pcdna3.1 HuT5α RhT5α (μg) plpcx-based constructs 1.00E E+05 TRIM5αrh 1.00E TRIM5α plasmid (μg)
|
|
- Melvyn Dennis O’Connor’
- 5 years ago
- Views:
Transcription
1 a p pdna3. as.... (μg) p pagmt5α (μg) Sakuma t al., Supplmntary Fig. (/2) 293T CV Vro pdna3. AgmT5α CynT5α pdna3. AgmT5α CynT5α pdna3. AgmT5α CynT5α pdna3. AgmT5α CynT5α HA βatin p CMV prom. KpnI Start oon GGTACCATG~ ORF XhoI Kozak Start oon EoRIGCCACCATG~ BGH pa HIV NL43 Titr () plpcxas onstruts.e6.e5.e4 hu rh.e3.5. plasmi (μg) Prnt viaility MTT Assay pbssk() pdna3. p. (μg). pagmt5α pcynt5α Fig. S an p xprss omparal lvls of protins. (a)., an. μg of th pdna3.as plasmis wr transft in 293T lls, an th protins wr tt y antiha antioy. () Comparison of th lvls of primat protins upon transint transftion of pdna3.as plasmis noing variants from human, rhsus monky, Afrian Grn monky an Cynomolgus monky. Anothr xampl of xprssion in 293T lls (lft panl), an xprssion in 293T,, CV an Vro lls whih wr transft with. μg of xprssing plasmi (mil an right panls). () p has a KpnI sit (GGTACC) insta of th onsnsus Kozak squn (GCCACC), whil has th onsnsus Kozak squn. () 293T lls wr otransft with., an. μg of plpcxrhha or plpcxhuha (rtroviral vtoras rhxprssing plasmis, kinly provi y Dr. Soroski) along with. μg of pnl43. Viral titrs wr trmin two ays aftr transftion. () 293T lls wr transft with., an. μg of th pdna3.as xprssing plasmis y Fugn6. Two ays aftr transftion, prnt ll viaility was analyz y MTT assay. an p xprss omparal lvls of protins. Whn xprssing plasmis wr transft, th lvls of human an rhsus protins wr omparal in 293T,, CV or Vro lls (Fig. Sa an ). As w sri in our original artil (Sakuma t al., 27 Nat M), th rhsus monky xprssing plasmi, p, has a KpnI sit (GGTACC) insta of th onsnsus Kozak squn (GCCACC), whras has th onsnsus Kozak squn (GCCACC) (Fig. S). This may rsult in th ompromis xprssion from p. W also xamin anothr rhxprssion plasmi, plpcxrhha (Strmlau t al., 24, Natur), whih xprsss approximatly 5fol lss rh protin than p (Fig. Si). plpcxrhha lok HIV proution mor ffiintly than plpcxhuha (Fig. S). W thus onlu that rh has strongr antihiv ativity than hu. Whn w analyz 293T lls transft with th xprssing plasmis y MTT assay, no onsiral toxiity was osrv (Fig. S).
2 Sakuma t al., Supplmntary Fig. (2/2) f psp72.6 (μg) pcmvr8.9 phgp psp72 pcmvr8.9 phgp g phgp (μg) Wiltyp GagPol/Rv/Tat pcmvr8.9 ( μg) Coonoptimiz GagPol phgp (.3 μg) p.... (μg) h Fulllngth Fulllngth i phgp (μg) Clls plpcx HA.2 p.2 Trunat (2 kda) phgp VLPs in VLPs Trunat (2 kda) VLPs Fulllngth Trunat (2 kda) Fig. S (f) 293T lls wr transft with or.6 µg of psp72 (), pcmvr8.9 (a wiltyp HIV GagPol xprssion plasmi, kinly provi y Dr. Trono) or phgp an ll lysats wr analyz for HIV Gag protin xprssion. (g) W otransft 293T lls with rasing amounts of phgp with µg of p or pdna3. (Lft panl). pdna3. was us to ajust th final plasmi onntrations. Two ays aftr transftion, lls wr harvst to xamin th HIV Gag xprssion (Lft panl). 293T lls wr otransft with inrasing amounts of p with μg of pcmvr8.9 or.3 μg of phgp. HIV Gag protins wr tt y immunolotting (Right panls). (h) 293T lls wr transft with µg of phgp togthr with. µg of p or. Two ays aftr transftion, VLPs wr filtr an purifi y ultrantrifugation through a 2% suros ushion. Th purifi VLPs wr sujt to immunolotting analysis to tt (right panl) an Gag (lft panl) protins. (i) 293T lls wr transft with.4 µg of phgp, togthr with. or.2 µg of p or plpcxrhha. Two ays aftr transftion, purifi VLPs an ll lysats wr analyz for rh signals. Effiint napsiation of rh, ut not hu, in HIV viruslik partils (VLPs). As w sri in our original artil (Sakuma t al., 27, Nat M), a oonoptimiz HIV GagPolxprssing plasmi, phgp, whih xprsss high lvls of HIV GagPol protins in a Rvinpnnt mannr (Fig. Sf), oul mask th rhmiat lat rstrition (Fig. Sg). This osrvations suggst that th lat rstrition an xplain y th alan twn th lvls of Gag graation an synthsis in th lls. Whn th Gag proution surpasss th miat Gag graation, w oul otain high lvls of HIV VLPs in th prsn of rh protin. In ths onitions, intat an trunat forms of rh, ut not hu, wr tt in th purifi HIV VLPs (Fig. Sh), suggsting a strongr intration twn rh an HIV Gag polyprotins. It was also not that th VLPs ma in th prsn of rh protin ontain mor prursor Gag protins than th ontrol (Fig. Sh). Effiint rh napsiation was also osrv with anothr rhxprssing plasmi, plpcxrhha (Fig. Si). As w rport prviously (Sakuma t al., 27, Nat M), oxprssion of HIV GagPol an rh rsult in trunation of th protin. No rh signals wr tt in th asn of phgp, ruling out th possiility of srtion without napsiation.
