SUPPLEMENTARY INFORMATION
|
|
- Justina Martin
- 6 years ago
- Views:
Transcription
1 DOI: /ncb2294 Figure S1 Localization and function of cell wall polysaccharides in root hair cells. (a) Spinning-disk confocal sections of seven day-old A. thaliana seedlings stained with 0.1% S4B were collected with a 10X objective (scale bars = 50 mm) using either brightfield (left panel) or appropriate filter sets to image S4B fluorescence (right panel). Young root hairs in a zone in which active tip-growth occurs display highly enriched S4B staining predominantly in the root hair apex (arrowheads), while mature root hairs display much more uniform staining along the entire root hair shaft (brackets). Quantification of the time- and dose-dependent effects of cellulase (b), xyloglucanase (c), and pectate lyase (d) treatment on growing root hairs. Characterization of the effect of xyloglucanase treatment on cellulose or cellulose-like polysaccharides (e), or xyloglucan (f) in growing root hairs. Medial confocal sections of root hairs from zones of active tip-growth were collected using a 40X (left; scale bar = 10 mm) or 10X lens (right; scale bar = 50 mm) and brightfield (upper panels) or appropriate filter sets to visualize S4B (e; lower panels) or anti-ccrc-m1 immunofluorescence (f; lower panels, 40X lens) either prior to (left panels) or after xyloglucanase treatment (+XGase; right panels) (scale bars = 10 mm). 1
2 Figure S2 (a). Brightfield image of root hairs from seven day-old wt(col-0) seedlings, (b). Root hairless kjk-2 seedling, (c). kjk-2 seedling transformed with 35S::EYFP-CSLD3. (d-e) Medial plane optical sections of kjk-2 seedlings rescued with (d) 35S::EYFP-CSLD3 or (e) the endogenous promoter (endop::eyfp-csld3) collected using spinning-disk confocal microscopy and appropriate filter sets. (f) Root hair lengths in wt(col-0), and kjk-2 lines rescued with EYFP-CSLD3 driven by either endogenous CSLD3 promoter (endop) or 35S EYFP-CSLD3::A6CD chimera driven by 35S promoter. Average length of root hairs (n = 30) from three independent seedlings were measured, error bars = +/- SD (scale bars = 100 mm for A-C; 10 mm for D-E). 2
3 Figure S3 Polarized EYFP-CSLD3 localizes into discrete regions of fluorescence that are motile in the tips of root hair cells. (a) Three successive Z-plane optical sections of a growing root hair cell stably expressing EYFP- CSLD3 were collected using spinning-disk confocal microscopy. EYFP- CSLD3 fluorescence was collected for 50 milliseconds with a 100X oil objective (1.46 NA) and optical sections are separated by 1 mm distances. EYFP-CSLD3 is enriched in a tip-restricted plasma membrane domain in the apex of the hair cell, and does not appear to be uniform but localizes in discrete regions of high fluorescence (highlighted by arrowheads; scale bar = 2 mm). (b) EYFP-CSLD3 dynamics within the apical plasma membrane domain. Successive frames of a time-lapse movie were collected for 50 milliseconds with a 100X oil objective (1.46 NA) at five second intervals. Zones where discrete regions of higher EYFP-CLSD3 fluorescence were detected are indicated by white or yellow brackets. While some of these appeared motionless relative to the growing tip (white asterisk) multiple fluorescent regions appeared and disappeared from the confocal plane, or could be observed to move position relative to the growing root hair apex (arrow heads; scale bar = 2 mm). 3
4 Figure S4 Fluorescence recovery after photobleaching growing root hairs. Medial confocal sections were collected from growing root hairs from seven day-old seedlings expressing EYFP-CSLD3. After establishing root hairs were growing, photobleaching was performed within small (a) or large (c) ROI (red circles). Quantification of fluorescence recovery of EYFP-CSLD3 within the apical plasma membrane domain in two independent root hairs (black squares and grey triangles) was measured at 2-second intervals within the small (b) or large (d) photobleached ROI. 4
5 Figure S5 Fluorescence recovery after photobleaching in latrunculin B treated root hairs. Medial confocal sections were collected from growing root hairs from seven day-old seedlings expressing EYFP-CSLD3. After establishing root hairs were growing, they were treated with 200 nm latrunculin B. Upon loss of cytoplasmically localized EYFP-CSLD3 vesicles within the root hair apex, photobleaching was performed within small (a) or large (c) ROI (red circles). Quantification of fluorescence recovery of EYFP- CSLD3 within the apical plasma membrane domain in two independent root hairs (black squares and grey triangles) was measured within the small (b) or large (d) photobleached ROI (scale bar = 1 mm). 5
6 Primers Primer Sequence (5-3 ) A: CSLD3-upper ATGGCGTCTAATAATCATTTCATGAACAGTAG B: CSLD3-lower TCATGGGAAAGTGAAAGATCCTCCGATTT C: kjk-4-lower TCATTTGATCTCGAGGAGAGCGAGTA D: CSLD3-Nterm-upper ATGGCGTCTAATAATCATTTCATGAACAGT E: CSLD3-Nterm-lower GGAAACCACTTGGGAAACTGATCAAGTAGC F: CSLD3-Cterm-upper GAGAGGTTTGCGTATGTGAACGTTGGAATCTAC G: CSLD3-Cterm-lower TCATGGGAAAGTGAAAGATCCTCCGATT H: CESA6-CD-upper ATCAGTTCCCTAAATGGTACCC I: CESA6-CD-lower GAGTTAATGTAGGACAACCGCT Table S1 Primers used for PCR amplification and assembly of CSLD3, kjk-4, and CSLD3::A6CD constructs. 6
