pcdna3.1 HuT5α RhT5α (μg) plpcx-based constructs 1.00E E+05 TRIM5αrh 1.00E TRIM5α plasmid (μg)

Transcription

1 a p pdna3. as.... (μg) p pagmt5α (μg) Sakuma t al., Supplmntary Fig. (/2) 293T CV Vro pdna3. AgmT5α CynT5α pdna3. AgmT5α CynT5α pdna3. AgmT5α CynT5α pdna3. AgmT5α CynT5α HA βatin p CMV prom. KpnI Start oon GGTACCATG~ ORF XhoI Kozak Start oon EoRIGCCACCATG~ BGH pa HIV NL43 Titr () plpcxas onstruts.e6.e5.e4 hu rh.e3.5. plasmi (μg) Prnt viaility MTT Assay pbssk() pdna3. p. (μg). pagmt5α pcynt5α Fig. S an p xprss omparal lvls of protins. (a)., an. μg of th pdna3.as plasmis wr transft in 293T lls, an th protins wr tt y antiha antioy. () Comparison of th lvls of primat protins upon transint transftion of pdna3.as plasmis noing variants from human, rhsus monky, Afrian Grn monky an Cynomolgus monky. Anothr xampl of xprssion in 293T lls (lft panl), an xprssion in 293T,, CV an Vro lls whih wr transft with. μg of xprssing plasmi (mil an right panls). () p has a KpnI sit (GGTACC) insta of th onsnsus Kozak squn (GCCACC), whil has th onsnsus Kozak squn. () 293T lls wr otransft with., an. μg of plpcxrhha or plpcxhuha (rtroviral vtoras rhxprssing plasmis, kinly provi y Dr. Soroski) along with. μg of pnl43. Viral titrs wr trmin two ays aftr transftion. () 293T lls wr transft with., an. μg of th pdna3.as xprssing plasmis y Fugn6. Two ays aftr transftion, prnt ll viaility was analyz y MTT assay. an p xprss omparal lvls of protins. Whn xprssing plasmis wr transft, th lvls of human an rhsus protins wr omparal in 293T,, CV or Vro lls (Fig. Sa an ). As w sri in our original artil (Sakuma t al., 27 Nat M), th rhsus monky xprssing plasmi, p, has a KpnI sit (GGTACC) insta of th onsnsus Kozak squn (GCCACC), whras has th onsnsus Kozak squn (GCCACC) (Fig. S). This may rsult in th ompromis xprssion from p. W also xamin anothr rhxprssion plasmi, plpcxrhha (Strmlau t al., 24, Natur), whih xprsss approximatly 5fol lss rh protin than p (Fig. Si). plpcxrhha lok HIV proution mor ffiintly than plpcxhuha (Fig. S). W thus onlu that rh has strongr antihiv ativity than hu. Whn w analyz 293T lls transft with th xprssing plasmis y MTT assay, no onsiral toxiity was osrv (Fig. S).

2 Sakuma t al., Supplmntary Fig. (2/2) f psp72.6 (μg) pcmvr8.9 phgp psp72 pcmvr8.9 phgp g phgp (μg) Wiltyp GagPol/Rv/Tat pcmvr8.9 ( μg) Coonoptimiz GagPol phgp (.3 μg) p.... (μg) h Fulllngth Fulllngth i phgp (μg) Clls plpcx HA.2 p.2 Trunat (2 kda) phgp VLPs in VLPs Trunat (2 kda) VLPs Fulllngth Trunat (2 kda) Fig. S (f) 293T lls wr transft with or.6 µg of psp72 (), pcmvr8.9 (a wiltyp HIV GagPol xprssion plasmi, kinly provi y Dr. Trono) or phgp an ll lysats wr analyz for HIV Gag protin xprssion. (g) W otransft 293T lls with rasing amounts of phgp with µg of p or pdna3. (Lft panl). pdna3. was us to ajust th final plasmi onntrations. Two ays aftr transftion, lls wr harvst to xamin th HIV Gag xprssion (Lft panl). 293T lls wr otransft with inrasing amounts of p with μg of pcmvr8.9 or.3 μg of phgp. HIV Gag protins wr tt y immunolotting (Right panls). (h) 293T lls wr transft with µg of phgp togthr with. µg of p or. Two ays aftr transftion, VLPs wr filtr an purifi y ultrantrifugation through a 2% suros ushion. Th purifi VLPs wr sujt to immunolotting analysis to tt (right panl) an Gag (lft panl) protins. (i) 293T lls wr transft with.4 µg of phgp, togthr with. or.2 µg of p or plpcxrhha. Two ays aftr transftion, purifi VLPs an ll lysats wr analyz for rh signals. Effiint napsiation of rh, ut not hu, in HIV viruslik partils (VLPs). As