3 Sakuma t al., Supplmntary Fig. 2 a BlI Hin III Sph I BamH I HIV NL43 Titr () Rh R R/H Bl Sph Hu H/R VLPs 6 in VLPs RING BB CC B3.2(SPRY) Rh R R/H Bl Sph Hu H/R Fulllngth Trunat (~2 kda) pr55 gag (hr) Fig. S2. Th rh RBCC omain is rsponsil for th antiviral ativity on HIV proution. (a) Shmati rprsntation of himras (BB, a Box2 motif; CC, a oiloil motif). Th sha ox in th B3.2(SPRY) omain iniats th rgion that is ssntial for th rhmiat arly rstrition of HIV. Th iagram is not to sal. () 293T lls wr transft with μg of pnl43 an. μg of a himri xprssion plasmi. Aftr two ays, viral titrs in th suprnatants wr trmin. As a ontrol,. μg of psp72 was us. () () 293T lls wr otransft with.2 μg of phgp togthr with a sris of plasmis xprssing himras (. μg). Aftr two ays, th ultur suprnatants wr harvst an filtr through a.45 μm por siz filtr. Th VLPs wr thn purifi y ultrantrifugation through a 2% suros ushion an analyz for th inorporation of th HAtagg as wll as th HIV Gag protins. () hu ovrxprssion lays HIV Gag maturation kintis. 293T lls wr transft with.25 µg of pcmvr8.9 an. µg of pdna3., p or phut5a. Two ays posttransftion, th lls wr puls an th lvls of Gag protins wr assay y immunopripitation using spifi antiois. rh RBCC omain is rsponsil for th lat rstrition (From Figur 4 in our original artil (Sakuma t al., 27 Nat M), with aitional ata, S2). Th himri onstruts with th rh RBCC omain, ut not th rh B3.2(SPRY) omain, ffiintly ru th HIV titrs. Th rh Box2 an partial oiloil motifs wr rquir for ffiint antiviral ativity an virion inorporation of (Fig. S2, ). Th VLPs ma in th prsn of protins, spially rstritiv himri onstruts, ontain mor prursor Gag protins (Fig. S2). W ar intrst in th osrvation y Strrow t al. (998, Virology) that Cylosporin A tratmnt rsults in similar Gag prossing fts in HIV VLPs ma in simian Cos lls. hu ovrxprssion lays HIV Gag maturation kintis (From Figur 2F in our original artil, with aitional hu ata). Staility of HIV Gag protins in th prsn or asn of protins wr trmin y pulshas assays (Fig. S2). Whn HIV GagPol wr xprss in th asn of (), HIV Gag polyprotin an apsi wr tt throughout th assay. Although th signals for prursor Gag protins graually ras, this orrlat with inras signal of apsi. Thrfor, th total signals for Gag protins in prour lls rmain high. Th halflif of total Gag protins was stimat as 6.6 hours. In ontrast, HIV Gag polyprotin appar to turn ovr rapily in th prsn of rh an th signal for apsi was low ttal lvls. Human protin show an intrmiat phnotyp with lay Gag maturation kintis.
