* 17.8 DOUGLASS HANLY MOIR PATHOLOGY. "We take it personally"
|
|
- Bryan Brooks
- 5 years ago
- Views:
Transcription
1 Toll Free: Results: Dr EricaAH Dr Karl BAUMGAfr Dr Elizabeth BERM Or Jonathan BLACKV Dr David BLAXlAN Dr Warick oelprado SPECIALIST PATHOLOGISTS Or Colin GOLDSCHMIDT Or Richard HASKELL PLMIPLM/PLM/SMY A 1911 D.O.B. (Age) : (19) PH: /XT AG/25603/1 011 GLUC;COELIAC SEROLOGY;OHEAS;FAI,TESTOSTERONE & SHBG;FREE TESTOSTERONE;FSH;GH;LH;PROLACTIN;TSH+FT4 ;FBC;FE STUOIES;FREE T3;LFT [RT3;DIHYOROTESTOSTERONE;TBG Reports to tollow] QUERY HYPOPITUITARISM Date Printed: You r Reference: Sex: M Page: 1 Free Testosterone * DHEAS 8.2 µmolll Further report to follow. Thank you for referring thjs patient KRSMANOVIC. MARKO: FREE TESTOSTERONE, DHEAS NATA ACCREDITATION NO, 2178 ~ PHONE I APPT: I-N-O-T-E-s-I 4222/ /07
2 All hours: Pathologists: Toll Free: Results: Dr EricaAH Dr Kar1 SAL Dr Eli.zabetr S=Fi"''' DrJonathanRAG' DrDavidBl..AXl.AN DrFionaBONAR DrIvanBURCHETT DrInnyBUSMANIS DrGrahameCALDWELL DrIanCHAMBEr,S DrDebbieCLARK DrWarickDELPRADO DrJoannaDING Dr RobertDIXON DrStephenFAIRY Dr SteveMORAN DrAnnabelleFARNSWORTH Dr HelenOGLE Dr LeoFEAIN DrSimonPALFREEMAN DrWilliamFELBEL Dr MiriamPAUL Dr ColinGOLDSCHMIDT Dr PaulRICHMOND Dr FrancesHANLY DrElizabethSINCLAIR Dr RichardHASKELL DrVeraSTOERMER Dr VickiHOWARD DrAndrewTAN Dr DebraJENSEN DrJeanneTOMLINSON Dr KenKNEALE DrCateTREBECK Dr RobynLEVINGSTON' DrMarkWILSHER Dr AlanLLOYD DrTinaYEN DrRayMcKINLEY Dr DenisMOIR (Age) : (19) PH: /XT AG/25418/33/35 GLUC;COELIAC SEROLOGY;FAI,TESTOSTERONE& SHBG;FSH;GH;LH;PROLACTIN;TSH+FT4;FBC;FESTUDIES;FREE T3;L [RT3;DHEAS;FREE TESTOSTERONE;DIHYDROTESTOSTERONE;TBG. Reportsto follow] QUERY HYPOPITUITARISM Date of Service: ID N0.: Sex: M Date Printed: Your Reference: Page: 1 FULL BLOOD COUNT ( Reference: Male, Adult) ( Reference ) Haemoglobin 176 gil ( ) RCC 5.84 xl01\12/l ( ) Haematocrit 0.51 ratio ( ) MCV 87.3 fl ( ) MCH 30.1 pg ( ) MCHC 345 gil ( ) ROW 41.5 fl ( ) WBC Count 7.5 xl01\9/l ( ) Neutrophils (34.6%) 2.6 xl01\9/l ( ) Lymphocytes (49.5%) 3.7 xl Ql\9/L ( ) Monocytes (9.5%) 0.7 xl01\9/l ( ) Eosinophils (5.3%) 0.4 xl01\9/l ( ) Basophils (1.1%) 0.1 xl01\9/l ( ) Plat Count 202 xl01\9/l ( ) COMMENT: Fuli blood count normal LIVER FUNCTION TESTS Bilirubin 10 µmol/l ALP 107 U/L GGT 12 U/L W *3~ U~ AST 67 U/L ALT * 96 U/L T.Protein 79 gil Albumin 50 gil Globulin 29 gil Elevated transaminase(s). Follow-up may be indicated Plasma Glucose: 4.7 mmol/l ( ) If fasting # LH (Roche Method) <0.5 lull? Exogenous hormone effect. If not, pituitary pathology may need to be excluded. Female Basal Mid cycle peak Post-menopausal Male Children KRSMANOVIC, MARKO: FBC, LFT, GLUC, LH NATAACCREDITA1l0 NO ~ PHONE I APPT: I NOTES I 4222/D /07
3 I "We take it pe1'sonally" 14 Giffnock Avenue, Macquarie Park, NSW, AUSTRALIA2113 Toll Free: Results: Dr EricaAHN Dr Karl BAUMGART Dr Elizabeth BERNAL Dr Jonathan BLACKWELL Dr David BLAXLAND Dr Warick DELPRADO Dr Colin GOLDSCHMIDT Dr Richard HASKELL D.O.B. (Age) : (19) PH: GLUC;COELIAC SEROLOGY;FAI,TESTOSTERONE & SHBG;FSH;GH;LH;PROLACTIN;TSH+FT4;FBC;FE STUDIES;FREE T3;L [RT3;DHEAS;FREE TESTOSTERONE;DIHYDROTESTOSTERONE;TBG - Reports to follow] QUERY HYPOPITUITARISM Date Printed: Your Reference: /XT AG/25418/34/35 M Sex: Page: 2 Prolactin 190 mlu/l ( Testosterone * 6.7 nmol/l ( Sex Hormone Binding Globulin 29 nmol/l ( Free Androgen Index 23 % ( methods and COELIAC SEROLOGY Gliadin