Nature Neuroscience: doi: /nn Supplementary Figure 1
|
|
- Isaac Turner
- 5 years ago
- Views:
Transcription
1 Supplementary Figure 1 Subcellular segregation of VGluT2-IR and TH-IR within the same VGluT2-TH axon (wild type rats). (a-e) Serial sections of a dual VGluT2-TH labeled axon. This axon (blue outline) has two distinguishable microdomains: an axon terminal (AT) with VGluT2 signal (scattered dark material) and an adjacent area containing TH signal (gold particles, arrowheads). Both compartments establish synapses with postsynaptic structures (orange outlines). The VGluT2 AT establishes an asymmetric synapse (green arrows) with the head of a dendritic spine (sp1), which contains a spine apparatus (sa). The segment of the axon containing TH establishes a symmetric synapse (blue arrows) with a dendritic spine (sp2). Scale bars represent 200 nm.
2 Supplementary Figure 2 Specificity evaluation of anti-vmat2 antibodies by western blot analysis. (a) Graphic map of paav-ef1a-dio-vmat2(myc)-wpre-pa. A Myc epitope was inserted in-frame with VMAT2 at the N-terminus for immunodetection of transgenic VMAT2. (b) VMAT2 immunodetection by different anti-vmat2 antibodies. Western blots in lanes 1-8 from a gel loaded with the same amount of total protein from rat nacc homogenate, and tested with eight different anti-vmat2 antibodies as follows: (1) ab from Abcam; (2) H-V008 from Phoenix Pharmaceuticals, Inc; (3) ab81855 from Abcam; (4) VMAT2- Rb-Af720 from Frontier Institute Co. ltd; (5) from Synaptic Systems; (6) AB1598P from EMD Millipore; (7) SAB from Sigma-Aldrich; (8) EB06558 from Everest Biotech. Seven out of the 8 tested anti-vmat2 antibodies recognize multiple bands with exception of the EB06558 that recognizes two bands with a molecular weight 55 kda (arrow), expected for VMAT2. Lanes 9 and 10 correspond to western blot prepared from total protein from transfected cell homogenates expressing VMAT2 with Myc tag, and probed with anti-vmat2 antibody (EB06558) or anti-myc antibody from EMD Millipore (05-724). Each anti-vmat2 and anti-myc antibodies recognize a single band with similar molecular weight ( 55 kda), as detected in the nacc homogenate.
3 Supplementary Figure 3 VGluT2 and VMAT2 localize to distinct subpopulations of synaptic vesicles (wild type rats). (a) Full length western blots of proteins from isolated vesicles prior to immunoprecipitation, IP (T), and after IP with antibodies against VGluT2 (IP:VGluT2; B1) or VMAT2 (IP:VMAT2; B2). Western blots were immunolabeled (IB) with antibodies against VGluT2, VMAT2 or the vesicular marker synaptophysin. The vesicular nature of each fraction was confirmed by the detection of synaptophysin. VGluT2 and VMAT2 are present in the total pool of vesicles (T). In contrast, VGluT2 is detected only in the sample IP with anti-vglut2 antibody (IP:VGluT2), and VMAT2 is detected only in the sample IP with anti-vmat2 antibody (IP:VMAT2). (b) A model showing accumulation of dopamine by VMAT2 in a vesicle different from the one that accumulates glutamate by VGluT2.
4 Supplementary Figure 4 TH neurons expressing mcherry under the regulation of the TH promoter (TH::Cre mice). (a) Schematic representation of AAV5-DIO-ChR2-mCherry injection into the VTA of TH::Cre mice. (b) Low magnification of a coronal section, which was incubated with an anti-mcherry antibody and hybridized with a TH antisense radioactive riboprobe. Section is seen under bright field (for visualization of mcherry-ir), and under epiluminescence microscope (for visualization of silver grains indicating expression of TH mrna). Bregma mm. Rectangular area in b is shown at higher magnification in (c-e) to display two neurons coexpressing TH-mRNA and mcherry-ir. (f) The bars indicate the frequency (mean + s.e.m.) of neurons containing mcherry-ir or TH mrna from a total of 576 mcherry-ir neurons. Out of these neurons, ± 0.83% have mcherry-ir and TH mrna (t(2) = 17.07, P = , n = 3). Scale bars represent 100 µm (b) and 10 µm (e).