4 Sakuma t al., Supplmntary Fig. 3 a D D D2 D3 D4 SP CC RINGBBCC D D D2 D3 D4 B3.2(SPRY) SP CC f mutants (antiha) pdna3. p SP CC phgp p (μg) pd (μg) pdna3. p.2 SP CC.2 p7 VLPs (phgp) inorporation (in VLP) HIV NL43 Titr () 6 3 Full lngth Trunat (~2 kda) Ct Hu Rh D D D2 D3 D4 SP CC trunation (Cll lysats) Full lngth Trunat (~2 kda) Fig. S3 (a) Shmati rprsntation of mutants. BB; a BBox2 motif, CC; a oil oil omain motif. () Exprssion of th mutant protins wr vrifi y immunolotting. () 293T lls wr otransft with pnl43 an a plasmi xprssing wiltyp rh (Rh) or th ltion mutants. psp72 was us as a ontrol (Ct). Fortyight hours posttransftion, ultur suprnatants wr harvst to trmin th viral titrs (Man ± SD) () 293T lls wr otransft with.2 μg of ph GP togthr with a sris of plasmis xprssing rh mutants (. μg). Aftr two ays, th ultur suprnatants wr harvst an filtr through a.45 μm por siz filtr. Th VLPs wr thn purifi y ultrantrifugation through a 2% suros ushion an analyz for th inorporat y immunolotting with antiha antioy (lowr panl). Th sam mmran was rpro for HIV Gag protins (uppr panl). () Sam as () xpt that ll lysats wr harvst to analyz an HIV protin xprssion. Th sam mmran was pro with thr iffrnt antiois, antiha, anti an antip7. (f) 293T lls wr transft with.4 µg of phgp, togthr with. or.2 µg of p or pd. Two ays aftr transftion, ll lysats wr analyz for signals. Th rh B3.2(SPRY) omain is not rquir for th lat rstrition. A sris of Ctrminally HAtagg rh mutants with ltions in th N or Ctrminal rgions wr gnrat (Fig. S3a). Aftr vrifying th xprssion of HAtagg protins (Fig. S3), w xamin thir antiviral ativity on HIV proution. Exprssion of SP, a B3.2(SPRY) omain ltion mutant, show th antiviral ffts omparal to th wiltyp rh, whil mutants with ltion in th Ntrminal rgion or th linkr rgion twn th oiloil an B3.2(SPRY) omains rsult in loss of th lat rstrition (Fig. S3). To arss th influn of C or Ntrminal ltions of rh on th intration with HIV Gag, w gnrat HIV VLPs in th prsn of rh mutants an xamin thir inorporation into th VLPs. Immunolotting analysis with antiha antioy show that th Ctrminal ltion mutants SP, an CC, ut not th Ntrminal ltion mutants, wr ffiintly inorporat into th VLPs. Ths osrvations suggst that th Ntrminal rgion (or th onformation of rh protin) is ssntial for th ffiint VLP inorporation, whil th oiloil an B3.2(SPRY) omains ar ispnsal for th virion inorporation. Th VLPs ma in th prsn of rstritiv protins (Wiltyp an SP) ontain mor prmatur Gag protins (Fig. S3 uppr panl). To onfirm th antihiv ativity of SP, w prou HIV NL43 in th prsn of th mutants an xamin th lvls of HIV Gag protins (Fig. S3). In th prsn of th mutant SP, HIV Gag protins wr ras in th prour lls. To onfirm th wakr intration twn th D mutant an HIV GagPol, w otransft th D mutant or wiltyp rhxprssing plasmis with phgp. Th rh mutant D show a wakr signal for th trunat 2 kda form (Fig. S3f) furthr suggsting th impair intration twn th Ntrminal ltion mutant an HIV Gag polyprotins in th lls.
5 Sakuma t al., Supplmntary Fig. 4 (/2) a HIV vtor inftion (human) (flin) Early (postntry) rstrition iy FLH iy FLH iy FLH iy FLH iy FLH iy FLH %positiv Stal rh xprssion Transint rh ovrxprssion Lat rstrition NL43 SIVma NL43 SIVma 6 3 HIV (NL43) titrs 6 3 HLa pcdna3. p pcdna3. p 293T pcdna3. p HLa pcdna3. p pcdna3. p Etopi rh xprssion in human, HLa an flin lls os not support th lat rstrition. Th rhmiat postntry rstrition has n stui xtnsivly y topi rh xprssion in human, HLa or lls. W thus xamin if introution of rh oul support th lat rstrition in ths ll lins. W first inft an lls with a rtroviral vtor xprssing Ctrminally HAtagg rh. As a ontrol, w inft a rtroviral vtor with no insrt (). Following sltion unr th prsn of mg/ml of G48, w otain staly rhxprssing an ontrol an CRFK ulk population lls (Fig. S4a). W first xamin thir rsistan to a xprssing HIV vtor. As xpt, th rhxprssing lls wr mor rsistant to th inoming HIV vtor (Fig. S4). W thn xamin th lat rstrition in th an lls. As shown in Fig. S4, stal rh xprssion in ths lls i not ru th proution of HIV or SIVma. W thn xamin if transint ovrxprssion of rh in or HLa lls l to th lat rstrition.. μg of p or wr otransft with. μg of pnl43 in 293T, HLa an lls. Two ays aftr transftion, w analyz th viral titrs as wll as HIV Gag protins in th ll lysats. Transint rh ovrxprssion in HLa an lls i not lok th HIV proution (Fig. S4).