IgA 4 UlmL ( 0-20 Serologic markers normalise with gluten restriction and are unreliable in IgA deficiency. Gliadin IgA and ttg IgA-lgG may be elevated without coeliac disease. Very elevated gliadin (> 100) and moderately elevated ttg (>50) strongly suggest coeliac disease. Most undiagnosed coeliacs have ttg >300. Coeliac tissue typing excludes coeliac disease risk when HLA-D02 or 008 are absent. THYROID FUNCTION TESTS Free T3 (FT3) Free Thyroxine TSH (FT4) mlu/l ( ( 8-22 ( Cumulative Thyroid Function Current Result 31/03/ /05/08 00:00 00:00 00:00...~'=C?'!ii'i;;.~c,,,n:'i':'W:'"CC,,,,,,,,,.9 7.Q;3.00; , ,!},.,,,,,,,Unils,...,,=.FT3. ':ii';;ihll.:;;li;:;:!;':"'::;,"" ",2'.7..,.",,:,..' 11:3.0. "pmojll FT4 ~.9,,."pmoJl,l.." TSH.2.26 II 3.76.,::."..r:rillJ1l.,:. Growth Hormone 0.5 mlu/l ( 0-15 Ref Aange (2.5~6.0 ). (_8-22 ). (0.30.;,.4.00) KRSMANOVIC, MARKO NATA ACCREDITATION NO PROLACTIN, FAI,TESTOSTERONE & SHBG, COELIAC SER~ fwf~s~appt: '-N-O-TE-S-'I 4222/ /07
4 Toll Free: Resuits: Dr EricaAHN Dr Karl BAUMGART Dr Elizabeth BERNAL Dr Jonathan BLACKWELL Dr David BLAXLAND Dr Warick DELPRADO Dr Colin GOLDSCHMIDT Dr Richard HASKELL D.O.B. (Age): (19) PH: GLUC;COELIAC SEROLOGY;FAi,TESTOSTERONE & SHBG;FSH;GH;LH;PROLACTIN;TSH+FT4;FBC;FE STUOIES;FREE T3;L [RT3;DHEAS;FREE TESTOSTERONE;DIHYDROTESTOSTERONE;TBG. Reports to follow] QUERY HYPOPITUITARISM Date Printed: Your Reference: /XT AG/25419/35/35 Sex: M Page: 3 FSH <0.5 lull Female Basal Mid cycle peak Post-menopausal Male Children Iron Transferrin TIBC (Calculated) Saturation Ferritin 24.0 µmol/l ( * 3.9 gil ( * 84 µmol/l ( % ( µg/l ( KRSMANOVIC, MARKO : FSH, FE STUDIES NATA ACCREDiTATION NO ~ PHONE I APPT: I NOTES I 4222/D
5 fit HANLY I DOUGLASS "We take itpersqnally" MOIR 14 Giffnock Avenue, Milcquarie Park, NSW, AUSTRALIA 2113 All hours: Pathologj~ts' Toll Free: R~sults: DR FREDDY AZAR PLMIPLM!PLM/SMY D.O.B. (Age): (19) PH: /XT AG/25276/4/33 RT3;GlUG;COELIAC SEROlOGY;DHEAS;FAI,TESTOSTERONE & SHBG;FREE TESTOSTERONE;FSH;GH;LH;PROLACTIN ;TSH+FT4;FBC;FE STUDIES;FREE T3;LFT [OIHYDROTESTOSTERONE;TBG - Reports to follow] Clini",1 QUERY HYPOPITUITARISM Date of Service:14-0S_08 Date Printed 10 N0.:96547Q19 YourReference:22310 Sex M Page' 1 Reverse Tri-Iodolhyronine Noles: QUERY HYPOPITUITARISM Reverse T3 Reverse T3 LK 261 { Reported by Sullivan and Nicolaides Pathology, a member of the Sonic Healthcare Group. - - KRSMANOVIC, MARKO: RT3 NATA ACCREDITATION NO 2178 I PHONE I APPT: I NOTES 4222/010302/08
REFERENCE INTERVALS. Units Canine Feline Bovine Equine Porcine Ovine
REFERENCE INTERVALS Biochemistry Units Canine Feline Bovine Equine Porcine Ovine Sodium mmol/l 144-151 149-156 135-151 135-148 140-150 143-151 Potassium mmol/l 3.9-5.3 3.3-5.2 3.9-5.9 3.0-5.0 4.7-7.1 4.6-7.0
More informationNEW RCPCH REFERENCE RANGES-
s vary between populations and age groups and it is important to always check the reference Haematology: Haemoglobin Male 130 175 g/l 0 6 days 145-220 g/l Female 115 165 g/l 7 days 140-186 g/l 8 days 3
More informationSydPath Reference Intervals for Clinical Trials (Contract Pathology Unit) Unauthorised Copy
HAEMATOLOGY APTT 1 150 M 25 35 sec APTT 1 150 F 25 35 sec Basophils Cord 2 weeks M 0.0 0.4 10^9/L Basophils Cord 2 weeks F 0.0 0.4 10^9/L Basophils 2 wks 3 mths M 0.0 0.2 10^9/L Basophils 2 wks 3 mths
More informationMEMORANDUM. These reference ranges are effective immediately but sample requirements remain unchanged currently.