7 Supplementary Movie Legends Movie 1: DCB treatment results in rapid root hair rupture. Movie 2A: Cellulase treatment results in root hair rupture, but can be competitively inhibited by 0.8 mg/ml CM-cellulose. Movie 2B: Xyloglucanase treatment inhibits root hair growth. Movie 2C: Pectate lyase treatment inhibits root hair growth. Movie 3: EYFP-CESA6 is restricted to internal compartments in growing root hair cells. Movie 4: A functional EYFP-CSLD3 fusion localizes to membranes in the tips of growing root hair cells. Movie 5: Delivery of EYFP-CSLD3 to tip-enriched plasma membranes requires an intact actin cytoskeleton. Movie 6: EYFP-CSLD3 localizes as discrete particles in tip-enriched plasma membranes in growing root hair cells. Movie 7: EYFP-CSLD3 dynamics within the apical plasma membranes in growing root hair cells. Movie 8A: FRAP analysis of EYFP-CSLD3 in growing root hair cells; small ROI. Movie 8B: FRAP analysis of EYFP-CSLD3 in growing root hair cells; large ROI. Movie 8C: FRAP analysis of EYFP-CSLD3 in the apical plasma membrane domain of latrunculin B treated root hair cells; small ROI. Movie 8D: FRAP analysis of EYFP-CSLD3 in the apical plasma membrane domain of latrunculin B treated root hair cells; large ROI. Movie 9: DCB effect on EYFP-CSLD3 dynamics in the tips of root hair cells. Movie 10: Isoxaben has no effect on EYFP-CSLD3 localization in growing root hair cells. Movie 11: CGA treatment inhibits root hair growth and induces cell rupture and bulging. Movie 12: Subcellular distribution of the EYFP-CSLD3::A6CD chimera in a growing root hair cell from a rescued kjk-2 seedling. 7
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2988 Supplementary Figure 1 Kif7 L130P encodes a stable protein that does not localize to cilia tips. (a) Immunoblot with KIF7 antibody in cell lysates of wild-type, Kif7 L130P and Kif7
More informationSupplemental Data. Beck et al. (2010). Plant Cell /tpc
Supplemental Figure 1. Phenotypic comparison of the rosette leaves of four-week-old mpk4 and Col-0 plants. A mpk4 vs Col-0 plants grown in soil. Note the extreme dwarfism of the mpk4 plants (white arrows)
More informationJ. Cell Sci. 129: doi: /jcs : Supplementary information
Movie 1. AgLDL is contained in small sub-regions of the lysosomal synapse that are acidic. J774 cells were incubated with agldl dual labeled with a ph sensitive and a ph insensitive fluorophore for 1 hr.
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb3443 In the format provided by the authors and unedited. Supplementary Figure 1 TC and SC behaviour during ISV sprouting. (a) Predicted outcome of TC division and competitive Dll4-Notch-mediated
More informationSupplemental Materials Molecular Biology of the Cell
Supplemental Materials Molecular Biology of the Cell Gilberti et al. SUPPLEMENTAL FIGURE LEGENDS: Figure S1: The effect of pharmacological inhibitors on particle uptake. The data presented in Figure 1
More informationSupplemental Data. Wang et al. (2013). Plant Cell /tpc
Supplemental Data. Wang et al. (2013). Plant Cell 10.1105/tpc.112.108993 Supplemental Figure 1. 3-MA Treatment Reduces the Growth of Seedlings. Two-week-old Nicotiana benthamiana seedlings germinated on
More informationSupplementary Figure 1: GFAP positive nerves in patients with adenocarcinoma of
SUPPLEMENTARY FIGURES AND MOVIE LEGENDS Supplementary Figure 1: GFAP positive nerves in patients with adenocarcinoma of the pancreas. (A) Images of nerves stained for GFAP (green), S100 (red) and DAPI
More informationSUPPLEMENTARY INFORMATION
DOI:.38/ncb3399 a b c d FSP DAPI 5mm mm 5mm 5mm e Correspond to melanoma in-situ Figure a DCT FSP- f MITF mm mm MlanaA melanoma in-situ DCT 5mm FSP- mm mm mm mm mm g melanoma in-situ MITF MlanaA mm mm
More informationMII. Supplement Figure 1. CapZ β2. Merge. 250ng. 500ng DIC. Merge. Journal of Cell Science Supplementary Material. GFP-CapZ β2 DNA
A GV GVBD MI DNA CapZ β2 CapZ β2 Merge B DIC GFP-CapZ β2 Merge CapZ β2-gfp 250ng 500ng Supplement Figure 1. MII A early MI late MI Control RNAi CapZαβ DNA Actin Tubulin B Phalloidin Intensity(A.U.) n=10
More informationT H E J O U R N A L O F C E L L B I O L O G Y
T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Lu et al., http://www.jcb.org/cgi/content/full/jcb.201012063/dc1 Figure S1. Kinetics of nuclear envelope assembly, recruitment of Nup133
More informationSUPPLEMENTARY INFORMATION. Supplementary Figures
SUPPLEMENTARY INFORMATION Supplementary Figures Supplementary Figure 1: Characterization of CerTN-L15 expressed in Arabidopsis roots. a. Ratiometric images of CerTN-L15 in roots under osmotic stress Ratiometric
More informationT H E J O U R N A L O F C E L L B I O L O G Y
Supplemental material Brooks and Wallingford, http://www.jcb.org/cgi/content/full/jcb.201204072/dc1 T H E J O U R N A L O F C E L L B I O L O G Y Figure S1. Quantification of ciliary compartments in control
More informationSUPPLEMENTARY LEGENDS...