6 Sakuma t al., Supplmntary Fig. 4 (2/2) f Fol rstrition HIV NL43 proution 293T HLa GHOST HT29 A375 MIA PaCa2 HT8 SKOV3 U25 PANC IGrov 293T HLa HT29 A375 MIA PaCa2 HT8 SKOV3 U25 PANC IGrov Emryoni Kiny Crvial Canr Mullolastoma Colortal Anoarinoma Skin Malignant Mlanoma Panrati Carinoma Conntiv Tissu Firosaroma Ovarian Carinoma Gliolastoma Panrati Carinoma Lung Carinoma Ovarian Carinoma PANC g h Early (Postntry) rstrition RLU 3 2 HIVLuifras vtor inftion input (μl) PANC input (μl) Lat rstrition 3 2 HIV NL43 3 SIVma A PANC PANC i PANC rhha j 293T p (μg).. βatin Stal rhxprssion in human an PANC lls support th lat rstrition. () To fin human ll lins whih support rhmiat lat rstrition, w srn various ll lins y otransfting. μg of p (or ontrol pdna3.) along with.2 μg of pnl43 an analyzing th viral proution. W foun svral ll lins, inluing MIA PaCa2, PANC an, whih ma approximatly fol lss viruss in th prsn of rh protin. (f) W inft th thr ll lins with rtroviral vtors xprssing rh or. W slt th inft ll lins in th prsn of mg/ml of G48 an otain ulk populations of PANC an lls. W oul not otain any G48rsistant MIA PaCa2 lls. W onfirm rh xprssion in th an PANC lls y immunolotting with HA antioy, although long xposur tims wr rquir for aquat signals. (g) W xamin th rsistan of rhxprssing an PANC lls to a Luifrasxprssing HIV vtor. As xpt, th rhxprssing lls wr mor rsistant to th inoming HIV vtor. (h) W thn xamin th lat rstrition in th an PANC lls. Stal rh xprssion in an PANC lls ru th proution of HIV, ut not SIVma. (i) W ompar th lvls of rh xprssion in th staly rhxprssing ll lins. 6. ng of ll lysats wr analyz y immunolotting with antiha an antiβatin antiois. Th apparnt lvls of rh protin i not orrlat with thir aility to support th lat rstrition. (j) Th lvls of rh xprssion in th transintly transft 293T lls wr in xss of thos xprss in th stal.
7 Sakuma t al., Supplmntary Fig. 5 a HA HIVDsR vtor inftion βatin. %RFPpositiv Jurkat A3 #A #B #A #B Jurkat A3 SupT #A #B Early (Postntry) rstrition #A #B SupT MT4 #A #B RT5α#C #A #B MT4 RT5α#C HIV NL43 Titr () SIVmaA Titr () 3 3 #A #B Jurkat A3 Lat rstrition 6 6 #A #B SupT 6 6 #A #B RT5α#C MT4 Stal rh xprssion rsult in th lat rstrition in human Jurkat A3 an MT4 lls. (a) W xamin if introution of rh oul support th lat rstrition in human T ll lins. W inft Jurkat A3, SupT an MT4 lls with a rtroviral vtor xprssing Ctrminally HAtagg rh from an MLV LTR. As a ontrol, w inft th lls with a xprssing rtroviral vtor. Following sltion unr th prsn of G48, w otain staly rh or xprssing ulk population lls. W thn otain singl ll lons y limiting ilution. Cll lysats from 4x lls wr us to onfirm th xprssion of rh protin. Th sam mmran was rpro for β Atin protin. () W xamin thir rsistan to a DsRxprssing HIV vtor. Th rhxprssing SupT an MT4 lls wr strongly rsistant to HIV inftion, whil rhxprssing Jurkat lls show wak postntry rstrition. () W xamin th lat rstrition in th T ll lons. lls wr transft with 5 μg of pnl43 or psivmaa y Gn Pulsr Xll ltroporation systm. W us th prst Jurkat transftion protool for th xprimnt. Two ays aftr transftion, ultur suprnatants wr harvst to trmin th viral titrs. Stal rh xprssion in th SupT an MT4 lls ru proution of HIV, ut not SIVma.
8 a RING BBox2 Coiloil B3.2(SPRY) Sakuma t al., Supplmntary Fig. 6 LKO# H3#2 H3#5 H4# H4#3 H4#4 H4#6 LKO# shrna: plkoh3 /2 /4 /8 /6 /32 /64 /28 plkoh4 NMLV inftion αtuulin plko H3#2 H3#5 H4#3 H4#4 % 5.9% 2.% 27.7% 2.5% knokown lons LKO# H4# H4#3 Ct Rh Es Ct Rh Es Ct Rh Es Ct Rh Es NL43 titrs () 6 Ct: pdna3. Rh: p Es: ph4esap f Ct Rh Es Ct Rh Es Ct Rh Es Ct Rh Es Ct Rh Es LKO# H4# H4#3 H4#4 knokown lons NL43 titrs from FrhK4 lls (μg) Homo sapins Chromosom Loation: p5 Maaa mulatta Chromosom 4 TRIM6TRIM34 TRIM6 TRIM22 ( ~ ) TRIM34 TRIMP TRIM5 ( ~ ) TRIM5 ( ~ ) TRIM22 ( ~ ) TRIM6TRIM34 putativ Cylophilin A Enognous human is not a ominant ngativ fator for th rhmiat lat rstrition in human lls. (a) On of th possil rasons why introution of rh os not la to th lat rstrition in som human lls is aus human lls may hav a fator whih inhiits th rh lat rstrition mahinry. As th first aniat, w xamin th influn of nognous human on th rhmiat lat rstrition in lls. In orr to stalish lons with stal knokown, w inft lls with VSVGpsuotyp HIV vtors arrying a rhspifi shrna (LKOH3 an LKOH4, Opn Biosystms) or ontrol LKO at a multipliity of inftion (MOI) of.. Following sltion in th prsn of puromyin, w otain singl ll lons. Th mrna lvls in th LKO, LKOH3 or LKOH4transu lons wr srn y RTPCR. Four LKOH4 lons show sustantially ru