MEMORANDUM Originating Department Chemical Pathology Issued By: Issued To: Subject: Details: Dr. Shari Srinivasan All Laboratory Service Users Change in Chemical Pathology Analysers Dear Colleague, As
More informationA test that can measure the levels of minerals, as well as toxic heavy metals, through a hair mineral analysis.
Hair Mineral Analysis A test that can measure the levels of minerals, as well as toxic heavy metals, through a hair mineral analysis. Your hair contains every single mineral that exists in your body. These
More informationBC Biomedical Laboratories Adult Reference Ranges
BC Biomedical Laboratories Adult s Name Age 25 OH VITAMIN D Blood B 0-100 nmol/l Interpretation: < 25 Deficient 25-74 Insufficient 75-199 Sufficient > 200 Toxic 5HIAA (CALC) Urine B 0-100
More informationROTUNDA HOSPITAL DEPARTMENT OF LABORATORY MEDICINE
This active test table informs the user of Biochemistry tests available in house. s referred to other sites are recorded in the Referred Table. Issue date: 4 TH April 2016 Contact Phone Number ext.1345/2522
More informationHamilton Regional Laboratory Medicine Program
Created: April 2002 of Review: February 2004 of Review: June 2006 of Review: July 2007, St. Joseph s Healthcare went live with Meditech as of June18, 2007. of Review: August 2009 of Review: December 2011;
More informationHamilton Regional Laboratory Medicine Program
Created: April 2002 of Review: February 2004 of Review: June 2006 of Review: July 2007, St. Joseph s Healthcare went live with Meditech as of June18, 2007. of Review: August 2009 of Review: December 2011;
More informationTables of Normal Values (As of February 2005)
Tables of Normal Values (As of February 2005) Note: Values and units of measurement listed in these Tables are derived from several resources. Substantial variation exists in the ranges quoted as normal
More informationPlease contact the Client Services Team if you require further information.
Reference ranges are quoted on all reports where appropriate for the test carried out. The reference range and reporting units, including any interpretive information, is specific to the methodology used
More informationASPEN MOUNTAIN MEDICAL CENTER. Lab Health Fair
ASPEN MOUNTAIN MEDICAL CENTER Lab Health Fair GENERAL HEALTH PANEL: CMP CMP The Comprehensive Metabolic Panel is used as a broad screening tool to evaluate organ function and check for conditions such
More informationFBC interpretation. Dr. Gergely Varga
FBC interpretation Dr. Gergely Varga #1 71 Y/O female, c/o weakness Test Undertaken : FBC (FBC) Sample Type: Whole Blood [ - 26.09.11 14:59] Hb 7.3 g/dl* 12.0-15.5 RBC 3.5 10^12/l * 3.80-5.60 Hct 0.24
More informationAuthorised: JSWoodford, Lead of Speciality. Biochemistry Reference Intervals, October Page 1 of 5
AFP All All < 15 ug/l Albumin All 0-3M 25-40 g/l Albumin All 3-12M 32-45 g/l Albumin All 1-70Y 34-48 g/l Albumin All >70Y 32-46 g/l Alk Phos All 0-10Y 80-350 U/L Alk Phos M 10-14Y 45-400 U/L Alk Phos F
More informationComplete Medical History
Lab Results for Ben Greenfield Last Test Date: Your medical history is not complete. Complete Medical History Complete Medical History What's Next Blood Draw Blood draw scheduled Complete your medical
More informationBiochemistry Adult Reference Ranges
Certified correct on 28/06/2016 Biochemistry Adult Reference Ranges Test Reference range Units Reference range from Traceable to standard reference material Albumin 35 50 g/l Pathology IRMM ERM-DA470k/IFCC
More informationSchedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK
2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK Pathology Laboratory Contact: Gavyn Barrett BMI Blackheath Hospital Tel: +44 (0)20 7307 7373 40-42 Lee Terrace E-Mail: Gavyn.barrett@tdlpathology.com
More informationAustralian and New Zealand College of Veterinary Scientists. Membership Examination. Small Animal Medicine Paper 1
Australian and New Zealand College of Veterinary Scientists Membership Examination June 2017 Small Animal Medicine Paper 1 Perusal time: Fifteen (15) minutes Time allowed: Two (2) hours after perusal Answer
More informationSenior Executive Wellness Profile
Senior Executive Wellness Profile Comprehensive 86 tests from one blood sample to check your current health Patient Name: Elite Business Center, st Floor, # 05 Al Barsha, Behind Mall of Emirates, Dubai,
More information6/3/2018 9:37:00AM 6/3/2018 9:39:05AM 6/3/2018 1:44:56PM A/c Status. Test Name Results Units Bio. Ref. Interval Bilirubin Direct 0.