5 Supplementary Figure 5 Mesoaccumbens axons from VGluT2 neurons expressing mcherry under the regulation of the VGluT2 promoter (VGluT2::Cre mice). (a) Schematic representation of AAV5-DIO-ChR2-mCherry injection into the VTA of VGluT2::Cre mice. (b) Double labeled VTA cryosections for the detection of mcherry- IR or TH-IR. From this preparation, three different classes of neurons were laser microdissected: cells expressing only mcherry-ir (mcherry-ir + /TH-IR (arrows)), cells co-expressing mcherry-ir and TH-IR (mcherry-ir + /TH-IR + (arrowheads)) and cells expressing only TH-IR (mcherry-ir /TH-IR + (stars)). (c) Percentage of neurons containing detectable levels of VGluT2 mrna or TH mrna in each of the three classes of laser micro-dissected neurons: mcherry-ir + /TH-IR (n = 30 neurons), mcherry-ir + /TH-IR + (n = 35 neurons), and mcherry-ir /TH-IR + (n = 40 neurons). Each mcherry-ir + /TH-IR neuron was confirmed to have VGluT2 mrna and lack TH mrna. Each mcherry-ir /TH-IR + neuron was confirmed to have TH mrna and lack VGluT2 mrna. The majority of dissected dual mcherry-ir + /TH-IR + neurons found in the medial VTA have both VGluT2 mrna and TH mrna (97%, 34 out of 35 neurons). (d-g) Subcellular Segregation of TH and VGluT2 in the nacc of VGluT2-ChR2-mCherry mice. Detection of mcherry (red) under the VGluT2 promoter, VGluT2-IR (green), and TH-IR (blue) in the VTA and nacc. (d) Low magnification of the VTA showing cells with mcherry within the midline aspects of this structure. (e) High magnification of the area delimited with white box in (d) showing a dual labeled mcherry/th neuron (1), and single labeled mcherry (2) and single labeled TH (3) neurons. (f) Within the nacc, mcherry-ir under the VGluT2 promoter is observed along an axon (arrows) and within terminal-like structures (arrowheads), which contain VGluT2-IR. TH-IR is adjacent to the VGluT2-IR axon terminal. (g) Segregation among the VGluT2 terminal-like structures and the TH-axon segment within the same nacc axon from a VGluT2-TH neuron is better seen in this 3- D reconstruction from Z-stack confocal microscopy images of triple labeled nacc. Scale bars represent 10 µm (b), 100 µm (d), 5 µm (e) and 2 µm (f).
6 Supplementary Figure 6 Mouse mesoaccumbens neurons establish VGluT2-asymmetric synapses or TH-symmetric synapses (TH::Cre mice). (a) Schematic representation of AAV5-DIO-ChR2-mCherry injection into the VTA of TH::Cre mice. (b) Electron micrograph of a nacc AT from a VTA neuron co-expressing mcherry-ir (scattered dark material) and VGluT2-IR (gold particles, green arrowheads) making an asymmetric synapse (green arrow) with a dendrite (De). (c) Electron micrograph of an AT from a VTA neuron co-expressing mcherry-ir (scattered dark material) and TH-IR (gold particles, blue arrowhead) making a symmetric synapse (blue arrow) on a dendrite (De). (d) Schematic representation of nacc inputs from VTA neurons expressing mcherry-ir under the regulation of TH promoter (TH-ChR2-mCherry mice). (e-g) A single AT from a VTA-VGluT2 neuron synapses on several postsynaptic structures. Serial sections of a single AT derived from a VTA neuron expressing mcherry-ir (scattered dark material) and containing VGluT2-IR (gold particles, green arrowheads) establishes asymmetric synapses (green arrows) with several postsynaptic structures, two dendritic spines (sp1 and sp2) and one dendrite (De). Scale bars represent 200 nm (b,c,e,f,g).
7 Supplementary Figure 7 TH immunoreactivity (TH-IR) is distributed in the entire axon and axon terminal lacking VGluT2 (TH::Cre mice). (a) Schematic representation of nacc inputs from VTA neurons expressing mcherry immunoreactivity (mcherry-ir) under the regulation of the TH promoter (TH-ChR2-mCherry mice). (b-c) Immunofluorescence detection of mcherry (red), TH (blue), and VGluT2 (green) in the nacc. Note mcherry detection throughout the axon (red in b), and VGluT2-IR restricted to a neighboring terminal-like structure lacking mcherry-ir (arrowheads in b). Under 2-D view, TH-IR appears to be present in segments within the mcherry-ir axon and terminal (arrow in b). However, the TH distribution throughout the axon and axon terminal is better seen after 3-D reconstruction from Z-stack of confocal microscopy images of triple labeled nacc (c). (d,e) Electron micrographs of serial sections of a TH-only axon containing mcherry-ir (scattered dark material) and TH-IR (gold particles, arrowheads). One axon terminal (AT) from this axon made a symmetric synapse (arrow) on a dendrite (De, orange outline). Scale bars represent 2 µm (b) and 200 nm (d,e).
8 Supplementary Figure 8 Compartmentalization of the storage and release of glutamate to axon terminals and the storage and release of dopamine to the adjacent axonal segment. Mesoaccumbens synapses established by 3 different classes of mesocorticolimbic neurons (TH-only, VGluT2-only and VGluT2-TH neurons), and subcellular segregation for dopaminergic and glutamatergic signaling. Axon terminals containing dopamine vesicles (blue circles) and establishing symmetric synapses on the side of dendritic spines (sp1) are originated from either TH-only or VGluT2-TH neurons. In contrast, axon terminals containing glutamate vesicles (green circles) derived from VGluT2-only or VGluT2-TH neurons make asymmetric synapses on the head of dendritic spines (or dendrites, no representation in this diagram). A single axon terminal from these glutamatergic terminals can establish asymmetric synapses with several postsynaptic targets (sp2 and sp3). A dual glutamatergic-dopaminergic axon from a VGluT2-TH neuron illustrates the compartmentalization of the storage and release of glutamate to axon terminals and the storage and release of dopamine to the adjacent axonal segment.
