in SETD2- deregulated renal cell carcinoma Rochelle L. Tiedemann 1, Ryan A. Hlady 2, Paul D. Hanavan 3, Douglas F. Lake 3, Raoul Tibes 4,5, Jeong-Heon

More information

Environmental Health Sciences

Environmental Health Sciences Make vampire food safe for vampires, again. Hormone-related cancers Pre-term birth Autoimmunity ADHD Endometriosis Degenerative diseases Fibroids Allergies Obesity Asthma Learning disabilities Infertility

More information

Alpha thalassemia mental retardation X-linked. Acquired alpha-thalassemia myelodysplastic syndrome

Alpha thalassemia mental retardation X-linked. Acquired alpha-thalassemia myelodysplastic syndrome Alpha thalassemia mental retardation X-linked Acquired alpha-thalassemia myelodysplastic syndrome (Alpha thalassemia mental retardation X-linked) Acquired alpha-thalassemia myelodysplastic syndrome Schematic

More information

Xenoestrogen-induced Regulation of EZH2 and Histone Methylation via Non-Genomic Estrogen

Xenoestrogen-induced Regulation of EZH2 and Histone Methylation via Non-Genomic Estrogen Xenoestrogen-induced Regulation of EZH2 and Histone Methylation via Non-Genomic Estrogen Receptor Signaling to PI3K/AKT Tiffany G. Bredfeldt, Kristen L. Greathouse, Stephen H. Safe, Mien-Chie Hung, Mark

More information

Examining environmental contributors to autism spectrum disorder

Examining environmental contributors to autism spectrum disorder Examining environmental contributors to autism spectrum disorder Valerie Hu, Ph.D. Dept. of Biochemistry and Molecular Medicine School of Medicine and Health Sciences The George Washington University E-mail:

More information

Epigenetic Markers for Transplacental Exposure to Airborne Polycyclic Aromatic Hydrocarbons (PAHs( PAHs) ) and Childhood Asthma.

Epigenetic Markers for Transplacental Exposure to Airborne Polycyclic Aromatic Hydrocarbons (PAHs( PAHs) ) and Childhood Asthma. Epigenetic Markers for Transplacental Exposure to Airborne Polycyclic Aromatic Hydrocarbons (PAHs( PAHs) ) and Childhood Asthma Winnie Wan-yee Tang, Ph.D Department of Environmental Health University of

More information

SUPPLEMENTAL FILE. mir-22 and mir-29a are members of the androgen receptor cistrome modulating. LAMC1 and Mcl-1 in prostate cancer

SUPPLEMENTAL FILE. mir-22 and mir-29a are members of the androgen receptor cistrome modulating. LAMC1 and Mcl-1 in prostate cancer 1 SUPPLEMENTAL FILE 2 3 mir-22 and mir-29a are members of the androgen receptor cistrome modulating LAMC1 and Mcl-1 in prostate cancer 4 5 6 Lorenza Pasqualini 1, Huajie Bu 1,2, Martin Puhr 1, Narisu Narisu

More information

The agouti mouse model: an epigenetic biosensor for nutritional and environmental alterations on the fetal epigenome

The agouti mouse model: an epigenetic biosensor for nutritional and environmental alterations on the fetal epigenome The agouti mouse model: an epigenetic biosensor for nutritional and environmental alterations on the fetal epigenome Dana C Dolinoy 2008 International Life Sciences Institute The ability of environmental

More information

Exploring Environmental Chemicals and Risk of Breast Cancer During the Menopausal Transition

Exploring Environmental Chemicals and Risk of Breast Cancer During the Menopausal Transition Exploring Environmental Chemicals and Risk of Breast Cancer During the Menopausal Transition Susan L. Neuhausen, Ph.D Morris and Horowitz Families Endowed Professor Beckman Research Institute of City of