lvls of spifi signals. From th RTPCR rsults with srially ilut RT prouts, w stimat that th LKOH4 lons xprss approximatly ~3% of th normal lvl of mrna. () W hk thir rsistan to a VSVGpsuotyp, xprssing NMLV vtor (Bok t al., 2, J. Virol., kinly provi y Dr. J. Stoy). W slt thr lons, H4#, H4#3 an H4#4, whih xprss th lowst lvls of spifi mrna. () W also gnrat a shrnarsistant rhxprssing plasmi, ph4esap, y introuing silnt mutations ("TGCACTGTCTCATTCTTCAAT (CTVSFFN)" to "TGTACGGTAAGTTTTTTTAAT") in th shrna targt sit of p. W onfirm th rh protin xprssion in. Th sap mutant was mor rsistant to th shrna H4 in th knokown lons. () W otransft th rhxprssing plasmis along with pnl43. Two ays aftr transftion, th ultur suprnatants wr harvst an us to xamin th viral titrs. Enognous hu knokown as wll as introution of rhh4esap i not afft th viral proution. () Whn w otransft rhsus monky FrhK4 lls with pnl43 an, w foun no ffts. Colltivly, w onlu that human is not a ominant ngativ fator in th rhmiat lat rstrition in human lls. (f) Typ I intrfronrsponsiv TRIM5 an TRIM22 gns shar th nhanr rgion, suggsting similar transriptional rgulation of th two protins. W spulat that TRIM22 protin may play a rol in th miat lat rstrition.
9 a NLSCyp CypAining loop SIVma 85PVHAGPIAP PQPA.P.QQ 9 tat Sakuma t al., Supplmntary Fig. 7.E6 LTR gag propol vif vpr rv vpu nv nf LTR.E5.E4 NLSCA SIVmaCA.E3 Ct Rh Ct Rh Ct Rh NL43 NLSCA NLSCyp Rlativ strngth (jug from th titrs) SIV < T5α SIV T5α SIV = T5α SIV > T5α SIV < T5α SIV < T5α SIV < T5α SIV T5α.E8 SIVma A psivmaa p (μg)......e7.e6 Full lngth rhha.e5.e p (μg)..3. SIVma plasmi (μg) PrGag CA HIV NL43as mutants with SIVma apsi squns ar largly snsitiv to th lat rstrition. W ma pnlscyp, whih has th Cylophilin Aining loop squn rpla with th SIVma ountrpart (sam mutations sri y Kamaa t al., 26, Pro Natl Aa Si USA), y xtnsion PCR/loning. A HIV(SCA)noing onstrut was kinly provi y Dr. Soroski, an us as a tmplat to amplify th gag squn, whih susquntly lon into pnl43 (pnlsca) following two stps of xtnsion PCR/loning. To tst th ffts of CA mutations on th snsitivity to th rh lat rstrition, w otransft 293T lls with th proviral plasmi an p, an prou th HIV mutants in th prsn of rh. Similar to th prvious stuis, rh xprssion strongly ru th parntal NL43 titrs. rh xprssion ras th viral titrs from pnl43sca an pnl43scyp mor than fols, suggsting that NL43as mutants with SIVma apsi squns ar largly snsitiv to th lat rstrition. Th viral titrs from pnl SCA was lowr than parntal pnl43, suggsting that th SCA mutant has impair fitnss uring viral proution in 293T lls or inftion of GHOST lls. SIVmaA proution altrs th lvls of rh protin in prour lls. In th rhmiat arly (postntry) rstrition, apsi squns trmin viral susptiility to th rstrition (Strmlau t al., 24, Natur). In our original stuy (Sakuma t al., 27, Nat M), w show that SIVmaA an SIVagmtan wr mor rsistant to th rhmiat lat rstrition. Howvr, this os not nssarily iniat that SIVma Gag avois th lat rstrition through saping th intration with rh. In orr to tst th possiility that SIVma an saturat or lok th lat rstrition mahinry, w xamin if rh protin rstrits SIVma whn th SIVma proution is suoptimal. As shown in Fig. S7, SIVma am mor snsitiv to th lat rstrition whn lowr onntrations of SIVma plasmi wr otransft with p in 293T lls. Intriguingly, wiltyp SIVma proution altr th pattrns of rh signals aoring to wstrn lot analysis (Fig. S7). Unr th onitions whr SIVma titrs wr not afft y th rh (SIVma>rh), ru lvls of rh wr sn. Whn th viral proution was afft y rh (SIVma<rh), w saw normal an/or altr pattrns of rh signals. From th pattrns of signals, w spulat that th protin might gra y uiquitination. Although w n to prform furthr arful xprimnts, ths osrvations suggst that SIVma an rsist this rstrition y ountrating or saturating th lat rstrition mahinry, rathr than saping rognition y rh. It is intrsting to not that many viruss ar known to xprss viral protins, whih ountrat TRIM9miat antiviral ativitis y moifying/graing TRIM9 (Ch t al., 23, J. Virol. (HSV); Ullman t al., 27, J. Virol. (Anovirus); Blonl t al., 22, Onogn (Rais virus)). is a mmr of th vast family of TRIM protins with RBCC omains. Givn that svral TRIM protins ar known to uprgulat following viral inftion or intrfron tratmnt, it is possil that a sust of TRIM protins rprsnt a nw group of antiviral fators whih lok viral proution at a posttranslational stag. It is also onival that HIV has volv rtain stratgis to avoi/saturat/ountrat suh antiviral ativitis impos y human TRIM protins.