w sri in our original artil (Sakuma t al., 27, Nat M), a oonoptimiz HIV GagPolxprssing plasmi, phgp, whih xprsss high lvls of HIV GagPol protins in a Rvinpnnt mannr (Fig. Sf), oul mask th rhmiat lat rstrition (Fig. Sg). This osrvations suggst that th lat rstrition an xplain y th alan twn th lvls of Gag graation an synthsis in th lls. Whn th Gag proution surpasss th miat Gag graation, w oul otain high lvls of HIV VLPs in th prsn of rh protin. In ths onitions, intat an trunat forms of rh, ut not hu, wr tt in th purifi HIV VLPs (Fig. Sh), suggsting a strongr intration twn rh an HIV Gag polyprotins. It was also not that th VLPs ma in th prsn of rh protin ontain mor prursor Gag protins than th ontrol (Fig. Sh). Effiint rh napsiation was also osrv with anothr rhxprssing plasmi, plpcxrhha (Fig. Si). As w rport prviously (Sakuma t al., 27, Nat M), oxprssion of HIV GagPol an rh rsult in trunation of th protin. No rh signals wr tt in th asn of phgp, ruling out th possiility of srtion without napsiation.

3 Sakuma t al., Supplmntary Fig. 2 a BlI Hin III Sph I BamH I HIV NL43 Titr () Rh R R/H Bl Sph Hu H/R VLPs 6 in VLPs RING BB CC B3.2(SPRY) Rh R R/H Bl Sph Hu H/R Fulllngth Trunat (~2 kda) pr55 gag (hr) Fig. S2. Th rh RBCC omain is rsponsil for th antiviral ativity on HIV proution. (a) Shmati rprsntation of himras (BB, a Box2 motif; CC, a oiloil motif). Th sha ox in th B3.2(SPRY) omain iniats th rgion that is ssntial for th rhmiat arly rstrition of HIV. Th iagram is not to sal. () 293T lls wr transft with μg of pnl43 an. μg of a himri xprssion plasmi. Aftr two ays, viral titrs in th suprnatants wr trmin. As a ontrol,. μg of psp72 was us. () () 293T lls wr otransft with.2 μg of phgp togthr with a sris of plasmis xprssing himras (. μg). Aftr two ays, th ultur suprnatants wr harvst an filtr through a.45 μm por siz filtr. Th VLPs wr thn purifi y ultrantrifugation through a 2% suros ushion an analyz for th inorporation of th HAtagg as wll as th HIV Gag protins. () hu ovrxprssion lays HIV Gag maturation kintis. 293T lls wr transft with.25 µg of pcmvr8.9 an. µg of pdna3., p or phut5a. Two ays posttransftion, th lls wr puls an th lvls of Gag protins wr assay y immunopripitation using spifi antiois. rh RBCC omain is rsponsil for th lat rstrition (From Figur 4 in our original artil (Sakuma t al., 27 Nat M), with aitional ata, S2). Th himri onstruts with th rh RBCC omain, ut not th rh B3.2(SPRY) omain, ffiintly ru th HIV titrs. Th rh Box2 an partial oiloil motifs wr rquir for ffiint antiviral ativity an virion inorporation of (Fig. S2, ). Th VLPs ma in th prsn of protins, spially rstritiv himri onstruts, ontain mor prursor Gag protins (Fig. S2). W ar intrst in th osrvation y Strrow t al. (998, Virology) that Cylosporin A tratmnt rsults in similar Gag prossing fts in HIV VLPs ma in simian Cos lls. hu ovrxprssion lays HIV Gag maturation kintis (From Figur 2F in our original artil, with aitional hu ata). Staility of HIV Gag protins in th prsn or asn of protins wr trmin y pulshas assays (Fig. S2). Whn HIV GagPol wr xprss in th asn of (), HIV Gag polyprotin an apsi wr tt throughout th assay. Although th signals for prursor Gag protins graually ras, this orrlat with inras signal of apsi. Thrfor, th total signals for Gag protins in prour lls rmain high. Th halflif of total Gag protins was stimat as 6.6 hours. In ontrast, HIV Gag polyprotin appar to turn ovr rapily in th prsn of rh an th signal for apsi was low ttal lvls. Human protin show an intrmiat phnotyp with lay Gag maturation kintis.