TABLE OF CONTENTS SUPPLEMENTARY LEGENDS... 2 11 MOVIE S1... 2 FIGURE S1 LEGEND... 3 FIGURE S2 LEGEND... 4 FIGURE S3 LEGEND... 5 FIGURE S4 LEGEND... 6 FIGURE S5 LEGEND... 7 FIGURE S6 LEGEND... 8 FIGURE
More informationSUPPLEMENTARY INFORMATION
DOI: 1.138/ncb222 / b. WB anti- WB anti- ulin Mitotic index (%) 14 1 6 2 T (h) 32 48-1 1 2 3 4 6-1 4 16 22 28 3 33 e. 6 4 2 Time (min) 1-6- 11-1 > 1 % cells Figure S1 depletion leads to mitotic defects
More informationFig. S1. Subcellular localization of overexpressed LPP3wt-GFP in COS-7 and HeLa cells. Cos7 (top) and HeLa (bottom) cells expressing for 24 h human
Fig. S1. Subcellular localization of overexpressed LPP3wt-GFP in COS-7 and HeLa cells. Cos7 (top) and HeLa (bottom) cells expressing for 24 h human LPP3wt-GFP, fixed and stained for GM130 (A) or Golgi97
More informationTanimoto et al., http ://www.jcb.org /cgi /content /full /jcb /DC1
Supplemental material JCB Tanimoto et al., http ://www.jcb.org /cgi /content /full /jcb.201510064 /DC1 THE JOURNAL OF CELL BIOLOGY Figure S1. Method for aster 3D tracking, extended characterization of
More informationThe Rab GTPase RabA4d Regulates Pollen Tube Tip Growth in Arabidopsis thaliana W
The Plant Cell, Vol. 21: 526 544, February 2009, www.plantcell.org ã 2009 American Society of Plant Biologists The Rab GTPase RabA4d Regulates Pollen Tube Tip Growth in Arabidopsis thaliana W Amy L. Szumlanski
More informationT H E J O U R N A L O F C E L L B I O L O G Y
Supplemental material Edens and Levy, http://www.jcb.org/cgi/content/full/jcb.201406004/dc1 T H E J O U R N A L O F C E L L B I O L O G Y Figure S1. Nuclear shrinking does not depend on the cytoskeleton
More informationSupplemental information contains 7 movies and 4 supplemental Figures
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 Supplemental information contains 7 movies and 4 supplemental Figures Movies: Movie 1. Single virus tracking of A4-mCherry-WR MV
More informationF-actin VWF Vinculin. F-actin. Vinculin VWF
a F-actin VWF Vinculin b F-actin VWF Vinculin Supplementary Fig. 1. WPBs in HUVECs are located along stress fibers and at focal adhesions. (a) Immunofluorescence images of f-actin (cyan), VWF (yellow),
More informationSUPPLEMENTARY INFORMATION
DOI: 0.038/ncb33 a b c 0 min 6 min 7 min (fixed) DIC -GFP, CenpF 3 µm Nocodazole Single optical plane -GFP, CenpF Max. intensity projection d µm -GFP, CenpF, -GFP CenpF 3-D rendering e f 0 min 4 min 0
More informationSUPPLEMENTARY FIGURE LEGENDS
SUPPLEMENTARY FIGURE LEGENDS Supplemental FIG. 1. Localization of myosin Vb in cultured neurons varies with maturation stage. A and B, localization of myosin Vb in cultured hippocampal neurons. A, in DIV
More informationNature Biotechnology: doi: /nbt Supplementary Figure 1. Analysis of hair bundle morphology in Ush1c c.216g>a mice at P18 by SEM.