LL - LL-ROHINI (NATIONAL REFERENCE 140222511 Age 45 Years Gender Male 6/3/2018 93700AM 6/3/2018 93905AM 6/3/2018 14456M Ref By Final Swasth lus Tax Saver anel 1 LIVER & KIDNEY ANEL, SERUM (Spectrophotometry,
More informationACCREDITATION DOCUMENT
Accreditation No: Awarded to Dow Diagnostic Reference and Research Laboratory (DDRRL), Dow University of Health Sciences Suparco Road Gulzar e Hijri KDA Scheme-35, Karachi, Pakistan. The scope of accreditation
More informationTotal Cholesterol A Type of Fat. LDL "Bad" Cholesterol. HDL "Good" Cholesterol. Triglycerides Type of Fat. vldl-c Precursor to LDL Cholest
Lab Results for Ben Greenfield Last Test Date: 2013-08-13 Let us know what you think How likely are you to recommend WellnessFX to a friend or colleague? 1 2 3 4 5 6 7 Not at all likely Neutral Extremely
More informationResults Report. Welcome to Your ABT Report! Introduction to the ABT Report
Results Report Athlete Name: SHEPPARD, JOSEPH Date of Blood Draw: Dec 08, 2017 Panel: ABT Gold Panel ABT Expert: Dr. Rock Welcome to Your ABT Report! Thank you for trusting AthleteBloodTest.com to be a
More informationBASIC METABOLIC PANEL
Update 2/12/2018 BASIC METABOLIC PANEL CPT 80048 Stability: 3 days at 15-25 C; 7 days at 2-8 C; > 7 days at -70 C Colorimetric Assay, Rate reaction, ISE Components: BUN, Calcium, Chloride, CO2, Creatinine,
More informationWeight. Your weight. Body Mass Index Measure of weight to hei. Total to HDL Ratio Total Cholesterol to HDL
Lab Results for Jason Sissel Last Test Date: 2014-11-18 Vital Signs While vital signs often do not give as much specific information as blood tests, they are commonly tracked as macroscopic measures of
More informationWeight Your weight. Body Mass Index Measure of weight to hei. Total to HDL Ratio Total Cholesterol to HDL
Lab Results for Jason Sissel Last Test Date: 2014-12-19 Vital Signs While vital signs often do not give as much specific information as blood tests, they are commonly tracked as macroscopic measures of
More informationClinician Blood Panel Results
Page 1 of 8 Blood Panel - Markers Out of Range and Patterns (Pattern: proprietary formula using one or more Blood Markers) Blood Panel: Check for Markers that are out of Lab Range ***NOTE*** Only one supplement
More informationProvider: TONY BOGGESS DO 1310 S Main St Ann Arbor, MI Account No: Results
DOB: 03.17.1969 Fasting: Yes ACC/AHA Risk Score: BMI: 28.9 Info: 1310 S Main St Ann Arbor, MI 48104 Requisition No: Received Date & Time: 09.09.2017 11:46 AM Collection Date & Time: 09.08.2017 NOT GIVEN
More informationAnalyte Specimen Demographic Reference Range Units
Acetone Negative titer Alanine aminotransferase (ALT/SGPT) 10-49 U/L Albumin 3.2-4.8 g/dl Alcohol < 10 Alpha-fetoprotein (AFP) < 1.3-8.1 ng/ml Alkaline phosphatase 0 7 days 7 30 days 1 3 3 6 6 12 1 3 3
More information*** To get the most out of this report and the consultation, send us blood test results that cover as many of the following markers as possible:
Rick Gold, Certified FDN Practitioner Gold Functional Wellness, Inc. Web: http://goldfunctionalwellness.com/ Phone: (561)270-6364 Email: Rick@goldfunctionalwellness.com Schedule a consultation: https://snapappointments.com/listing/38c
More informationCOMPANY OR UNIVERSITY
CONTRIBUTOR NAME Daniel Heinrich, DVM CONTRIBUTOR EMAIL dheinric@umn.edu COAUTHORS Jed Overmann, DVM, DACVP; Davis Seelig DVM, PhD, DACVP & Matthew Sturos, DVM COMPANY OR UNIVERSITY University of Minnesota
More informationResults Report. Welcome to Your ABT Report!