4 Sakuma t al., Supplmntary Fig. 3 a D D D2 D3 D4 SP CC RINGBBCC D D D2 D3 D4 B3.2(SPRY) SP CC f mutants (antiha) pdna3. p SP CC phgp p (μg) pd (μg) pdna3. p.2 SP CC.2 p7 VLPs (phgp) inorporation (in VLP) HIV NL43 Titr () 6 3 Full lngth Trunat (~2 kda) Ct Hu Rh D D D2 D3 D4 SP CC trunation (Cll lysats) Full lngth Trunat (~2 kda) Fig. S3 (a) Shmati rprsntation of mutants. BB; a BBox2 motif, CC; a oil oil omain motif. () Exprssion of th mutant protins wr vrifi y immunolotting. () 293T lls wr otransft with pnl43 an a plasmi xprssing wiltyp rh (Rh) or th ltion mutants. psp72 was us as a ontrol (Ct). Fortyight hours posttransftion, ultur suprnatants wr harvst to trmin th viral titrs (Man ± SD) () 293T lls wr otransft with.2 μg of ph GP togthr with a sris of plasmis xprssing rh mutants (. μg). Aftr two ays, th ultur suprnatants wr harvst an filtr through a.45 μm por siz filtr. Th VLPs wr thn purifi y ultrantrifugation through a 2% suros ushion an analyz for th inorporat y immunolotting with antiha antioy (lowr panl). Th sam mmran was rpro for HIV Gag protins (uppr panl). () Sam as () xpt that ll lysats wr harvst to analyz an HIV protin xprssion. Th sam mmran was pro with thr iffrnt antiois, antiha, anti an antip7. (f) 293T lls wr transft with.4 µg of phgp, togthr with. or.2 µg of p or pd. Two ays aftr transftion, ll lysats wr analyz for signals. Th rh B3.2(SPRY) omain is not rquir for th lat rstrition. A sris of Ctrminally HAtagg rh mutants with ltions in th N or Ctrminal rgions wr gnrat (Fig. S3a). Aftr vrifying th xprssion of HAtagg protins (Fig. S3), w xamin thir antiviral ativity on HIV proution. Exprssion of SP, a B3.2(SPRY) omain ltion mutant, show th antiviral ffts omparal to th wiltyp rh, whil mutants with ltion in th Ntrminal rgion or th linkr rgion twn th oiloil an B3.2(SPRY) omains rsult in loss of th lat rstrition (Fig. S3). To arss th influn of C or Ntrminal ltions of rh on th intration with HIV Gag, w gnrat HIV VLPs in th prsn of rh mutants an xamin thir inorporation into th VLPs. Immunolotting analysis with antiha antioy show that th Ctrminal ltion mutants SP, an CC, ut not th Ntrminal ltion mutants, wr ffiintly inorporat into th VLPs. Ths osrvations suggst that th Ntrminal rgion (or th onformation of rh protin) is ssntial for th ffiint VLP inorporation, whil th oiloil an B3.2(SPRY) omains ar ispnsal for th virion inorporation. Th VLPs ma in th prsn of rstritiv protins (Wiltyp an SP) ontain mor prmatur Gag protins (Fig. S3 uppr panl). To onfirm th antihiv ativity of SP, w prou HIV NL43 in th prsn of th mutants an xamin th lvls of HIV Gag protins (Fig. S3). In th prsn of th mutant SP, HIV Gag protins wr ras in th prour lls. To onfirm th wakr intration twn th D mutant an HIV GagPol, w otransft th D mutant or wiltyp rhxprssing plasmis with phgp. Th rh mutant D show a wakr signal for th trunat 2 kda form (Fig. S3f) furthr suggsting th impair intration twn th Ntrminal ltion mutant an HIV Gag polyprotins in th lls.