Supplementary Figure 1 Analysis of hair bundle morphology in Ush1c c.216g>a mice at P18 by SEM. (a-c) Heterozygous c.216ga mice displayed normal hair bundle morphology at P18. (d-i) Disorganized hair bundles
More informationSupplemental Data. Wu et al. (2010). Plant Cell /tpc
Supplemental Figure 1. FIM5 is preferentially expressed in stamen and mature pollen. The expression data of FIM5 was extracted from Arabidopsis efp browser (http://www.bar.utoronto.ca/efp/development/),
More informationSupplementary Materials for
advances.sciencemag.org/cgi/content/full/3/6/e1700338/dc1 Supplementary Materials for HIV virions sense plasma membrane heterogeneity for cell entry Sung-Tae Yang, Alex J. B. Kreutzberger, Volker Kiessling,
More informationSupplementary Data Dll4-containing exosomes induce capillary sprout retraction ina 3D microenvironment
Supplementary Data Dll4-containing exosomes induce capillary sprout retraction ina 3D microenvironment Soheila Sharghi-Namini 1, Evan Tan 1,2, Lee-Ling Sharon Ong 1, Ruowen Ge 2 * and H. Harry Asada 1,3
More informationSupplementary Figure S1 (a) (b)
Supplementary Figure S1: IC87114 does not affect basal Ca 2+ level nor nicotineinduced Ca 2+ influx. (a) Bovine chromaffin cells were loaded with Fluo-4AM (1 μm) in buffer A containing 0.02% of pluronic
More informationSupplementary Figure 1. Baf60c and baf180 are induced during cardiac regeneration in zebrafish. RNA in situ hybridization was performed on paraffin
Supplementary Figure 1. Baf60c and baf180 are induced during cardiac regeneration in zebrafish. RNA in situ hybridization was performed on paraffin sections from sham-operated adult hearts (a and i) and
More informationNature Neuroscience: doi: /nn Supplementary Figure 1. Neuron class-specific arrangements of Khc::nod::lacZ label in dendrites.
Supplementary Figure 1 Neuron class-specific arrangements of Khc::nod::lacZ label in dendrites. Staining with fluorescence antibodies to detect GFP (Green), β-galactosidase (magenta/white). (a, b) Class
More informationSupplementary Figure 1
S U P P L E M E N TA R Y I N F O R M AT I O N DOI: 10.1038/ncb2896 Supplementary Figure 1 Supplementary Figure 1. Sequence alignment of TERB1 homologs in vertebrates. M. musculus TERB1 was derived from
More informationSUPPLEMENTARY INFORMATION
Supplementary Information included with Nature MS 2008-02-01484B by Colantonio et al., entitled The dynein regulatory complex is required for ciliary motility and otolith biogenesis in the inner ear. This
More informationSupplementary Information
Nature Immunology doi:1.138/ni.2477 Supplementary Information Capillary and arteriolar pericytes attract innate leukocytes exiting through venules and instruct them with pattern recognition and motility
More informationDynamic Partitioning of a GPI-Anchored Protein in Glycosphingolipid-Rich Microdomains Imaged by Single-Quantum Dot Tracking
Additional data for Dynamic Partitioning of a GPI-Anchored Protein in Glycosphingolipid-Rich Microdomains Imaged by Single-Quantum Dot Tracking Fabien Pinaud 1,3, Xavier Michalet 1,3, Gopal Iyer 1, Emmanuel
More informationCD3 coated cover slips indicating stimulatory contact site, F-actin polymerization and
SUPPLEMENTAL FIGURES FIGURE S1. Detection of MCs. A, Schematic representation of T cells stimulated on anti- CD3 coated cover slips indicating stimulatory contact site, F-actin polymerization and microclusters.
More information(a) Significant biological processes (upper panel) and disease biomarkers (lower panel)
Supplementary Figure 1. Functional enrichment analyses of secretomic proteins. (a) Significant biological processes (upper panel) and disease biomarkers (lower panel) 2 involved by hrab37-mediated secretory
More informationSupplementary Figure S1: TIPF reporter validation in the wing disc.
Supplementary Figure S1: TIPF reporter validation in the wing disc. a,b, Test of put RNAi. a, In wildtype discs the Dpp target gene Sal (red) is expressed in a broad stripe in the centre of the ventral
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb3200 Supplementary Figure 1 Expression analysis of stomach markers in gutlike structure. (a) Differentiation scheme of gut-like structure formation from embryonic stem cells. (b) RT-PCR
More informationSupplementary material Legends to Supplementary Figures Figure S1. Figure S2. Figure S3.
Supplementary material Legends to Supplementary Figures. Figure S1. Expression of BICD-N-MTS fusion does not affect the distribution of the Golgi and endosomes. HeLa cells were transfected with GFP-BICD-N-MTS
More informationAuthors: K. L. Arendt, M. Royo, M. Fernández-Monreal, S. Knafo, C. N. Petrok, J.