Results Report Athlete Name: SHEPPARD, JOSEPH Date of Blood Draw: Feb 10, 2018 Panel: ABT Bronze Panel ABT Expert: Dr. Rock Welcome to Your ABT Report! Thank you for trusting AthleteBloodTest.com to be
More informationClinician Blood Panel Results
Page 1 of 8 Blood Panel - Markers Out of Range and Patterns (Pattern: proprietary formula using one or more Blood Markers) Blood Panel: Check for Markers that are out of Lab Range ***NOTE*** Only one supplement
More informationCERTIFICATE OF ACCREDITATION
CERTIFICATE OF ACCREDITATION In terms of section 22(2) (b) of the Accreditation for Conformity Assessment, Calibration and Good Laboratory Practice Act, 2006 (Act 19 of 2006), read with sections 23(1),
More informationHematology TOONYA TURNER. IDEXX Services: Senior Profile with Heartworm -Standard CBC. RBC M/µL. Hematocrit
TOONYA TURNER PET OWNER: TURNER SPECIES: Cnine BREED: GENDER: Femle AGE: 1 Yers PATIENT ID: 17047 Fmily Pet Helth Cre 3623 Indin Hills Rod Dectur, Albm 35603 256-341-0200 ACCOUNT #: 87040 ATTENDING VET:
More informationANNUAL HEALTH CHECKUP BASIC HEALTH PACKAGE
ANNUAL HEALTH CHECKUP Taking care of your health is our responsibility and to make sure that you remain at a distance from the serious maladies, we also step forward in providing health checkups. This
More informationUnderstanding your blood results:
Understanding your blood results: Contents Introduction... 1 Haematology... 2 Biochemistry... 3 MB - 'Electrolytes' (Sodium, Potassium, Chloride, Bicarbonate):... 3 MB - Kidney parameters... 4 MB - Liver
More information10 Essential Blood Tests PART 1
Presents 10 Essential Blood Tests PART 1 The Blood Chemistry Webinars With DR. DICKEN WEATHERBY Creator of the Blood Chemistry Software Essential Blood Test #1: Basic Chem Screen and CBC http://bloodchemsoftware.com
More informationSMITH, JOHN D.C. Functional Health Report Practitioner Copy JANE DOE. Lab Test on Mar 11, 2017 Conventional US Units
SMITH, JOHN D.C. Functional Health Report Practitioner Copy JANE DOE Conventional US Units Table of Contents Health Improvement Plan 3 This report shows customized recommendations based on the blood test
More informationAustralian and New Zealand College of Veterinary Scientists. Fellowship Examination. Veterinary Clinical Pathology Paper 1
Australian and New Zealand College of Veterinary Scientists Fellowship Examination June 2012 Veterinary Clinical Pathology Paper 1 Perusal time: Twenty (20) minutes Time allowed: Three (3) hours after
More informationHMCL223 Clinical Diagnostic Techniques
HMCL223 Clinical Diagnostic Techniques Session 1: Introduction, Screening blood tests part I Endeavour College of Natural Health endeavour.edu.au 1 Session Objectives Introduction Testing standards, populations
More informationGRADING CRITERIA for CMS Regulated Analytes
CLIA '88 AND GRADING The Clinical Laboratory Improvement Amendments of 1988 (CLIA '88) were established by the federal government (CMS) to regulate clinical laboratories and proficiency test providers
More informationENROLLMENT CONFIRMATION
Step 1: Please review the Facility/Contact information. If any of the information is incorrect, please make the appropriate changes below: Facility/Contact Phone: (850)474-3660 Fax: (850)474-3659 6431
More informationNORMAL LABORATORY VALUES FOR CHILDREN
Pediatric Drug Lookup Normal Laboratory Values for NORMAL LABORATORY VALUES FOR CHILDREN CHEMISTRY Normal Values Albumin 0-1 y 2.0-4.0 g/dl 1 y to adult 3.5-5.5 g/dl Ammonia Newborns 90-150 mcg/dl 40-120
More informationTypes of target values, acceptable ranges
Types of target values, acceptable ranges As the differential of rounding, maximum 1 percent point deviation is allowed from the maximum acceptable range. 100. Clinical chemistry (wet) 1. Calcium RMV 10
More informationMEDICAL HISTORY. 23-Jan-2018 to 23-Jan VCA Miller-Robertson Animal Hospital 8807 Melrose Ave, Los Angeles, CA (310)
8807 Melrose Ave, Los Angeles, CA 90069 (310) 657-7050 MEDICAL HISTORY 23-Jan-2018 to 23-Jan-2018 Client Linnea Engdahl (1810) C: Linnea: (310) 351-9547 Patient Abby (6487) Canine Mixed Breed 3y (22-Jan-2015)
More informationSMITH, JOHN D.C. Functional Health Report. Patient Copy JANE DOE. Lab Test on Mar 11, 2017 Conventional US Units
SMITH, JOHN D.C. Functional Health Report Patient Copy JANE DOE Conventional US Units Table of Contents Health Improvement Plan 3 This report shows customized recommendations based on the blood test results.