5 Sakuma t al., Supplmntary Fig. 4 (/2) a HIV vtor inftion (human) (flin) Early (postntry) rstrition iy FLH iy FLH iy FLH iy FLH iy FLH iy FLH %positiv Stal rh xprssion Transint rh ovrxprssion Lat rstrition NL43 SIVma NL43 SIVma 6 3 HIV (NL43) titrs 6 3 HLa pcdna3. p pcdna3. p 293T pcdna3. p HLa pcdna3. p pcdna3. p Etopi rh xprssion in human, HLa an flin lls os not support th lat rstrition. Th rhmiat postntry rstrition has n stui xtnsivly y topi rh xprssion in human, HLa or lls. W thus xamin if introution of rh oul support th lat rstrition in ths ll lins. W first inft an lls with a rtroviral vtor xprssing Ctrminally HAtagg rh. As a ontrol, w inft a rtroviral vtor with no insrt (). Following sltion unr th prsn of mg/ml of G48, w otain staly rhxprssing an ontrol an CRFK ulk population lls (Fig. S4a). W first xamin thir rsistan to a xprssing HIV vtor. As xpt, th rhxprssing lls wr mor rsistant to th inoming HIV vtor (Fig. S4). W thn xamin th lat rstrition in th an lls. As shown in Fig. S4, stal rh xprssion in ths lls i not ru th proution of HIV or SIVma. W thn xamin if transint ovrxprssion of rh in or HLa lls l to th lat rstrition.. μg of p or wr otransft with. μg of pnl43 in 293T, HLa an lls. Two ays aftr transftion, w analyz th viral titrs as wll as HIV Gag protins in th ll lysats. Transint rh ovrxprssion in HLa an lls i not lok th HIV proution (Fig. S4).

6 Sakuma t al., Supplmntary Fig. 4 (2/2) f Fol rstrition HIV NL43 proution 293T HLa GHOST HT29 A375 MIA PaCa2 HT8 SKOV3 U25 PANC IGrov 293T HLa HT29 A375 MIA PaCa2 HT8 SKOV3 U25 PANC IGrov Emryoni Kiny Crvial Canr Mullolastoma Colortal Anoarinoma Skin Malignant Mlanoma Panrati Carinoma Conntiv Tissu Firosaroma Ovarian Carinoma Gliolastoma Panrati Carinoma Lung Carinoma Ovarian Carinoma PANC g h Early (Postntry) rstrition RLU 3 2 HIVLuifras vtor inftion input (μl) PANC input (μl) Lat rstrition 3 2 HIV NL43 3 SIVma A PANC PANC i PANC rhha j 293T p (μg).. βatin Stal rhxprssion in human an PANC lls support th lat rstrition. () To fin human ll lins whih support rhmiat lat rstrition, w srn various ll lins y otransfting. μg of p (or ontrol pdna3.) along with.2 μg of pnl43 an analyzing th viral proution. W foun svral ll lins, inluing MIA PaCa2, PANC an, whih ma approximatly fol lss viruss in th prsn of rh protin. (f) W inft th thr ll lins with rtroviral vtors xprssing rh or. W slt th inft ll lins in th prsn of mg/ml of G48 an otain ulk populations of PANC an lls. W oul not otain any G48rsistant MIA PaCa2 lls. W onfirm rh xprssion in th an PANC lls y immunolotting with HA antioy, although long xposur tims wr rquir for aquat signals. (g) W xamin th rsistan of rhxprssing an PANC lls to a Luifrasxprssing HIV vtor. As xpt, th rhxprssing lls wr mor rsistant to th inoming HIV vtor. (h) W thn xamin th lat rstrition in th an PANC lls. Stal rh xprssion in an PANC lls ru th proution of HIV, ut not SIVma. (i) W ompar th lvls of rh xprssion in th staly rhxprssing ll lins. 6. ng of ll lysats wr analyz y immunolotting with antiha an antiβatin antiois. Th apparnt lvls of rh protin i not orrlat with thir aility to support th lat rstrition. (j) Th lvls of rh xprssion in th transintly transft 293T lls wr in xss of thos xprss in th stal.