More information

Analysis of shotgun bisulfite sequencing of cancer samples

Analysis of shotgun bisulfite sequencing of cancer samples Analysis of shotgun bisulfite sequencing of cancer samples Kasper Daniel Hansen Postdoc with Rafael Irizarry Johns Hopkins Bloomberg School of Public Health Brixen, July 1st, 2011 The

More information

Epigenetic Regulation of Health and Disease Nutritional and environmental effects on epigenetic regulation

Epigenetic Regulation of Health and Disease Nutritional and environmental effects on epigenetic regulation Epigenetic Regulation of Health and Disease Nutritional and environmental effects on epigenetic regulation Robert FEIL Director of Research CNRS & University of Montpellier, Montpellier, France. E-mail:

More information

TITLE: Identification of Estrogen Receptor Beta Binding Sites in the Human Genomes

TITLE: Identification of Estrogen Receptor Beta Binding Sites in the Human Genomes AD Award Number: W81XWH-09-1-0297 TITLE: Identification of Estrogen Receptor Beta Binding Sites in the Human Genomes PRINCIPAL INVESTIGATOR: Thien Le CONTRACTING ORGANIZATION: University of Chicago, Chicago,

More information

Spermatogenesis. What is it and what does it look like? How do hormones regulate spermatogenesis?

Spermatogenesis. What is it and what does it look like? How do hormones regulate spermatogenesis? Spermatogenesis What is it and what does it look like? How do hormones regulate spermatogenesis? FSH, androgens, growth factors Animal Physiology (Hill, Wise, Anderson): Ch. 15 435-438 1 Spermatogenesis:

More information

Epigenomics. Ivana de la Serna Block Health Science

Epigenomics. Ivana de la Serna Block Health Science Epigenomics Ivana de la Serna Block Health Science 388 383-4111 ivana.delaserna@utoledo.edu Outline 1. Epigenetics-definition and overview 2. DNA methylation/hydroxymethylation 3. Histone modifications

More information

CASCADE PUBLISHABLE FINAL ACTIVITY REPORT

CASCADE PUBLISHABLE FINAL ACTIVITY REPORT Project no: FOOD-CT-2004-506319 Project acronym: CASCADE Project title: Chemicals as contaminants in the food chain: an NoE for research, risk assessment and education Instrument: Network of Excellence

More information

Mohammad Husain Department of Biotechnology, Jamia Millia Islamia New Delhi

Mohammad Husain Department of Biotechnology, Jamia Millia Islamia New Delhi Role of Vitamin D receptor (VDR) in HIV induced tubular injury Mohammad Husain Department of Biotechnology, Jamia Millia Islamia New Delhi 07/10/2015 INTRODUCTION Vitamin D is technically not a Vitamin;

More information

Hormones. Hormones. When you hear the word hormones, what do you think of? When you hear the word hormones, what do you think of?

Hormones. Hormones. When you hear the word hormones, what do you think of? When you hear the word hormones, what do you think of? When you hear the word hormones, what When you hear the word hormones, what When you hear the word hormones, what When you hear the word hormones, what Hormones As your body s chemical messengers, hormones

More information

Frederick vom Saal Division of Biological Sciences University of Missouri-Columbia, USA

Frederick vom Saal Division of Biological Sciences University of Missouri-Columbia, USA INTERNATIONAL SEMINARS ON PLANETARY EMERGENCIES 49th Session SCIENCE FOR PEACE THE WORLD OVER (THE NEW MANHATTAN PROJECT) Erice 20-23 August 2016 SESSION 8: CHILDREN WELFARE DISRUPTION OF DEVELOPMENT BY

More information

Prenatal exposure to EDCs and obesity: combining toxicology and epidemiology

Prenatal exposure to EDCs and obesity: combining toxicology and epidemiology EDC Strategy, CHE partnership call, June 18, 2014 Prenatal exposure to EDCs and obesity: combining toxicology and epidemiology Prof. Juliette Legler Institute for Environmental Studies, VU University Amsterdam,

More information

Environmental Exposures and Immune Function

Environmental Exposures and Immune Function Environmental Exposures and Immune Function Presented by Dr. B Paige Lawrence Professor of Environmental Medicine and of Microbiology & Immunology University of Rochester School of Medicine and Dentistry