SUPPLEMENTARY INFORMATION Title: PIP 3 controls synaptic function by maintaining AMPA receptor clustering at the postsynaptic membrane Authors: K. L. Arendt, M. Royo, M. Fernández-Monreal, S. Knafo, C.
More informationd e f Spatiotemporal quantification of subcellular ATP levels in a single HeLa cell during changes in morphology Supplementary Information
Ca 2+ level (a. u.) Area (a. u.) Normalized distance Normalized distance Center Edge Center Edge Relative ATP level Relative ATP level Supplementary Information Spatiotemporal quantification of subcellular
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2419 Figure S1 NiGFP localization in Dl mutant dividing SOPs. a-c) time-lapse analysis of NiGFP (green) in Dl mutant SOPs (H2B-RFP, red; clones were identified by the loss of nlsgfp) showing
More informationZhu et al, page 1. Supplementary Figures
Zhu et al, page 1 Supplementary Figures Supplementary Figure 1: Visual behavior and avoidance behavioral response in EPM trials. (a) Measures of visual behavior that performed the light avoidance behavior
More information04_polarity. The formation of synaptic vesicles
Brefeldin prevents assembly of the coats required for budding Nocodazole disrupts microtubules Constitutive: coatomer-coated Selected: clathrin-coated The formation of synaptic vesicles Nerve cells (and
More informationSupplementary Figure 1 Expression of Crb3 in mouse sciatic nerve: biochemical analysis (a) Schematic of Crb3 isoforms, ERLI and CLPI, indicating the
Supplementary Figure 1 Expression of Crb3 in mouse sciatic nerve: biochemical analysis (a) Schematic of Crb3 isoforms, ERLI and CLPI, indicating the location of the transmembrane (TM), FRM binding (FB)
More informationJCB. Supplemental material. Gu et al.,
Supplemental material Gu et al., http://www.jcb.org/cgi/content/full/jcb.201010075/dc1 T H E J O U R N A L O F C E L L B I O L O G Y Figure S1. S1P directly induces actin assembly. Actin assembly at the
More informationAhtiainen et al., http :// /cgi /content /full /jcb /DC1
Supplemental material JCB Ahtiainen et al., http ://www.jcb.org /cgi /content /full /jcb.201512074 /DC1 THE JOURNAL OF CELL BIOLOGY Figure S1. Distinct distribution of different cell cycle phases in the
More informationT H E J O U R N A L O F C E L L B I O L O G Y
Supplemental material Chen et al., http://www.jcb.org/cgi/content/full/jcb.201210119/dc1 T H E J O U R N A L O F C E L L B I O L O G Y Figure S1. Lack of fast reversibility of UVR8 dissociation. (A) HEK293T
More informationSupplementary Figures
Supplementary Figures Supplementary Figure 1 Characterization of stable expression of GlucB and sshbira in the CT26 cell line (a) Live cell imaging of stable CT26 cells expressing green fluorescent protein
More informationVesicular Trafficking of Semaphorin 3A is Activity- Dependent and Differs Between Axons and Dendrites
Traffic 6; 7: 6 77 Blackwell Munksgaard Copyright # Blackwell Munksgaard 6 doi:./j.6-854.6.44.x Vesicular Trafficking of Semaphorin A is Activity- Dependent and Differs Between Axons and Dendrites Joris
More informationA Tour of the Cell Chapter 4. Outline. Early contributors to Understanding Cells. Cell Theory. Cell Size s Matt Schleiden & Ted Schann
A Tour of the Cell Chapter 4 Outline History of the science behind cells Cell theory & its importance Why are cells small? Microscopes Cell structure and function Prokaryotic cells Eukaryotic cells Early
More informationNature Neuroscience: doi: /nn Supplementary Figure 1. MADM labeling of thalamic clones.
Supplementary Figure 1 MADM labeling of thalamic clones. (a) Confocal images of an E12 Nestin-CreERT2;Ai9-tdTomato brain treated with TM at E10 and stained for BLBP (green), a radial glial progenitor-specific
More informationSUPPLEMENTARY INFORMATION
Supplementary Figures Supplementary Figure S1. Binding of full-length OGT and deletion mutants to PIP strips (Echelon Biosciences). Supplementary Figure S2. Binding of the OGT (919-1036) fragments with
More informationSupplementary Figure S1. Venn diagram analysis of mrna microarray data and mirna target analysis. (a) Western blot analysis of T lymphoblasts (CLS)
Supplementary Figure S1. Venn diagram analysis of mrna microarray data and mirna target analysis. (a) Western blot analysis of T lymphoblasts (CLS) and their exosomes (EXO) in resting (REST) and activated
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2566 Figure S1 CDKL5 protein expression pattern and localization in mouse brain. (a) Multiple-tissue western blot from a postnatal day (P) 21 mouse probed with an antibody against CDKL5.