More informationCERTIFICATE OF ACCREDITATION
CERTIFICATE OF ACCREDITATION In terms of section 22(2) (b) of the Accreditation for Conformity Assessment, Calibration and Good Laboratory Practice Act, 2006 (Act 19 of 2006), read with sections 23(1),
More informationPOSTGRADUATE INSTITUTE OF MEDICINE UNIVERSITY OF COLOMBO
POSTGRADUATE INSTITUTE OF MEDICINE UNIVERSITY OF COLOMBO Selection Examination for Enrolment to the in-service Training Programme in Postgraduate Certificate in Basic Laboratory Sciences leading to the
More informationComparison of VACUETTE Heparin Gel Tubes for Common Chemistry Analytes
Comparison of VACUETTE Heparin Gel Tubes for Common Chemistry Analytes Background: Greiner-Bio-One, Austria has been selling plastic evacuated tubes (VACUETTE ) for venous blood collection since 9. The
More informationCytochrome-C (rat, mouse) forward GGAGGCAAGCATAAGACTGG. mouse hexokinase 2 gene, intron 9 reverse GGGAACACAAAAGACCTCTTCTGG
Supplementary Table 1. The sequences of oligonucleotide primers. Genes Sequence rat actin forward CGAGTACAACCTTCTTGCAG rat actin reverse GAGTCCTTCTGACCCATACC tubulin (rat, mouse) forward TAGCAGAGATCACCAATGCC
More informationSaskatchewan ND Price List
Saskatchewan ND Price List Note: There is a $55 per requisition documentation fee. Prices valid only in Saskatchewan. PANEL Healthy Living Assessment Panel $115.00 Enhanced Healthy Living Assessment Panel
More informationCROATIAN SOCIETY OF MEDICAL BIOCHEMISTRY AND LABORATORY MEDICINE
CROATIAN SOCIETY OF MEDICAL BIOCHEMISTRY AND LABORATORY MEDICINE Croatian Centre for Quality Assessment in Laboratory Medicine Dear colleagues, Boskoviceva 18, 10000 Zagreb Croatia Tel/Phone & Fax: +385
More informationSchedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK
2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK Biochemistry Department University Hospital of North Durham Durham County Durham DH1 5TW Contact: Dr Tim Lang Tel: +44 (0) 191 333 2694 Fax:
More informationAustralian and New Zealand College of Veterinary Scientists. Membership Examination. Veterinary Pathology Paper 1
Australian and New Zealand College of Veterinary Scientists Membership Examination June 2014 Veterinary Pathology Paper 1 Perusal time: Fifteen (15) minutes Time allowed: Two (2) hours after perusal Answer
More information15/9/2017 4:23:00PM 15/9/2017 4:26:06PM 20/9/2017 4:58:24PM A/c Status. Test Name Results Units Bio. Ref. Interval < >40.00 mg/dl <150.
Lab No 135091258 Age 30 Years Gender Male 15/9/2017 42300M 15/9/2017 42606M 20/9/2017 45824M Ref By UNKNWON Final Test Results Units Bio Ref Interval SWASTH LUS HEALTH ADVANCE ANEL LIID ROFILE, BASIC,
More informationThe Use of Tests in Clinical Biochemistry Interpreting Blood Results. Rowland Reece Principal Clinical Biochemist St. Vincent s University Hospital
The Use of Tests in Clinical Biochemistry Interpreting Blood Results Rowland Reece Principal Clinical Biochemist St. Vincent s University Hospital Topic Headlines What is Clinical Biochemistry? How does
More informationProvided by MedicalStudentExams.com NORMAL LABORATORY VALUES
NORMAL LABORATORY VALUES 1. BLOOD, PLASMA, SERUM 2. CEREBROSPINAL FLUID 3. HEMATOLOGIC 4. SWEAT 5. URINE 6. SYNOVIAL FLUID 7. TOXIC LEVELS 8. Tumour Markers 9. Differential of Cerebral Spinal Fluid 10.
More information1.) 3 yr old FS Siamese cat: 3 day history of lethargy, anorexia. Dyspneic, thin, febrile.
1.) 3 yr old FS Siamese cat: 3 day history of lethargy, anorexia. Dyspneic, thin, febrile. NUCLEATED CELLS 19.5 High 4.0-14.0 x 10^3/ul METAMYELOCYTES 9 % 1.8 High 0.0-0.0 x 10^3/ul BAND NEUTROPHILS 61
More informationClinician Blood Panel Results
Page 1 of 7 Blood Panel - Markers Out of Range and Patterns (Pattern: proprietary formula using one or more Blood Markers) Blood Panel: Check for Markers that are out of Lab Range ***NOTE*** Only one supplement
More informationSchedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK
2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK Biochemistry Department Poole Hospital Longfleet Road Poole BH15 2JB Contact: Dr Fergus Jack Tel: +44 (0) 1202 442 497 E-Mail: Fergus.jack@poole.nhs.uk
More informationLabDriver Audit Trail Example
LabDriver Audit Trail Example Sample details:= (SampleDId=82051) Lab no: 0902168 Centre: CR Centre (CentreId=1079) (BatchSId=1317) Status: Checked Blood date: 13/05/2009 time: 11:31:00 lab received: 13/05/2009
More informationS Potassium K mmol/l Up to 1m m - 1y >1y /07/2010. S Chloride CL mmol/l Up to 3m > 3m /07/2010
Northumbria Healthcare NHS Trust Clinical Chemistry Deartment Reference Ranges Reference Ranges in use in Telepath Laboratory System at July 2005 unless indicated otherwise Last date Amended; 20/08/2010
More informationPreconception carrier screening. Information for Doctors
Preconception carrier screening Information for Doctors Preconception carrier screening can identify individuals or couples at high risk of having a child with a serious heritable disorder. This test is
More informationLABORATORY NORMAL RANGES. Prepared by Date Adopted Supersedes Procedure # / Dated William T. Pope, PhD and
Prepared by Date Adopted Supersedes Procedure # / Dated William T. Pope, PhD and 3-31-09 Normal Ranges / 12-30-08 Christy O Brien, MT (ASCP) CHEMISTRY Acetone None detected Albumin, g/dl 3.5-5.0 Adult
More informationInterpreting Blood Tests Part 1. Dr Andrew Smith
Interpreting Blood Tests Part 1 Dr Andrew Smith Outline Part 1 (This Week) Introduction Which Tube!?! FBCs U+Es Part 2 (Next Week): More Electrolytes LFTs Clotting Extras Introduction Bloods are a core
More informationEvaluation of VACUETTE CAT Serum Fast Separator Blood Collection Tube for Routine Chemistry Analytes in Comparison to VACUTAINER RST Tube
Evaluation of VACUETTE CAT Serum Fast Separator Blood Collection Tube for Routine Chemistry Analytes in Comparison to VACUTAINER RST Tube Background: Greiner-Bio-One, Austria has been selling plastic evacuated