Supplemental Information. Dorsal Raphe Dual Serotonin-Glutamate Neurons. Drive Reward by Establishing Excitatory Synapses
Cell Reports, Volume 26 Supplemental Information Dorsal Raphe Dual Serotonin-Glutamate Neurons Drive Reward by Establishing Excitatory Synapses on VTA Mesoaccumbens Dopamine Neurons Hui-Ling Wang, Shiliang
More informationNature Neuroscience: doi: /nn.4335
Supplementary Figure 1 Cholinergic neurons projecting to the VTA are concentrated in the caudal mesopontine region. (a) Schematic showing the sites of retrograde tracer injections in the VTA: cholera toxin
More informationNature Neuroscience: doi: /nn Supplementary Figure 1. Distribution of starter cells for RV-mediated retrograde tracing.
Supplementary Figure 1 Distribution of starter cells for RV-mediated retrograde tracing. Parcellation of cortical areas is based on Allen Mouse Brain Atlas and drawn to scale. Thick white curves, outlines
More informationNature Neuroscience: doi: /nn Supplementary Figure 1. ACx plasticity is required for fear conditioning.
Supplementary Figure 1 ACx plasticity is required for fear conditioning. (a) Freezing time of conditioned and control mice before CS presentation and during CS presentation in a new context. Student s
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nature11306 Supplementary Figures Supplementary Figure 1. Basic characterization of GFP+ RGLs in the dentate gyrus of adult nestin-gfp mice. a, Sample confocal images
More informationSupplementary Figure 1
Supplementary Figure 1 Localization of virus injections. (a) Schematic showing the approximate center of AAV-DIO-ChR2-YFP injection sites in the NAc of Dyn-cre mice (n=8 mice, 16 injections; caudate/putamen,
More information(a) Significant biological processes (upper panel) and disease biomarkers (lower panel)
Supplementary Figure 1. Functional enrichment analyses of secretomic proteins. (a) Significant biological processes (upper panel) and disease biomarkers (lower panel) 2 involved by hrab37-mediated secretory
More informationSupplementary information. The Light Intermediate Chain 2 Subpopulation of Dynein Regulates Mitotic. Spindle Orientation
Supplementary information The Light Intermediate Chain 2 Subpopulation of Dynein Regulates Mitotic Spindle Orientation Running title: Dynein LICs distribute mitotic functions. Sagar Mahale a, d, *, Megha
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2566 Figure S1 CDKL5 protein expression pattern and localization in mouse brain. (a) Multiple-tissue western blot from a postnatal day (P) 21 mouse probed with an antibody against CDKL5.
More information293T cells were transfected with indicated expression vectors and the whole-cell extracts were subjected
SUPPLEMENTARY INFORMATION Supplementary Figure 1. Formation of a complex between Slo1 and CRL4A CRBN E3 ligase. (a) HEK 293T cells were transfected with indicated expression vectors and the whole-cell
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/6/283/ra57/dc1 Supplementary Materials for JNK3 Couples the Neuronal Stress Response to Inhibition of Secretory Trafficking Guang Yang,* Xun Zhou, Jingyan Zhu,
More informationSUPPLEMENTARY INFORMATION. Otx2 controls neuron subtype identity in ventral tegmental area and antagonizes
Di Salvio et al. 1 SUPPLEMENTARY INFORMATION Otx2 controls neuron subtype identity in ventral tegmental area and antagonizes vulnerability to MPTP Michela Di Salvio, Luca Giovanni Di Giovannantonio, Dario
More informationSupplementary figure 1: LII/III GIN-cells show morphological characteristics of MC
1 2 1 3 Supplementary figure 1: LII/III GIN-cells show morphological characteristics of MC 4 5 6 7 (a) Reconstructions of LII/III GIN-cells with somato-dendritic compartments in orange and axonal arborizations
More informationStructural basis for the role of inhibition in facilitating adult brain plasticity
Structural basis for the role of inhibition in facilitating adult brain plasticity Jerry L. Chen, Walter C. Lin, Jae Won Cha, Peter T. So, Yoshiyuki Kubota & Elly Nedivi SUPPLEMENTARY FIGURES 1-6 a b M
More informationSupplementary Figure 1. Identification of the type II spiral ganglion neurons (SGN) via immunofluorescence of peripherin protein (PRPH).