More informationSupplementary Information. Cofilin Regulates Nuclear Architecture through a Myosin-II Dependent Mechanotransduction Module
Supplementary Information Cofilin Regulates Nuclear Architecture through a Myosin-II Dependent Mechanotransduction Module O Neil Wiggan, Bryce Schroder, Diego Krapf, James R. Bamurg and Jennifer G. DeLuca
More informationSupplementary Information. Tissue-wide immunity against Leishmania. through collective production of nitric oxide
Supplementary Information Tissue-wide immunity against Leishmania through collective production of nitric oxide Romain Olekhnovitch, Bernhard Ryffel, Andreas J. Müller and Philippe Bousso Supplementary
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2480 a ~250 kda ~130 ~95 ~72 ~250 kda anti ypk1δ ypk2δ D239A S641A T659A tor2δ YPK2 ypk2δ CherryYPK1 unspecific crossreaction Cherry c b D239A S641A T659A YPK2 D239A S641A T659A tor2δ YPK2
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2638 Figure S1 Morphological characteristics of fetal testes and ovaries from 6.5-20 developmental weeks. Representative images of Hematoxylin and Eosin staining of testes and ovaries over
More informationMcWilliams et al., http :// /cgi /content /full /jcb /DC1
Supplemental material JCB McWilliams et al., http ://www.jcb.org /cgi /content /full /jcb.201603039 /DC1 THE JOURNAL OF CELL BIOLOGY Figure S1. In vitro characterization of mito-qc. (A and B) Analysis
More informationLentiviral Delivery of Combinatorial mirna Expression Constructs Provides Efficient Target Gene Repression.
Supplementary Figure 1 Lentiviral Delivery of Combinatorial mirna Expression Constructs Provides Efficient Target Gene Repression. a, Design for lentiviral combinatorial mirna expression and sensor constructs.
More informationSD-1 SD-1: Cathepsin B levels in TNF treated hch
SD-1 SD-1: Cathepsin B levels in TNF treated hch. A. RNA and B. protein extracts from TNF treated and untreated human chondrocytes (hch) were analyzed via qpcr (left) and immunoblot analyses (right) for
More informationSUPPLEMENTAL MATERIALS
Supplementary Methods SUPPLEMENTAL MATERIALS Supplementary References Supplementary Video Legends Supplementary Figures and Legends SUPPLEMENTARY METHODS Additional animals and cell lines used for the
More informationSupplemental Data. Hao et al. (2014). Plant Cell /tpc
Supplemental Figure 1. Confocal Images and VA-TIRFM Analysis of GFP-RbohD in Arabidopsis Seedlings. (A) RbohD expression in whole Arabidopsis seedlings. RbohD was expressed in the leaves, hypocotyl, and
More informationNature Methods: doi: /nmeth.4257
Supplementary Figure 1 Screen for polypeptides that affect cellular actin filaments. (a) Table summarizing results from all polypeptides tested. Source shows organism, gene, and amino acid numbers used.
More informationNature Immunology: doi: /ni.3631
Supplementary Figure 1 SPT analyses of Zap70 at the T cell plasma membrane. (a) Total internal reflection fluorescent (TIRF) excitation at 64-68 degrees limits single molecule detection to 100-150 nm above
More informationSupplementary Figure 1
Supplementary Figure 1 14 12 SEM4C PLXN2 8 SEM4C C 3 Cancer Cell Non Cancer Cell Expression 1 8 6 6 4 log2 ratio Expression 2 1 4 2 2 p value.1 D Supplementary Figure 1. Expression of Sema4C and Plexin2
More informationIn Vivo Imaging of Virological Synapses
In Vivo Imaging of Virological Synapses Xaver Sewald 1, David G. Gonzalez 2, Ann M. Haberman 2, and Walther Mothes 1 * 1 Department of Microbial Pathogenesis, Yale University School of Medicine, New Haven,
More informationSupplemental Information. Autophagy in Oncogenic K-Ras. Promotes Basal Extrusion. of Epithelial Cells by Degrading S1P. Current Biology, Volume 24
Current Biology, Volume 24 Supplemental Information Autophagy in Oncogenic K-Ras Promotes Basal Extrusion of Epithelial Cells by Degrading S1P Gloria Slattum, Yapeng Gu, Roger Sabbadini, and Jody Rosenblatt
More informationSupplementary information. The Light Intermediate Chain 2 Subpopulation of Dynein Regulates Mitotic. Spindle Orientation
Supplementary information The Light Intermediate Chain 2 Subpopulation of Dynein Regulates Mitotic Spindle Orientation Running title: Dynein LICs distribute mitotic functions. Sagar Mahale a, d, *, Megha
More informationROCK/Cdc42-mediated microglial motility and gliapse formation lead to phagocytosis of degenerating dopaminergic neurons in vivo
Supplementary Information ROCK/Cdc42-mediated microglial motility and gliapse formation lead to phagocytosis of degenerating dopaminergic neurons in vivo Carlos Barcia* 1,2, Carmen M Ros 1,2, Valentina