Supplementary Figures (1-6) Deletion of ADAM-9 in HGF/CDK4 mice impairs melanoma development and metastasis
Supplmntary Figurs (1-6) Dltion of ADAM-9 in HGF/CDK4 mic impairs mlanoma vlopmnt an mtastasis Nivs Giblr 1, Alxanr Schönfuß 1, Jnnifr Lansbrg #, Thomas Tüting, Cornlia Mauch an Paola Zigrino* A 25 * ADAM-9
More informationDigital Signal Processing Homework 7 Solutions in progress
Digital Signal Prossing Homwork 7 Solutions in progrss Du Wnsay 0 Novmbr 00 Problm 46 a, b, ) Fin th maximum valu of th magnitu of th frquny rspons ) Fin th pols an ros of H() f) Compar th minimum an maximum
More informationIdentification of Tim4 as a phosphatidylserine receptor. +Apoptotic thymocyte. +kat µg ml 1. Resident Thioglycollate.
Vol Novmr 7 oi:.8/natur67 Intifiation of Tim as a phosphatiylsrin rptor Masanori Miyanishi,, Kazutoshi Taa {, Masato Koik, Yasuo Uhiyama, Toshio Kitamura & Shigkazu Nagata,, In programm ll ath, a larg
More informationSupplementary Information
Supplmntary Information NMDA spiks nhan ation potntial gnration uring snsory input Luy M. Palmr, Aam S. Shai, Jams E. Rv, Harry L. Anrson, Ol Paulsn, Matthw E. Larkum Natur Nurosin: oi:1.138/nn.3646 1
More informationFerroptosis as a p53-mediated activity during tumour suppression
ARTICLE oi:1.138/natur14344 Frroptosis as a p53-miat ativity uring tumour supprssion L Jiang 1 *, Ning Kon 1 *, Tongyuan Li 1, Shang-Jui Wang 1, Tao Su 2,3, Hanina Hishoosh 2,3, Rihar Bar 1,2,3 & Wi Gu
More informationUtility of chemical shift - MRI for anterior mediastinal mature teratoma
R. MASUNO, t al : Chmial shift - MR imaging for miastinal matur tratoma 137 J. Tokyo M. Univ., 73 2 : 137-143, 2015 Utility of hmial shift - MRI for antrior miastinal matur tratoma Ryuhi MASUNO 1), Soihi
More informationNLRP4 negatively regulates type I interferon signaling by targeting the kinase TBK1 for degradation via the ubiquitin ligase DTX4
ngativly rgulats typ I intrfron signaling by targting th kinas for graation via th ubiquitin ligas Jun Cui 13,7, Yinyin Li 1,3,4,7, Liang Zhu 1, Dan Liu 5, Zhou Songyang 5, Hln Y Wang 1,3 & Rong-Fu Wang
More informationCoatomer LPAAT-γ Merge
DI: 1.138/n2273 Cotomr LPAAT-γ Mrg Tuuls (%) 1 5 < 5 nm 5~1nm 1~2nm 2~5nm >5nm 5~1nm < 5 nm 1~2nm 2~5nm >5nm 2 min 5 min 1 min 3 min < 5 nm 5~1nm 1~2nm 2~5nm >5nm < 5 nm 5~1nm 1~2nm 2~5nm >5nm Figur S1
More informationFunctionally relevant neutrophilia in CD11c diphtheria toxin receptor transgenic mice
Funtionally rlvant nutrophilia in CD11 iphthria toxin rptor transgni mi Anré P Tittl 1,5, Christoph Husr 1,5, Christina Ohligr 1, Chrystl Llanto 1, Simon Yona 2,4, Güntr J Hämmrling 3, Danil R Engl 1,
More informationnamib I A UnIVERSITY
r' namib I A UnIVERSITY OF SCIEnCE AnD TECHnOLOGY FACULTY OF MANAGEMENT SCIENCES DEPARTMENT MANAGEMENT QUALIFICATION: BACHELOR OF BUSINESSS QUALIFICATION CODE: BBAD/07BBMA COURSE CODE: BEM 711S LEVEL:
More information% of Nestin-EGFP (+) cells
8 7 6 3 Nestin CD % of Nestin-EGFP (+) ells 8 6 Nestin-EGFP Marge Nestin-EGFP Marge Expression levels of Expression levels of Tumorigeniity y stemness markers ifferentiation markers limiting ilution assay
More informationStriatum CA
Stritum Shnk3+/ mrna lvl (norm.) mrna lvl (norm.) NuN VTA Ehmt1 Ehmt2 Stritum Shnk3+/ Fluo. intnsity (norm.) Shnk3+/ Shnk3+/ NuN CA1 Fluo. intnsity (norm.) Shnk3+/ Shnk3+/ 1µm Ehmt2 DG Fluo. intnsity (norm.)