7 Sakuma t al., Supplmntary Fig. 5 a HA HIVDsR vtor inftion βatin. %RFPpositiv Jurkat A3 #A #B #A #B Jurkat A3 SupT #A #B Early (Postntry) rstrition #A #B SupT MT4 #A #B RT5α#C #A #B MT4 RT5α#C HIV NL43 Titr () SIVmaA Titr () 3 3 #A #B Jurkat A3 Lat rstrition 6 6 #A #B SupT 6 6 #A #B RT5α#C MT4 Stal rh xprssion rsult in th lat rstrition in human Jurkat A3 an MT4 lls. (a) W xamin if introution of rh oul support th lat rstrition in human T ll lins. W inft Jurkat A3, SupT an MT4 lls with a rtroviral vtor xprssing Ctrminally HAtagg rh from an MLV LTR. As a ontrol, w inft th lls with a xprssing rtroviral vtor. Following sltion unr th prsn of G48, w otain staly rh or xprssing ulk population lls. W thn otain singl ll lons y limiting ilution. Cll lysats from 4x lls wr us to onfirm th xprssion of rh protin. Th sam mmran was rpro for β Atin protin. () W xamin thir rsistan to a DsRxprssing HIV vtor. Th rhxprssing SupT an MT4 lls wr strongly rsistant to HIV inftion, whil rhxprssing Jurkat lls show wak postntry rstrition. () W xamin th lat rstrition in th T ll lons. lls wr transft with 5 μg of pnl43 or psivmaa y Gn Pulsr Xll ltroporation systm. W us th prst Jurkat transftion protool for th xprimnt. Two ays aftr transftion, ultur suprnatants wr harvst to trmin th viral titrs. Stal rh xprssion in th SupT an MT4 lls ru proution of HIV, ut not SIVma.

8 a RING BBox2 Coiloil B3.2(SPRY) Sakuma t al., Supplmntary Fig. 6 LKO# H3#2 H3#5 H4# H4#3 H4#4 H4#6 LKO# shrna: plkoh3 /2 /4 /8 /6 /32 /64 /28 plkoh4 NMLV inftion αtuulin plko H3#2 H3#5 H4#3 H4#4 % 5.9% 2.% 27.7% 2.5% knokown lons LKO# H4# H4#3 Ct Rh Es Ct Rh Es Ct Rh Es Ct Rh Es NL43 titrs () 6 Ct: pdna3. Rh: p Es: ph4esap f Ct Rh Es Ct Rh Es Ct Rh Es Ct Rh Es Ct Rh Es LKO# H4# H4#3 H4#4 knokown lons NL43 titrs from FrhK4 lls (μg) Homo sapins Chromosom Loation: p5 Maaa mulatta Chromosom 4 TRIM6TRIM34 TRIM6 TRIM22 ( ~ ) TRIM34 TRIMP TRIM5 ( ~ ) TRIM5 ( ~ ) TRIM22 ( ~ ) TRIM6TRIM34 putativ Cylophilin A Enognous human is not a ominant ngativ fator for th rhmiat lat rstrition in human lls. (a) On of th possil rasons why introution of rh os not la to th lat rstrition in som human lls is aus human lls may hav a fator whih inhiits th rh lat rstrition mahinry. As th first aniat, w xamin th influn of nognous human on th rhmiat lat rstrition in lls. In orr to stalish lons with stal knokown, w inft lls with VSVGpsuotyp HIV vtors arrying a rhspifi shrna (LKOH3 an LKOH4, Opn Biosystms) or ontrol LKO at a multipliity of inftion (MOI) of.. Following sltion in th prsn of puromyin, w otain singl ll lons. Th mrna lvls in th LKO, LKOH3 or LKOH4transu lons wr srn y RTPCR. Four LKOH4 lons show sustantially ru lvls of spifi signals. From th RTPCR rsults with srially ilut RT prouts, w stimat that th LKOH4 lons xprss approximatly ~3% of th normal lvl of mrna. () W hk thir rsistan to a VSVGpsuotyp, xprssing NMLV vtor (Bok t al., 2, J. Virol., kinly provi y Dr. J. Stoy). W slt thr lons, H4#, H4#3 an H4#4, whih xprss th lowst lvls of spifi mrna. () W also gnrat a shrnarsistant rhxprssing plasmi, ph4esap, y introuing silnt mutations ("TGCACTGTCTCATTCTTCAAT (CTVSFFN)" to "TGTACGGTAAGTTTTTTTAAT") in th shrna targt sit of p. W onfirm th rh protin xprssion in. Th sap mutant was mor rsistant to th shrna H4 in th knokown lons. () W otransft th rhxprssing plasmis along with pnl43. Two ays aftr transftion, th ultur suprnatants wr harvst an us to xamin th viral titrs. Enognous hu knokown as wll as introution of rhh4esap i not afft th viral proution. () Whn w otransft rhsus monky FrhK4 lls with pnl43 an, w foun no ffts. Colltivly, w onlu that human is not a ominant ngativ fator in th rhmiat lat rstrition in human lls. (f) Typ I intrfronrsponsiv TRIM5 an TRIM22 gns shar th nhanr rgion, suggsting similar transriptional rgulation of th two protins. W spulat that TRIM22 protin may play a rol in th miat lat rstrition.