More information

Prenatal alcohol exposure and metabolic disease in adulthood

Prenatal alcohol exposure and metabolic disease in adulthood 8 th International Research Conference on Adolescents and Adults with FASD Prenatal alcohol exposure and metabolic disease in adulthood Prof Karen Moritz Director Child Health Research Centre University

More information

TITLE: Examination of the Role of DNA Methylation Changes in Prostate Cancer using the Transgenic Adenocarcinoma of Mouse Prostate (TRAMP) Model

TITLE: Examination of the Role of DNA Methylation Changes in Prostate Cancer using the Transgenic Adenocarcinoma of Mouse Prostate (TRAMP) Model AD Award Number: W81XWH-07-1-0153 TITLE: Examination of the Role of DNA Methylation Changes in Prostate Cancer using the Transgenic Adenocarcinoma of Mouse Prostate (TRAMP) Model PRINCIPAL INVESTIGATOR:

More information

Epigenetics and trauma

Epigenetics and trauma Epigenetics and trauma Influence of trauma on mental health Patrick McGowan, PhD Biological Sciences, UTSC Cell and Systems Biology, Psychology University of Toronto patrick.mcgowan@utoronto.ca Leuven,

More information

Genetics and Genomics in Medicine Chapter 6 Questions

Genetics and Genomics in Medicine Chapter 6 Questions Genetics and Genomics in Medicine Chapter 6 Questions Multiple Choice Questions Question 6.1 With respect to the interconversion between open and condensed chromatin shown below: Which of the directions

More information

Meta-analysis of IDH-mutant cancers identifies EBF1 as a novel interaction partner for

Meta-analysis of IDH-mutant cancers identifies EBF1 as a novel interaction partner for Meta-analysis of IDH-mutant cancers identifies EBF1 as a novel interaction partner for TET2 Paul Guilhamon 1, Malihe Eskandarpour 2, Dina Halai 3, Gareth A. Wilson 1, Andrew Feber 1, Andrew E. Teschendorff

More information

A Bad Start Lasts a Lifetime: Need for Green Chemistry

A Bad Start Lasts a Lifetime: Need for Green Chemistry A Bad Start Lasts a Lifetime: Need for Green Chemistry Jerrold J. Heindel, PhD Scientific Program Administrator Division of Extramural Research and Training National Institute of Environmental Health Sciences

More information

Joanna Hillman Michael Higgins Lab Oncology for Scientists I 10/29/2015

Joanna Hillman Michael Higgins Lab Oncology for Scientists I 10/29/2015 Joanna Hillman Michael Higgins Lab Oncology for Scientists I 10/29/2015 ! Define Epigenetics & Genomic Imprinting! Discovery! What is the imprint! Lifecycle of an Imprint DMRs and ICEs! 2 main mechanisms

More information

Supplementary Fig.S1. MeDIP RPKM distribution of 5kb windows. Relative expression of DNMT. Percentage of genome. (fold change)

Supplementary Fig.S1. MeDIP RPKM distribution of 5kb windows. Relative expression of DNMT. Percentage of genome. (fold change) Supplementary Fig.S1 Percentage of genome 10% 8% 6% 4% 2% 0 MeDIP RPKM distribution of 5kb windows 0 0. 0.5 0.75 >1 MeDIP RPKM value EC Relative expression of DNMT (fold change) 12 6 4 3 2 1 EC DNMT1 DNMT2

More information

The silence of the genes: clinical applications of (colorectal) cancer epigenetics

The silence of the genes: clinical applications of (colorectal) cancer epigenetics The silence of the genes: clinical applications of (colorectal) cancer epigenetics Manon van Engeland, PhD Dept. of Pathology GROW - School for Oncology & Developmental Biology Maastricht University Medical