More informationPharmacy in Primary Care Safety Climate Report
Summry Shows your phrmy rsults in omprison with ll othr phrmis who hv omplt th survy t th tim of ownloing your rport Communition Working Conitions Lrship Tmwork this ftor ovrs: honst isussion twn tm mmrs
More informationFusarium vs. Soybean
Fusarium vs. Soyban Gnsata, a company which proucs soyban s for commrcial sal in Nbraska, is rsponing to th migration of Sun Dath Synrom (SDS) into Nbraska soyban fils. An infstation of SDS is far which
More informationEnzymatic Reaction Steps E + S ES ES* EP E + P
Enzymatic Raction Stps stp I stp II stp III stp IV E + S ES ES* EP E + P stp I stp II stp III stp IV binding of substrat (usually fast) formation of transition stat convrsion of transition stat to product
More informationREGRESSION ASSOCIATION VS. PREDICTION
BIOSTATISTICS WORKSHOP: REGRESSION ASSOCIATION VS. PREDICTION Sub-Saharan Africa CFAR mting July 18, 2016 Durban, South Africa Rgrssion what is it good for? Explor Associations Btwn outcoms and xposurs
More informationCOMPUTER EDUCATION TECHNIQUES, INC. (ASP.NET ) SA:
ASP.NET: Hns-on Introution In orr to lrn whih qustions hv n nswr orrtly? 1. Print ths pgs. 2. Answr th qustions. 3. Sn this ssssmnt with th nswrs vi:. FAX to (212) 967-3498. Or. Mil th nswrs to th following
More informationmch log height Counts GFP log height mch log height Counts GFP log height mch log height Counts high flux % Hist: 8.34 EBSS shctrl Counts
DOI:.8/n2886 mchrry-gfp-lc3 Autophgy Rportr: Autophgosom Autolysosom mchrry GFP LC3 mchrry GFP LC3 X ph >6. ph
More informationCattle Finishing Net Returns in 2017 A Bit Different from a Year Ago Michael Langemeier, Associate Director, Center for Commercial Agriculture
May 2017 Cattl Finishing Nt Rturns in 2017 A Bit Diffrnt from a Yar Ago Michal Langmir, Associat Dirctor, Cntr for Commrcial Agricultur With th xcption of May 2016, monthly fd cattl nt rturns wr ngativ
More informationRole of Bcl-2 family proteins in a non-apoptotic programmed cell death dependent on autophagy genes
Rol o amily protins in a non-apoptotic programm cll ath pnnt on autophagy gns Shigomi Shimizu 1,2,3, Toku Kanaski 4, Noboru Mizushima 4,5,6, Takshi Mizuta 1,3, Satoko Arakawa-Kobayashi 4, Craig B. Thompson
More informationTenascin-C is an endogenous activator of Toll-like receptor 4 that is essential for maintaining inflammation in arthritic joint disease
Tnasin-C is an nognous ativator o Toll-lik rptor 4 that is ssntial or maintaining inlammation in arthriti joint isas Kim Miwoo, Sanra Sar, Anna M Piinini, Julia Inglis, Anntt Traul,3, Emma Chan,3, Stan
More informationBipolar Transistors I
Bipolar Transistors I Pag 1 Bipolar Transistors I Th first tst of a transistor This la uss an NPN transistor, th. Lik any NPN transistor, it onsists of two PN juntions, as shown in Fig. 1 () a) ) ) Figur
More informationGentamicin Therapy Induced Functional Type VII Collagen in RDEB Patients Harboring Nonsense Mutations. David T. Woodley and Mei Chen
Gntamicin Thrapy Inuc Functional Typ VII Collagn in RDEB Patints Harboring Nonsns Mutations Davi T. Wooly an Mi Chn Dpartmnt of Drmatology, Univrsity of Southrn California, Los Angls, CA EB2017 Mting,
More informationTherapeutic activation of macrophages and microglia to suppress brain tumor-initiating cells
Thraputi ativation of marophags an miroglia to supprss brain tumor-initiating lls Susobhan Sarkar 1,, Axinia Döring 1,,6, Franz J Zmp 3,6, Clauia Silva 1,, Xuqing Lun 3, Xiuling Wang 3, John Klly 1,, Waltr
More informationJournal of Kerbala University, Vol. 7 No.1 Scientific. 2009
EFFECT Of SOME AMINO ACIDS, VITAMINS AND PLANT GROWTH REGULATORS ON MAINTENANCE AND LENGTH OF PLANTLETS DERIVED FROM IN VITRO CULTURE OF DATE PALM (Phonix atylifral.).cv.barh Kam Irahm Aas Ahm Aulla Saa
More informationList 3 ways these pictures are the same, and three ways they are different.