Supplementary Figure 1. Identification of the type II spiral ganglion neurons (SGN) via immunofluorescence of peripherin protein (PRPH). (a), (b), PRPH immunolabelling of cryosections from post-natal day
More informationFigure S1. (A) SDS-PAGE separation of GST-fusion proteins purified from E.coli BL21 strain is shown. An equal amount of GST-tag control, LRRK2 LRR
Figure S1. (A) SDS-PAGE separation of GST-fusion proteins purified from E.coli BL21 strain is shown. An equal amount of GST-tag control, LRRK2 LRR and LRRK2 WD40 GST fusion proteins (5 µg) were loaded
More informationSUPPLEMENTARY INFORMATION
Supplementary Figure 1. Normal AMPAR-mediated fepsp input-output curve in CA3-Psen cdko mice. Input-output curves, which are plotted initial slopes of the evoked fepsp as function of the amplitude of the
More informationZhu et al, page 1. Supplementary Figures
Zhu et al, page 1 Supplementary Figures Supplementary Figure 1: Visual behavior and avoidance behavioral response in EPM trials. (a) Measures of visual behavior that performed the light avoidance behavior
More informationMcWilliams et al., http :// /cgi /content /full /jcb /DC1
Supplemental material JCB McWilliams et al., http ://www.jcb.org /cgi /content /full /jcb.201603039 /DC1 THE JOURNAL OF CELL BIOLOGY Figure S1. In vitro characterization of mito-qc. (A and B) Analysis
More informationSupplementary Figure 1. SDS-FRL localization of CB 1 in the distal CA3 area of the rat hippocampus. (a-d) Axon terminals (t) in stratum pyramidale
Supplementary Figure 1. SDS-FRL localization of CB 1 in the distal CA3 area of the rat hippocampus. (a-d) Axon terminals (t) in stratum pyramidale (b) show stronger immunolabeling for CB 1 than those in
More informationNature Biotechnology: doi: /nbt Supplementary Figure 1
Supplementary Figure 1 Representative images of an in vitro comparison of several AAV serotypes regarding egfp expression in cochlear explants of CBA/CaJ mice. (A-F): Results after incubation at equal
More informationSupplementary Table 1. List of primers used in this study
Supplementary Table 1. List of primers used in this study Gene Forward primer Reverse primer Rat Met 5 -aggtcgcttcatgcaggt-3 5 -tccggagacacaggatgg-3 Rat Runx1 5 -cctccttgaaccactccact-3 5 -ctggatctgcctggcatc-3
More informationSupplementary Figure 1
Supplementary Figure 1 Arcuate ChIEF-tdTomato neurons expressed TH These micrographs show that TH-Cre-ChIEF-tdTomato (magenta), expressed by AAV in a TH-Cre mouse, were immunostained with TH (green) in
More informationSupplementary Figures
Supplementary Figures Supplementary Figure 1 Characterization of stable expression of GlucB and sshbira in the CT26 cell line (a) Live cell imaging of stable CT26 cells expressing green fluorescent protein
More informationDisrupting GluA2-GAPDH Interaction Affects Axon and Dendrite Development
Disrupting GluA2-GAPDH Interaction Affects Axon and Dendrite Development 1 Frankie Hang Fung Lee, 1 Ping Su, 1 Yu Feng Xie, 1 Kyle Ethan Wang, 2 Qi Wan and 1,3 Fang Liu 1 Campbell Research Institute, Centre
More informationNature Neuroscience: doi: /nn Supplementary Figure 1. Confirmation that optogenetic inhibition of dopaminergic neurons affects choice
Supplementary Figure 1 Confirmation that optogenetic inhibition of dopaminergic neurons affects choice (a) Sample behavioral trace as in Figure 1d, but with NpHR stimulation trials depicted as green blocks
More informationSupplementary Figure 1. SybII and Ceb are sorted to distinct vesicle populations in astrocytes. Nature Neuroscience: doi: /nn.
Supplementary Figure 1 SybII and Ceb are sorted to distinct vesicle populations in astrocytes. (a) Exemplary images for cultured astrocytes co-immunolabeled with SybII and Ceb antibodies. SybII accumulates
More informationSchwarz et al. Activity-Dependent Ubiquitination of GluA1 Mediates a Distinct AMPAR Endocytosis
Schwarz et al Activity-Dependent Ubiquitination of GluA1 Mediates a Distinct AMPAR Endocytosis and Sorting Pathway Supplemental Data Supplemental Fie 1: AMPARs undergo activity-mediated ubiquitination
More informationNature Neuroscience: doi: /nn Supplementary Figure 1. Iliopsoas and quadratus lumborum motor neurons in the L2 spinal segment.
Supplementary Figure 1 Iliopsoas and quadratus lumborum motor neurons in the L2 spinal segment. (A) IL and QL motor neurons were labeled after CTb-488 (green) muscle injections at birth. At P4, the L2
More informationSupplemental Materials Molecular Biology of the Cell
Supplemental Materials Molecular Biology of the Cell Garcia-Alvarez et al. Supplementary Figure Legends Figure S1.Expression and RNAi-mediated silencing of STIM1 in hippocampal neurons (DIV, days in vitro).
More informationSUPPLEMENTARY INFORMATION
DOI:.38/ncb3399 a b c d FSP DAPI 5mm mm 5mm 5mm e Correspond to melanoma in-situ Figure a DCT FSP- f MITF mm mm MlanaA melanoma in-situ DCT 5mm FSP- mm mm mm mm mm g melanoma in-situ MITF MlanaA mm mm
More informationNature Neuroscience: doi: /nn Supplementary Figure 1. Splenic atrophy and leucopenia caused by T3 SCI.