9 a NLSCyp CypAining loop SIVma 85PVHAGPIAP PQPA.P.QQ 9 tat Sakuma t al., Supplmntary Fig. 7.E6 LTR gag propol vif vpr rv vpu nv nf LTR.E5.E4 NLSCA SIVmaCA.E3 Ct Rh Ct Rh Ct Rh NL43 NLSCA NLSCyp Rlativ strngth (jug from th titrs) SIV < T5α SIV T5α SIV = T5α SIV > T5α SIV < T5α SIV < T5α SIV < T5α SIV T5α.E8 SIVma A psivmaa p (μg)......e7.e6 Full lngth rhha.e5.e p (μg)..3. SIVma plasmi (μg) PrGag CA HIV NL43as mutants with SIVma apsi squns ar largly snsitiv to th lat rstrition. W ma pnlscyp, whih has th Cylophilin Aining loop squn rpla with th SIVma ountrpart (sam mutations sri y Kamaa t al., 26, Pro Natl Aa Si USA), y xtnsion PCR/loning. A HIV(SCA)noing onstrut was kinly provi y Dr. Soroski, an us as a tmplat to amplify th gag squn, whih susquntly lon into pnl43 (pnlsca) following two stps of xtnsion PCR/loning. To tst th ffts of CA mutations on th snsitivity to th rh lat rstrition, w otransft 293T lls with th proviral plasmi an p, an prou th HIV mutants in th prsn of rh. Similar to th prvious stuis, rh xprssion strongly ru th parntal NL43 titrs. rh xprssion ras th viral titrs from pnl43sca an pnl43scyp mor than fols, suggsting that NL43as mutants with SIVma apsi squns ar largly snsitiv to th lat rstrition. Th viral titrs from pnl SCA was lowr than parntal pnl43, suggsting that th SCA mutant has impair fitnss uring viral proution in 293T lls or inftion of GHOST lls. SIVmaA proution altrs th lvls of rh protin in prour lls. In th rhmiat arly (postntry) rstrition, apsi squns trmin viral susptiility to th rstrition (Strmlau t al., 24, Natur). In our original stuy (Sakuma t al., 27, Nat M), w show that SIVmaA an SIVagmtan wr mor rsistant to th rhmiat lat rstrition. Howvr, this os not nssarily iniat that SIVma Gag avois th lat rstrition through saping th intration with rh. In orr to tst th possiility that SIVma an saturat or lok th lat rstrition mahinry, w xamin if rh protin rstrits SIVma whn th SIVma proution is suoptimal. As shown in Fig. S7, SIVma am mor snsitiv to th lat rstrition whn lowr onntrations of SIVma plasmi wr otransft with p in 293T lls. Intriguingly, wiltyp SIVma proution altr th pattrns of rh signals aoring to wstrn lot analysis (Fig. S7). Unr th onitions whr SIVma titrs wr not afft y th rh (SIVma>rh), ru lvls of rh wr sn. Whn th viral proution was afft y rh (SIVma<rh), w saw normal an/or altr pattrns of rh signals. From th pattrns of signals, w spulat that th protin might gra y uiquitination. Although w n to prform furthr arful xprimnts, ths osrvations suggst that SIVma an rsist this rstrition y ountrating or saturating th lat rstrition mahinry, rathr than saping rognition y rh. It is intrsting to not that many viruss ar known to xprss viral protins, whih ountrat TRIM9miat antiviral ativitis y moifying/graing TRIM9 (Ch t al., 23, J. Virol. (HSV); Ullman t al., 27, J. Virol. (Anovirus); Blonl t al., 22, Onogn (Rais virus)). is a mmr of th vast family of TRIM protins with RBCC omains. Givn that svral TRIM protins ar known to uprgulat following viral inftion or intrfron tratmnt, it is possil that a sust of TRIM protins rprsnt a nw group of antiviral fators whih lok viral proution at a posttranslational stag. It is also onival that HIV has volv rtain stratgis to avoi/saturat/ountrat suh antiviral ativitis impos y human TRIM protins.