More information

Disruptores Metabólicos y Obesidad

Disruptores Metabólicos y Obesidad Disruptores Metabólicos y Obesidad Ángel Nadal Institute of Bioengineering and CIBERDEM, Miguel Hernández University of Elche, Alicante, Spain nadal@umh.es Funded by: European Foundation for the Study

More information

Carcinogenesis in IBD

Carcinogenesis in IBD Oxford Inflammatory Bowel Disease MasterClass Carcinogenesis in IBD Dr Simon Leedham, Oxford, UK Oxford Inflammatory Bowel Disease MasterClass Carcinogenesis in Inflammatory Bowel Disease Dr Simon Leedham

More information

Hypothalamus, pituitary, and subordinate glands

Hypothalamus, pituitary, and subordinate glands Endocrine System The endocrine system is the body s slow communication system relying on three main components Endocrine glands, such as hypothalamus, pituitary, thyroid, adrenal, pancreas, gonad Hormones

More information

Transgenerational Effects of Diet: Implications for Cancer Prevention Overview and Conclusions

Transgenerational Effects of Diet: Implications for Cancer Prevention Overview and Conclusions Transgenerational Effects of Diet: Implications for Cancer Prevention Overview and Conclusions John Milner, Ph.D. Director, USDA Beltsville Human Nutrition Research Center Beltsville, MD 20705 john.milner@ars.usda.gov

More information

What further research do we need in order to prevent/manage the health impact of EDCs?

What further research do we need in order to prevent/manage the health impact of EDCs? What further research do we need in order to prevent/manage the health impact of EDCs? Alberto Mantovani, Toxicologist, Research director, Istituto Superiore di Sanità Roma, Italy alberto.mantovani@iss.it

More information

Large conserved domains of low DNA methylation maintained by Dnmt3a

Large conserved domains of low DNA methylation maintained by Dnmt3a Supplementary information Large conserved domains of low DNA methylation maintained by Dnmt3a Mira Jeong# 1, Deqiang Sun # 2, Min Luo# 1, Yun Huang 3, Grant A. Challen %1, Benjamin Rodriguez 2, Xiaotian

More information

Endocrine Disrupting Activity Associated With Oil and Natural Gas Extraction

Endocrine Disrupting Activity Associated With Oil and Natural Gas Extraction Endocrine Disrupting Activity Associated With Oil and Natural Gas Extraction Susan C Nagel, PhD Associate Professor Obstetrics, Gynecology, and Women s Health University of Missouri NIH R21ES026395 and

More information

Genes, Aging and Skin. Helen Knaggs Vice President, Nu Skin Global R&D

Genes, Aging and Skin. Helen Knaggs Vice President, Nu Skin Global R&D Genes, Aging and Skin Helen Knaggs Vice President, Nu Skin Global R&D Presentation Overview Skin aging Genes and genomics How do genes influence skin appearance? Can the use of Genomic Technology enable

More information

Role of CpG deserts in the epigenetic transgenerational inheritance of differential DNA methylation regions

Role of CpG deserts in the epigenetic transgenerational inheritance of differential DNA methylation regions Skinner and Guerrero-Bosagna BMC Genomics 2014, 15:692 RESEARCH ARTICLE Open Access Role of CpG deserts in the epigenetic transgenerational inheritance of differential DNA methylation regions Michael K

More information

Developmental Basis of Disease: A New Paradigm in Environmental Health Sciences

Developmental Basis of Disease: A New Paradigm in Environmental Health Sciences Developmental Basis of Disease: A New Paradigm in Environmental Health Sciences Linda S. Birnbaum, PhD, DABT, ATS Director National Institute of Environmental Health Sciences and National Toxicology Program

More information

To: National Toxicology Program (NTP); Center for the Evaluation of Risks to Human Reproduction (CERHR)

To: National Toxicology Program (NTP); Center for the Evaluation of Risks to Human Reproduction (CERHR) February 2, 2007 To: National Toxicology Program (NTP); Center for the Evaluation of Risks to Human Reproduction (CERHR) From: Natural Resources Defense Council These comments are submitted by Natural

More information