Supplementary Figure 1 Splenic atrophy and leucopenia caused by T3 SCI. (a) Gross anatomy of representative spleens from control and T3 SCI mice at 28 days post-injury. (b and c) Hematoxylin and eosin
More informationF-actin VWF Vinculin. F-actin. Vinculin VWF
a F-actin VWF Vinculin b F-actin VWF Vinculin Supplementary Fig. 1. WPBs in HUVECs are located along stress fibers and at focal adhesions. (a) Immunofluorescence images of f-actin (cyan), VWF (yellow),
More informationSERT. Synphys. VAMP2/Synbrev. Syngyr VMAT2 SCAMP1. SNAP25 NMDA Glt. M6a
Supplementary Figure S1 kda H P1 P2 LP1 LP2 70 35 15 25 70 35 25 100 70 25 SERT Synphys VAMP2/Synbrev Syngyr VMAT2 SCAMP1 SNAP25 NMDA Glt M6a Figure S1: Subcellular fractionation of mouse brain tissue
More informationSupplementary Figure 1) GABAergic enhancement by leptin hyperpolarizes POMC neurons A) Representative recording samples showing the membrane
Supplementary Figure 1) GABAergic enhancement by leptin hyperpolarizes POMC neurons A) Representative recording samples showing the membrane potential recorded from POMC neurons following treatment with
More informationJ. Cell Sci. 129: doi: /jcs : Supplementary information
Movie 1. AgLDL is contained in small sub-regions of the lysosomal synapse that are acidic. J774 cells were incubated with agldl dual labeled with a ph sensitive and a ph insensitive fluorophore for 1 hr.
More informationSupplementary Materials for VAMP4 directs synaptic vesicles to a pool that selectively maintains asynchronous neurotransmission
Supplementary Materials for VAMP4 directs synaptic vesicles to a pool that selectively maintains asynchronous neurotransmission Jesica Raingo, Mikhail Khvotchev, Pei Liu, Frederic Darios, Ying C. Li, Denise
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION Human cerebral cortex development from pluripotent stem cells to functional excitatory synapses Yichen Shi 1,2, Peter Kirwan 1,2, James Smith 1,2, Hugh P.C. Robinson 3 and Frederick
More informationSupplemental Information. Otic Mesenchyme Cells Regulate. Spiral Ganglion Axon Fasciculation. through a Pou3f4/EphA4 Signaling Pathway
Neuron, Volume 73 Supplemental Information Otic Mesenchyme Cells Regulate Spiral Ganglion Axon Fasciculation through a Pou3f4/EphA4 Signaling Pathway Thomas M. Coate, Steven Raft, Xiumei Zhao, Aimee K.
More informationAnatomy of a Neuron. Copyright 2000 by BSCS and Videodiscovery, Inc. Permission granted for classroom use. Master 2.1
Anatomy of a Neuron Master 2.1 Neurons Interact With Other Neurons Through Synapses Master 2.2 How Do Neurons Communicate? 1 2 3 4 5 6 Master 2.3 Neurons Communicate by Neurotransmission Neurons communicate
More informationSupplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 )
770 771 Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 ) Human CXCL1 GCGCCCAAACCGAAGTCATA ATGGGGGATGCAGGATTGAG PF4 CCCCACTGCCCAACTGATAG TTCTTGTACAGCGGGGCTTG
More informationT H E J O U R N A L O F C E L L B I O L O G Y
Supplemental material Chen et al., http://www.jcb.org/cgi/content/full/jcb.201210119/dc1 T H E J O U R N A L O F C E L L B I O L O G Y Figure S1. Lack of fast reversibility of UVR8 dissociation. (A) HEK293T
More informationSupporting Online Material for
www.sciencemag.org/cgi/content/full/1171320/dc1 Supporting Online Material for A Frazzled/DCC-Dependent Transcriptional Switch Regulates Midline Axon Guidance Long Yang, David S. Garbe, Greg J. Bashaw*
More informationNature Neuroscience: doi: /nn Supplementary Figure 1. Diverse anorexigenic signals induce c-fos expression in CEl PKC-δ + neurons
Supplementary Figure 1 Diverse anorexigenic signals induce c-fos expression in CEl PKC-δ + neurons a-c. Quantification of CEl c-fos expression in mice intraperitoneal injected with anorexigenic drugs (a),
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/7/308/ra4/dc1 Supplementary Materials for Antipsychotics Activate mtorc1-dependent Translation to Enhance Neuronal Morphological Complexity Heather Bowling, Guoan
More informationSUPPLEMENTARY FIGURES
SUPPLEMENTARY FIGURES 1 Supplementary Figure 1, Adult hippocampal QNPs and TAPs uniformly express REST a-b) Confocal images of adult hippocampal mouse sections showing GFAP (green), Sox2 (red), and REST
More informationSupplementary Figure 1 Expression of Crb3 in mouse sciatic nerve: biochemical analysis (a) Schematic of Crb3 isoforms, ERLI and CLPI, indicating the
Supplementary Figure 1 Expression of Crb3 in mouse sciatic nerve: biochemical analysis (a) Schematic of Crb3 isoforms, ERLI and CLPI, indicating the location of the transmembrane (TM), FRM binding (FB)
More informationT H E J O U R N A L O F C E L L B I O L O G Y
T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Krenn et al., http://www.jcb.org/cgi/content/full/jcb.201110013/dc1 Figure S1. Levels of expressed proteins and demonstration that C-terminal
More informationT H E J O U R N A L O F C E L L B I O L O G Y
Supplemental material Brooks and Wallingford, http://www.jcb.org/cgi/content/full/jcb.201204072/dc1 T H E J O U R N A L O F C E L L B I O L O G Y Figure S1. Quantification of ciliary compartments in control
More informationAuthors: K. L. Arendt, M. Royo, M. Fernández-Monreal, S. Knafo, C. N. Petrok, J.
SUPPLEMENTARY INFORMATION Title: PIP 3 controls synaptic function by maintaining AMPA receptor clustering at the postsynaptic membrane Authors: K. L. Arendt, M. Royo, M. Fernández-Monreal, S. Knafo, C.