More informationgenome edited transient transfection, CMV promoter
Supplementary Figure 1. In the absence of new protein translation, overexpressed caveolin-1-gfp is degraded faster than caveolin-1-gfp expressed from the endogenous caveolin 1 locus % loss of total caveolin-1-gfp
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2607 Figure S1 Elf5 loss promotes EMT in mammary epithelium while Elf5 overexpression inhibits TGFβ induced EMT. (a, c) Different confocal slices through the Z stack image. (b, d) 3D rendering
More informationsupplementary information
DOI: 10.1038/ncb2133 Figure S1 Actomyosin organisation in human squamous cell carcinoma. (a) Three examples of actomyosin organisation around the edges of squamous cell carcinoma biopsies are shown. Myosin
More informationLongitudinal tracking of single live cancer cells to understand cell cycle effects of the
Longitudinal tracking of single live cancer cells to understand cell cycle effects of the nuclear export inhibitor, selinexor Joshua M. Marcus 1, Russell T. Burke 1, John A. DeSisto 1, Yosef Landesman
More informationSupplementary table and figures
3D single molecule tracking with multifocal plane microscopy reveals rapid intercellular transferrin transport at epithelial cell barriers Sripad Ram, Dongyoung Kim, Raimund J. Ober and E. Sally Ward Supplementary
More informationSupplementary Figure 1
Supplementary Figure 1 Supplementary Fig. 1: Quality assessment of formalin-fixed paraffin-embedded (FFPE)-derived DNA and nuclei. (a) Multiplex PCR analysis of unrepaired and repaired bulk FFPE gdna from
More informationSupplementary Figure 1. SC35M polymerase activity in the presence of Bat or SC35M NP encoded from the phw2000 rescue plasmid.
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 Supplementary Figure 1. SC35M polymerase activity in the presence of Bat or SC35M NP encoded from the phw2000 rescue plasmid. HEK293T
More informationSupplementary Figure 1. The CagA-dependent wound healing or transwell migration of gastric cancer cell. AGS cells transfected with vector control or
Supplementary Figure 1. The CagA-dependent wound healing or transwell migration of gastric cancer cell. AGS cells transfected with vector control or 3xflag-CagA expression vector were wounded using a pipette
More informationSUPPLEMENTARY INFORMATION
In the format provided by the authors and unedited. 2 3 4 DOI: 10.1038/NMAT4893 EGFR and HER2 activate rigidity sensing only on rigid matrices Mayur Saxena 1,*, Shuaimin Liu 2,*, Bo Yang 3, Cynthia Hajal
More informationSupplemental Materials Molecular Biology of the Cell
Supplemental Materials Molecular Biology of the Cell Garcia-Alvarez et al. Supplementary Figure Legends Figure S1.Expression and RNAi-mediated silencing of STIM1 in hippocampal neurons (DIV, days in vitro).
More informationsfigure 1: Detection of L-fucose in normal mouse renal cortex using the plant lectin LTL
sfigure 1: Detection of L-fucose in normal mouse renal cortex using the plant lectin LTL LTL staining Negative control Fluorescence microscopy of normal (CL-11 +/+ ) mouse renal tissue after staining with
More informationPlant Cell, Development & Ultrastructure
PCDU Lecture Plant Cell, Development & Ultrastructure Plant Cell Biology Labs Download at: http://goo.gl/111tha Microtubules 13 Protofilamente 25nm Plant MT Cytoskeleton Animal MT cytoskeleton Preprophase
More informationSupplementary Figure 1. Rab27a-KD inhibits speed and persistence of HEp3 cells migrating in the chick CAM. (a) Western blot analysis of Rab27a
Supplementary Figure 1. Rab27a-KD inhibits speed and persistence of HEp3 cells migrating in the chick CAM. (a) Western blot analysis of Rab27a expression in GFP-expressing HEp3 cells. (b) Representative
More informationSupplementary Figure 1
Supplementary Figure 1 Global TeNT expression effectively impairs synaptic transmission. Injection of 100 pg tent mrna leads to a reduction of vesicle mediated synaptic transmission in the spinal cord
More informationSUPPLEMENTARY INFORMATION
SUPPLEENTRY INFORTION DOI: 1.138/ncb2577 Early Telophase Late Telophase B icrotubules within the ICB (percent of total cells in telophase) D G ultinucleate cells (% total) 8 6 4 2 2 15 1 5 T without gaps
More informationSUPPLEMENTARY INFORMATION
Supplementary Figure 1. Formation of the AA5x. a, Camera lucida drawing of embryo at 48 hours post fertilization (hpf, modified from Kimmel et al. Dev Dyn. 1995 203:253-310). b, Confocal microangiogram
More informationHigh resolution structural evidence suggests the Sarcoplasmic Reticulum forms microdomains with Acidic Stores (lyososomes) in the heart.