More informationCERTIFICATE OF ACCREDITATION
CERTIFICATE OF ACCREDITATION In terms of section 22(2) (b) of the Accreditation for Conformity Assessment, Calibration and Good Laboratory Practice Act, 2006 (Act 19 of 2006), read with sections 23(1),
More informationStability of VACUETTE Lithium Heparin Separator tubes with modified centrifugation conditions
Stability of VACUETTE Lithium Heparin Separator tubes with modified centrifugation conditions Background: Greiner-Bio-One, Austria has been selling plastic evacuated tubes (VACUETTE ) for venous blood
More informationReproductive carrier screening
Reproductive carrier screening Information for Doctors Available for three of the most common disorders Cystic fibrosis Spinal muscular atrophy Fragile X syndrome RANZCOG recommends that information about
More informationKathryn Jones 8/11/2015
1 of 8 8/11/2015 2:25 PM This informa on is copyrighted 2014 by Balancing Body Chemistry with Nutri on Seminars. No part may be copied or reproduced without wri en approval of Balancing Body Chemistry
More informationHormone Balance - Female Report SAMPLE. result graph based on Luteal Phase. result graph based on Luteal Phase
Patient Name: Patient DOB: Gender: Physician: Test Hormone Balance - Female Report SAMPLE Grote, Mary Jane Batch Number: B6437 2/16/1954 Accession Number: N52281 F Date Received: 2/3/2015 Any Lab Test
More informationBIO 116 Practice Assignment 1 The Endocrine System and Blood This is not a required assignment but it is recommended.
BIO 116 Practice Assignment 1 The Endocrine System and Blood This is not a required assignment but it is recommended. 1. Match the following glands of the endocrine system with the appropriate label 1.
More informationWeight Your weight. Body Mass Index Measure of weight to hei. Waist Circumference The circumference of you
Lab Results for Ben Greenfield Last Test Date: 2015-01-27 Vital Signs While vital signs often do not give as much specific information as blood tests, they are commonly tracked as macroscopic measures
More informationFullerton Healthcare Screening Centres
Fullerton Healthcare Screening Centres Fullerton Healthcare Screening Centre @ Ngee Ann City The Penthouse, #26-02 Ngee Ann City Tower B, 391B Orchard Road, Singapore 238874 Operating hours: Monday - Friday
More informationCERTIFICATE OF ACCREDITATION
CERTIFICATE OF ACCREDITATION In terms of section 22(2) (b) of the Accreditation for Conformity Assessment, Calibration and Good Laboratory Practice Act, 2006 (Act 19 of 2006), read with sections 23(1),
More informationSchedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK
2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK Ltd Pathology Department Contact: Sally Curtis BMI The Priory Hospital Tel: +44 (0) 20 7307 7342 Priory Road E-Mail: sally.curtis@tdlpathology.com
More informationSchedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK
2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK Spire Portsmouth Hospital Bartons Road Havant PO9 5NP United Kingdom Contact: Natalie Peck E-Mail: natalie.peck@spirehealthcare.com Website:
More informationCERTIFICATE OF ACCREDITATION
CERTIFICATE OF ACCREDITATION In terms of section 22(2) (b) of the Accreditation for Conformity Assessment, Calibration and Good Laboratory Practice Act, 2006 (Act 19 of 2006), read with sections 23(1),
More informationSMITH, JOHN D.C. Functional Health Report. Practitioner Copy JANE DOE. Lab Test on Jul 31, 2017 Conventional US Units
SMITH, JOHN D.C. Functional Health Report Practitioner Copy JANE DOE Conventional US Units Table of Contents Health Improvement Plan 5 This report shows customized recommendations based on the blood test
More informationHemochromatosis Information KIT for NEWBIES
Hemochromatosis Information KIT for NEWBIES Your KIT includes first steps for a complete diagnosis, next steps for appropriate treatment, next steps to inform family members and helpful items developed
More informationEvaluation of new MiniCollect Z Serum (Separator) Tubes
Evaluation of new MiniCollect Z Serum (Separator) Tubes Background: Greiner Bio-One has developed a newly designed MiniCollect tube offering an integrated collection scoop. The advantage of the new tube
More informationFasting total cholesterol, LDL cholesterol, HDL cholesterol and triglycerides (if fasting levels are not already available) *
Antipsychotic Shared Care and Physical Health Monitoring Recommendations Version 5 INDICATION - All patients on antipsychotics for chronic psychiatric illness Consultant/Specialist Care Services will initiate
More informationICL Integrative Laboratory Services Test Menu Contact ICL Client Care x300
Alletess Food Sensitivity Fingerstick 96 Foods IgG with or without Wellness Program 184 Foods IgG with or without Wellness Program Alletess Food Allergy/Sensitivity Serum 96 Foods IgG with or without Wellness
More informationStudy. Human Tolerance of Low Molecular Weight. Polyethylene Markers. Prof. Dr. Dr. Ruprecht Keller. Krankenhaus Merheim Zentrallabor
Study Human Tolerance of Low Molecular Weight Polyethylene Markers Prof. Dr. Dr. Ruprecht Keller Krankenhaus Merheim Zentrallabor Ostmerheimerstr. 00 509 Köln Human Tolerance of Low Molecular Weight Polyethylene
More information* * Interpretation
LL - LL-ROHINI (NATIONAL REFERENCE 139242049 Age Unknown Gender Unknown 9/3/2018 120000AM 9/3/2018 40032M 10/3/2018 24647M Ref By Final SUGAR ADVANCE ANEL MICROALBUMIN,1ST MORNING/RANDOM URINE (Immunoturbidimetry,Spectrophotometry)
More informationTEST LIST SAMPLE REQUIREMENT. 1 ml serum None
ALBUMIN TEST NAME ALKALINE PHOSPHATASE ALLERGY PROFILE, FOOD 30 allergens ALLERGY PROFILE, INHALANT 30 Allergens ALT AMYLASE ANA ANTI- TG ANTI-GLIADIN IGG ANTI-GLIADIN IGA ANTI-HBS ANTI-HCV ANTI-TPO APOLIPOPROTEIN
More informationWhile vital signs often do not give as much specific information as blood tests, they are commonly tracked as macroscopic measures of health.