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2988 Supplementary Figure 1 Kif7 L130P encodes a stable protein that does not localize to cilia tips. (a) Immunoblot with KIF7 antibody in cell lysates of wild-type, Kif7 L130P and Kif7
More informationDifferential neuronal vulnerability identifies IGF-2 as a protective factor in
Supplementary Information Differential neuronal vulnerability identifies IGF-2 as a protective factor in ALS Ilary Allodi 1,3, Laura Comley 1,3, Susanne Nichterwitz 1,3, Monica Nizzardo 2, Chiara Simone
More informationSUPPLEMENTARY FIGURE LEGENDS
SUPPLEMENTARY FIGURE LEGENDS Supplemental FIG. 1. Localization of myosin Vb in cultured neurons varies with maturation stage. A and B, localization of myosin Vb in cultured hippocampal neurons. A, in DIV
More informationCHAPTER 5 RESULTS Previous study: cell culture and organotypical slices
45 CHAPTER 5 RESULTS 5.1. Previous study: cell culture and organotypical slices Initial experiments have been conducted to ensure that the tet-on system works. A neuronal cell culture from mice expressing
More informationThe subcortical maternal complex controls symmetric division of mouse zygotes by
The subcortical maternal complex controls symmetric division of mouse zygotes by regulating F-actin dynamics Xing-Jiang Yu 1,2, Zhaohong Yi 1, Zheng Gao 1,2, Dan-dan Qin 1,2, Yanhua Zhai 1, Xue Chen 1,
More informationSupplementary Figure 1. Nature Neuroscience: doi: /nn.4547
Supplementary Figure 1 Characterization of the Microfetti mouse model. (a) Gating strategy for 8-color flow analysis of peripheral Ly-6C + monocytes from Microfetti mice 5-7 days after TAM treatment. Living
More informationUltrastructural Contributions to Desensitization at the Cerebellar Mossy Fiber to Granule Cell Synapse
Ultrastructural Contributions to Desensitization at the Cerebellar Mossy Fiber to Granule Cell Synapse Matthew A.Xu-Friedman and Wade G. Regehr Department of Neurobiology, Harvard Medical School, Boston,
More informationNature Neuroscience: doi: /nn Supplementary Figure 1
Supplementary Figure 1 Bidirectional optogenetic modulation of the tonic activity of CEA PKCδ + neurons in vitro. a, Top, Cell-attached voltage recording illustrating the blue light-induced increase in
More informationNature Neuroscience: doi: /nn Supplementary Figure 1
Supplementary Figure 1 Quantification of myelin fragments in the aging brain (a) Electron microscopy on corpus callosum is shown for a 18-month-old wild type mice. Myelin fragments (arrows) were detected
More informationSupplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells
Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells (b). TRIM33 was immunoprecipitated, and the amount of
More informationSupplementary Figure 1
Supplementary Figure 1 AAV-GFP injection in the MEC of the mouse brain C57Bl/6 mice at 4 months of age were injected with AAV-GFP into the MEC and sacrificed at 7 days post injection (dpi). (a) Brains
More informationType of file: PDF Title of file for HTML: Supplementary Information Description: Supplementary Figures
Type of file: PDF Title of file for HTML: Supplementary Information Description: Supplementary Figures Type of file: MOV Title of file for HTML: Supplementary Movie 1 Description: NLRP3 is moving along
More informationNature Neuroscience: doi: /nn.2275
Supplementary Figure S1. The presence of MeCP2 in enriched primary glial cultures from rat or mouse brains is not neuronal. Western blot analysis of protein extracts from (a) rat glial and neuronal cultures.
More informationBNP mrna expression in DR and DS rat left ventricles (n = 5). (C) Plasma norepinephrine
Kanazawa, et al. Supplementary figure legends Supplementary Figure 1 DS rats had congestive heart failure. (A) DR and DS rat hearts. (B) QRT-PCR analysis of BNP mrna expression in DR and DS rat left ventricles
More informationSupplementary Figure 1. Microglia do not show signs of classical immune activation following MD a-b. Images showing immunoreactivity for MHCII (a)
1 Supplementary Figure 1. Microglia do not show signs of classical immune activation following MD a-b. Images showing immunoreactivity for MHCII (a) and CD45 (b) in fixed sections of binocular visual cortex
More informationSupplementary Materials for. c-abl Activation Plays a Role in α-synucleinopathy Induced Neurodegeneration
Supplementary Materials for c-abl Activation Plays a Role in α-synucleinopathy Induced Neurodegeneration Saurav Brahmachari, Preston Ge, Su Hyun Lee, Donghoon Kim, Senthilkumar S. Karuppagounder, Manoj
More informationIslet viability assay and Glucose Stimulated Insulin Secretion assay RT-PCR and Western Blot
Islet viability assay and Glucose Stimulated Insulin Secretion assay Islet cell viability was determined by colorimetric (3-(4,5-dimethylthiazol-2-yl)-2,5- diphenyltetrazolium bromide assay using CellTiter
More informationDep. Control Time (min)
aa Control Dep. RP 1s 1 mv 2s 1 mv b % potentiation of IPSP 2 15 1 5 Dep. * 1 2 3 4 Time (min) Supplementary Figure 1. Rebound potentiation of IPSPs in PCs. a, IPSPs recorded with a K + gluconate pipette
More informationSUPPLEMENTARY INFORMATION
DOI: 1.138/ncb222 / b. WB anti- WB anti- ulin Mitotic index (%) 14 1 6 2 T (h) 32 48-1 1 2 3 4 6-1 4 16 22 28 3 33 e. 6 4 2 Time (min) 1-6- 11-1 > 1 % cells Figure S1 depletion leads to mitotic defects
More informationSupplementary Figure 1. AdipoR1 silencing and overexpression controls. (a) Representative blots (upper and lower panels) showing the AdipoR1 protein
Supplementary Figure 1. AdipoR1 silencing and overexpression controls. (a) Representative blots (upper and lower panels) showing the AdipoR1 protein content relative to GAPDH in two independent experiments.