High resolution structural evidence suggests the Sarcoplasmic Reticulum forms microdomains with Acidic Stores (lyososomes) in the heart. Daniel Aston, Rebecca A. Capel, Kerrie L. Ford, Helen C. Christian,
More informationklp-18 (RNAi) Control. supplementary information. starting strain: AV335 [emb-27(g48); GFP::histone; GFP::tubulin] bleach
DOI: 10.1038/ncb1891 A. starting strain: AV335 [emb-27(g48); GFP::histone; GFP::tubulin] bleach embryos let hatch overnight transfer to RNAi plates; incubate 5 days at 15 C RNAi food L1 worms adult worms
More informationSupplementary Figure 1. Electroporation of a stable form of β-catenin causes masses protruding into the IV ventricle. HH12 chicken embryos were
Supplementary Figure 1. Electroporation of a stable form of β-catenin causes masses protruding into the IV ventricle. HH12 chicken embryos were electroporated with β- Catenin S33Y in PiggyBac expression
More informationSupplementary Figure 1. Genotyping strategies for Mcm3 +/+, Mcm3 +/Lox and Mcm3 +/- mice and luciferase activity in Mcm3 +/Lox mice. A.
Supplementary Figure 1. Genotyping strategies for Mcm3 +/+, Mcm3 +/Lox and Mcm3 +/- mice and luciferase activity in Mcm3 +/Lox mice. A. Upper part, three-primer PCR strategy at the Mcm3 locus yielding
More informationType of file: PDF Title of file for HTML: Supplementary Information Description: Supplementary Figures
Type of file: PDF Title of file for HTML: Supplementary Information Description: Supplementary Figures Type of file: MOV Title of file for HTML: Supplementary Movie 1 Description: NLRP3 is moving along
More informationPHENOTYPIC DYNAMICS OF MICROGLIAL AND MONOCYTE-DERIVED CELLS IN GLIOBLASTOMA-BEARING MICE.
SUPPLEMENTARY FIGURES, TABLES AND VIDEOS PHENOTYPIC DYNAMICS OF MICROGLIAL AND MONOCYTE-DERIVED CELLS IN GLIOBLASTOMA-BEARING MICE. Clément Ricard 1,2,3,4, Aurélie Tchoghandjian 2,4, Hervé Luche 5, Pierre
More informationTRAF6 ubiquitinates TGFβ type I receptor to promote its cleavage and nuclear translocation in cancer
Supplementary Information TRAF6 ubiquitinates TGFβ type I receptor to promote its cleavage and nuclear translocation in cancer Yabing Mu, Reshma Sundar, Noopur Thakur, Maria Ekman, Shyam Kumar Gudey, Mariya
More informationSUPPLEMENTARY INFORMATION
Figure S1. Loss of Ena/VASP proteins inhibits filopodia and neuritogenesis. (a) Bar graph of filopodia number per stage 1 control and mmvvee (Mena/ VASP/EVL-null) neurons at 40hrs in culture. Loss of all
More informationNature Neuroscience: doi: /nn Supplementary Figure 1
Supplementary Figure 1 Subcellular segregation of VGluT2-IR and TH-IR within the same VGluT2-TH axon (wild type rats). (a-e) Serial sections of a dual VGluT2-TH labeled axon. This axon (blue outline) has
More informationSupplemental Data. Candat et al. Plant Cell (2014) /tpc Cytosol. Nucleus. Mitochondria. Plastid. Peroxisome. Endomembrane system
Cytosol Nucleus 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 PSORT MultiLoc YLoc SubLoc BaCelLo WoLF PSORT
More informationInfluenza virus exploits tunneling nanotubes for cell-to-cell spread
Supplementary Information Influenza virus exploits tunneling nanotubes for cell-to-cell spread Amrita Kumar 1, Jin Hyang Kim 1, Priya Ranjan 1, Maureen G. Metcalfe 2, Weiping Cao 1, Margarita Mishina 1,
More informationSupplementary Materials for
www.sciencetranslationalmedicine.org/cgi/content/full/4/117/117ra8/dc1 Supplementary Materials for Notch4 Normalization Reduces Blood Vessel Size in Arteriovenous Malformations Patrick A. Murphy, Tyson
More informationAfferent lymph-derived T cells and dendritic cells use different CCR7-dependent routes for lymph node entry and intranodal migration
Braun et al. Supplementary Information 1 Supplementary Information Afferent lymph-derived T cells and dendritic cells use different CCR7-dependent routes for lymph node entry and intranodal migration Asolina
More informationSupplementary Figure 1 The ability to regenerate an ear hole is discontinuous with wound healing. Ear-hole closure at D85 for each sex within each
Supplementary Figure 1 The ability to regenerate an ear hole is discontinuous with wound healing. Ear-hole closure at D85 for each sex within each species observed. Data show a binary response to a 4 mm
More information