Lab Results for Ben Greenfield Last Test Date: 2014-04-23 Vital Signs While vital signs often do not give as much specific information as blood tests, they are commonly tracked as macroscopic measures
More informationCOMMITTEE FOR MEDICINAL PRODUCTS FOR VETERINARY USE (CVMP) LIST ON
European Medicines Agency Veterinary Medicines and Inspections London, 20 November 2006 EMEA/CVMP/556/04- Rev.1 COMMITTEE FOR MEDICINAL PRODUCTS FOR VETERINARY USE (CVMP) LIST ON ADDITIONAL CONTROLLED
More information28. Bilirubin (total, total conjugated, unconjugated, direct and indirect).
1. 17-OH-Progesterone. 2. 5α-dihydrotestosterone (DHT). 3. Adrenocorticotropic Hormone ACTH. 4. Alanine Transaminase (ALT, SGPT). 5. Albumin, qualitative. 6. Aldosterone. 7. Allergen Specific IgG Antibody.
More informationBlood Test Results Report
Blood Test Results Report The Blood Test Results Report lists the results of the patient s Chemistry Screen and CBC and shows you whether or not an individual element is outside of the optimal range and/or
More informationBio-Rad Laboratories EQAS. External Quality Assurance Services
Bio-Rad Laboratories EXternal QUALITY ASSURANCE SERVICES EQAS External Quality Assurance Services Bio-Rad Laboratories EXternal QUALITY ASSURANCE SERVICES Participate in an internationally recognized quality
More informationRapid Laboratories In House Tests
Electrolytes CL CL (CHLORIDE) Electrolytes CO2 CO2 (BICARBONATE) Electrolytes K K (POTASSIUM) Electrolytes NA NA (SODIUM) Basic Metabolic Panel (BMP) GLU GLU (GLUCOSE) Basic Metabolic Panel (BMP) CA CA
More informationCERTIFICATE OF ACCREDITATION
CERTIFICATE OF ACCREDITATION LANCET KENYA LIMITED UPPERHILL NAIROBI LABORATORY Co. Reg. No.: C168507 Facility Accreditation Number: is a South African National Accreditation System accredited laboratory
More informationHaemochromatosis. Testing and Treatment
Haemochromatosis Testing and Treatment How the body controls iron levels We get iron from the food we eat and the amount absorbed is determined by our body s needs. We do not have a biological mechanism
More informationMinimum Whole Blood Volumes for Microcollection Tubes for Neonates, Pediatrics, Patients less than 45 kg (100 lb) and Difficult Collections
The following table outlines the minimum whole blood volume that must be drawn into a microcollection tube (unless otherwise stated) for an individual test on a neonate, pediatric, patient weighing less
More information5/6/ :35:00AM 5/6/ :57:28AM 5/6/2017 3:49:09PM A/c Status. Test Name Results Units Bio. Ref. Interval
LL - LL-ROHINI (NATIONAL REFERENCE 136235211 Age Unknown Gender Unknown 5/6/2017 103500AM 5/6/2017 105728AM 5/6/2017 34909M Ref By Final Swasth lus Health Advance anel LIVER & KIDNEY ANEL, SERUM (Spectrophotometry,
More informationHd Hydroxylase. Cholesterol. 17-OH Pregnenolne DHEA Andrstendiol. Pregnenolone. 17-OH Progestrone. Androstendione. Progestrone.
PATHOPHISIOLOGY OF SEX HORMONES R. Mohammadi Biochemist (Ph.D.) Faculty member of Medical Faculty CHOLESTEROL IS THE PRECURSOR OF STERIOD HORMONES Cholesterol Pregnenolone 17-OH 17βHSD Pregnenolne DHEA
More information