More informationParallel Driving and Modulatory Pathways Link the Prefrontal Cortex and Thalamus
Boston University OpenBU Health Sciences http://open.bu.edu SAR: Health Sciences: Scholarly Papers 2007-9-5 Parallel Driving and Modulatory Pathways Link the Prefrontal Cortex and Thalamus Zikopoulos,
More informationSocial deficits in Shank3-deficient mouse models of autism are rescued by histone deacetylase (HDAC) inhibition
SUPPLEMENTARY INFORMATION Articles https://doi.org/10.1038/s41593-018-0110-8 In the format provided by the authors and unedited. Social deficits in Shank3-deficient mouse models of autism are rescued by
More informationSUPPLEMENTARY INFORMATION
doi: 10.1038/nature06994 A phosphatase cascade by which rewarding stimuli control nucleosomal response A. Stipanovich*, E. Valjent*, M. Matamales*, A. Nishi, J.H. Ahn, M. Maroteaux, J. Bertran-Gonzalez,
More informationBMI risk SNPs associate with increased CADM1 and CADM2 expression in the cerebellum of human subjects.
Supplementary Figure 1 BMI risk SNPs associate with increased CADM1 and CADM2 expression in the cerebellum of human subjects. Boxplots show the 25% and 75% quantiles of normalized mrna expression levels
More informationRescue of mutant rhodopsin traffic by metformin-induced AMPK activation accelerates photoreceptor degeneration Athanasiou et al
Supplementary Material Rescue of mutant rhodopsin traffic by metformin-induced AMPK activation accelerates photoreceptor degeneration Athanasiou et al Supplementary Figure 1. AICAR improves P23H rod opsin
More informationFig. S1. Subcellular localization of overexpressed LPP3wt-GFP in COS-7 and HeLa cells. Cos7 (top) and HeLa (bottom) cells expressing for 24 h human
Fig. S1. Subcellular localization of overexpressed LPP3wt-GFP in COS-7 and HeLa cells. Cos7 (top) and HeLa (bottom) cells expressing for 24 h human LPP3wt-GFP, fixed and stained for GM130 (A) or Golgi97
More informationSupplementary Figure 1 hlrrk2 promotes CAP dependent protein translation.
` Supplementary Figure 1 hlrrk2 promotes CAP dependent protein translation. (a) Overexpression of hlrrk2 in HeLa cells enhances total protein synthesis in [35S] methionine/cysteine incorporation assays.
More informationNature Biotechnology: doi: /nbt Supplementary Figure 1. Diagram of BBB and brain chips.
Supplementary Figure 1 Diagram of BBB and brain chips. (a) Schematic of the BBB Chip demonstrates the 3 parts of the chip, Top PDMS channel, membrane and Bottom PDMS channel; (b) Image of 2 BBB Chips,
More informationNature Neuroscience: doi: /nn Supplementary Figure 1. Neuron class-specific arrangements of Khc::nod::lacZ label in dendrites.
Supplementary Figure 1 Neuron class-specific arrangements of Khc::nod::lacZ label in dendrites. Staining with fluorescence antibodies to detect GFP (Green), β-galactosidase (magenta/white). (a, b) Class
More informationA Hepatocyte Growth Factor Receptor (Met) Insulin Receptor hybrid governs hepatic glucose metabolism SUPPLEMENTARY FIGURES, LEGENDS AND METHODS
A Hepatocyte Growth Factor Receptor (Met) Insulin Receptor hybrid governs hepatic glucose metabolism Arlee Fafalios, Jihong Ma, Xinping Tan, John Stoops, Jianhua Luo, Marie C. DeFrances and Reza Zarnegar
More informationSUPPLEMENTARY FIGURES AND TABLE
SUPPLEMENTARY FIGURES AND TABLE Supplementary Figure S1: Characterization of IRE1α mutants. A. U87-LUC cells were transduced with the lentiviral vector containing the GFP sequence (U87-LUC Tet-ON GFP).
More informationNature Neuroscience: doi: /nn Supplementary Figure 1. MADM labeling of thalamic clones.
Supplementary Figure 1 MADM labeling of thalamic clones. (a) Confocal images of an E12 Nestin-CreERT2;Ai9-tdTomato brain treated with TM at E10 and stained for BLBP (green), a radial glial progenitor-specific
More informationSupplemental Figures:
Supplemental Figures: Figure 1: Intracellular distribution of VWF by electron microscopy in human endothelial cells. a) Immunogold labeling of LC3 demonstrating an LC3-positive autophagosome (white arrow)
More informationSupplementary Figure 1. Quantile-quantile (Q-Q) plots. (Panel A) Q-Q plot graphical
Supplementary Figure 1. Quantile-quantile (Q-Q) plots. (Panel A) Q-Q plot graphical representation using all SNPs (n= 13,515,798) including the region on chromosome 1 including SORT1 which was previously
More informationSupplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation.
Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation. (a) Embryonic fibroblasts isolated from wildtype (WT), BRAF -/-, or CRAF -/- mice were irradiated (6 Gy) and DNA damage
More informationSupplemental Figure 1. Intracranial transduction of a modified ptomo lentiviral vector in the mouse
Supplemental figure legends Supplemental Figure 1. Intracranial transduction of a modified ptomo lentiviral vector in the mouse hippocampus targets GFAP-positive but not NeuN-positive cells. (A) Stereotaxic
More informationUbe3a is required for experience-dependent maturation of the neocortex
Ube3a is required for experience-dependent maturation of the neocortex Koji Yashiro, Thorfinn T. Riday, Kathryn H. Condon, Adam C. Roberts, Danilo R. Bernardo, Rohit Prakash, Richard J. Weinberg, Michael
More informationNature Immunology: doi: /ni.3866
Nature Immunology: doi:10.1038/ni.3866 Supplementary Figure 1 The effect of TIPE2 on chemotaxis. a, The expression of TIPE2 in dhl-60c, dhl-60t, TIPE2-expressing and 15/16Q-expressing dhl-60t neutrophils
More informationT H E J O U R N A L O F C E L L B I O L O G Y
Supplemental material Beck et al., http://www.jcb.org/cgi/content/full/jcb.201011027/dc1 T H E J O U R N A L O F C E L L B I O L O G Y Figure S1. Membrane binding of His-tagged proteins to Ni-liposomes.
More informationSantulli G. et al. A microrna-based strategy to suppress restenosis while preserving endothelial function
ONLINE DATA SUPPLEMENTS Santulli G. et al. A microrna-based strategy to suppress restenosis while preserving endothelial function Supplementary Figures Figure S1 Effect of Ad-p27-126TS on the expression
More informationHormonal gain control of a medial preoptic area social reward circuit
CORRECTION NOTICE Nat. Neurosci. 20, 449 458 (2017) Hormonal gain control of a medial preoptic area social reward circuit Jenna A McHenry, James M Otis, Mark A Rossi, J Elliott Robinson, Oksana Kosyk,
More informationmm Distance (mm)
b a Magnet Illumination Coverslips MPs Objective 2575 µm 1875 µm 1575 µm 1075 µm 875 µm 545 µm 20µm 2 3 0.5 0.3mm 1 1000 100 10 1 0.1 1000 100 10 1 0.1 Field Induction (Gauss) 1.5 0 5 10 15 20 Distance
More informationSupplementary Figure 1. Gene schematics of hyls-1, gasr-8 and k10g6.4, and TEM analysis of TFs in WT and hyls-1 cilia. (a) Gene structure of hyls-1,
Supplementary Figure 1. Gene schematics of hyls-1, gasr-8 and k10g6.4, and TEM analysis of TFs in WT and hyls-1 cilia. (a) Gene structure of hyls-1, gasr-8 and k10g6.4 based on WormBase (http://wormbase.org),
More informationT H E J O U R N A L O F C E L L B I O L O G Y
Supplemental material Edens and Levy, http://www.jcb.org/cgi/content/full/jcb.201406004/dc1 T H E J O U R N A L O F C E L L B I O L O G Y Figure S1. Nuclear shrinking does not depend on the cytoskeleton
More informationNature Neuroscience: doi: /nn Supplementary Figure 1. Large-scale calcium imaging in vivo.
Supplementary Figure 1 Large-scale calcium imaging in vivo. (a) Schematic illustration of the in vivo camera imaging set-up for large-scale calcium imaging. (b) High-magnification two-photon image from
More informationSupplementary Figure 1
Supplementary Figure 1 Supplementary Figure 1 Schematic depiction of the tandem Fc GDF15. Supplementary Figure 2 Supplementary Figure 2 Gfral mrna levels in the brains of both wild-type and knockout Gfral
More informationSupplemental Table I
Supplemental Table I Cortex Hippocampus Age (weeks) Genotype STE 61 pste 61 STE 61 pste 61 8 100.0 ± 4.4 96.2 ± 6.0 99.8 ± 8.7 167.5 ± 7.8* 100.0 ± 7.0 90.5 ± 13.8 100.0 ± 12.8 260.4 ± 33.9** 12 100.0
More informationSupplementary Figure S1: Tanycytes are restricted to the central/posterior hypothalamus
Supplementary Figure S1: Tanycytes are restricted to the central/posterior hypothalamus a: Expression of Vimentin, GFAP, Sox2 and Nestin in anterior, central and posterior hypothalamus. In the anterior
More informationSupplemental Tables and Figures. The metalloproteinase-proteoglycans ADAMTS7 and ADAMTS12 provide an innate,
Supplemental Tables and Figures The metalloproteinase-proteoglycans ADAMTS7 and ADAMTS12 provide an innate, tendon-specific protective mechanism against heterotopic ossification Timothy Mead et al Supplemental
More information