List 3 ways ths picturs ar th sam, and thr ways thy ar diffrnt. Human Nuron Comptition i i i i Follow dirctions on th sht in Bindr. 1. Mak Storyboard today and all plans to show nuron firing 2. Monday
More informationAlternate Mount and Location for a Trolling Motor. Print in Landscape Mode with ¼ inch borders.
SIDE MOTOR MOUNT Drawn 09-15-2013 Altrnat Mount and Location for a Trolling Motor Rv. 09-21-2013 Print in Landscap Mod with ¼ inch bordrs. Th primary purpos of locating th trolling motor nxt to th oprator
More informationAlternate Mount and Location for a Trolling Motor. Print in Landscape Mode with ¼ inch borders.
SIDE MOTOR MOUNT Altrnat Mount and Location for a Trolling Motor Drawn 09-15-2013 Rv. 07-11-2016 Print in Landscap Mod with ¼ inch bordrs. Th primary purpos of locating th trolling motor nxt to th oprator
More informationCerebrovascular disease Defined from diagnosis ICD10: I60-69, ICD8:
Supplmntary Tabl 1: ICD cods Diagnoss, surgical procdurs, and pharmacothrapy usd for dfining th study population, comorbidity, and outcoms Study population Myocardial Infarction ICD8: 430 ICD10: I21-22
More informationVerification Analysis of Spread Footing
Vrifiation manual o. Upat 03/016 Vrifiation Analysis of Spra Footing Program: Fil: Spra Footing Dmo_vm_n_0.gpa In this vrifiation manual you will fin a han-ma vrifiation analysis of aring apaity of a spra
More informationFall 2005 Economics and Econonic Methods Prelim. (Shevchenko, Chair; Biddle, Choi, Iglesias, Martin) Econometrics: Part 4
Fall 2005 Economics and Econonic Mthods Prlim (Shvchnko, Chair; Biddl, Choi, Iglsias, Martin) Economtrics: Part 4 Dirctions: Answr all qustions. Point totals for ach qustion ar givn in parnthsis; thr ar
More informationTime Variation of Expected Returns on REITs: Implications for Market. Integration and the Financial Crisis
Tim Variation of Expctd Rturns on REITs: Implications for Markt Intgration and th Financial Crisis Author Yuming Li Abstract This articl uss a conditional covarianc-basd thr-factor pricing modl and a REIT
More informationNational Assessment in Sweden. A multi-dimensional (ad)venture
Challngs in Educational Masurmnt Contnt, Mthods and Consquncs Gothnburg, 12 Oct. 2016 National Assssmnt in Swdn A multi-dimnsional (ad)vntur Gudrun Erickson Univrsity of Gothnburg Dpt. of Education and
More information**** **** **** ** ***
Prnt totl popultion Prnt totl popultion 9 7 3 9 7 3 ELAV>UAS-52Q **** * *** **** **** ** *** **** EtOH DHT nm.5 μm 5 μm nm.5 μm 5 μm nm.5 μm 5 μm nm.5 μm 5 μm Mlofnmi i Tolfnmi i Flufnmi i Tri OK37>UAS-52Q
More informationPhenomenon the kinetic energy and the inertia material of the bodies
Phnomnon th kinti nrgy and th inrtia matrial of th bodis F. F. Mnd http://fmnauka.narod.ru/works.html mnd_fdor@mail.ru Abstrat In th artil is xamind physial natur of th inrtia of matrial tl. Good is known,
More informationChapter 12 Student Lecture Notes 12-1
Chaptr 1 Studnt Lctur Nots 1-1 Businss Statistics: A Dcision-Making Approach 6 th Edition Chaptr 1 Goodnss-of-Fit Tsts and Contingncy Analysis 005 Prntic-Hall, Inc. Chap 1-1 Chaptr Goals Aftr complting
More informationLETTERS. Foxp3-dependent programme of regulatory T-cell differentiation
Vol 5 15 Fbruary 27 doi:1.18/natur55 Foxp-dpndnt programm of rgulatory T-ll diffrntiation Mar A. Gavin 1 {, Jffry P. Rasmussn 1, Jason D. Fontnot 1, Valria Vasta 2, Vinnt C. Manganillo, Josph A. Bavo 2
More informationAN ANALYSIS OF TELEPHONE MESSAGES: MINIMIZING UNPRODUCTIVE REPLAY TIME
AN ANALYSIS OF TELEPHONE MESSAGES: MINIMIZING UNPRODUCTIVE REPLAY TIME Michal D. Fltwood, Danill L. Paig, Chris S. Fick, and Knnth R. Laughry, Sr. Dpartmnt of Psychology Ric Univrsity Houston, TX flt@ric.du
More informationQuestion Paper 16 and 17 November 2005
KEY SKILLS INFORMATION AND COMMUNICATION TECHNOLOGY Lvl 3 Lttings [KSI31] Qustion Ppr 16 n 17 Novmr 2005 WHAT YOU NEED This Qustion Ppr An Answr Covr Sht Ass to omputr, softwr n printr As to four t fils
More informationGoing Below the Surface Level of a System This lesson plan is an overview of possible uses of the
Titl Acknowldgmnts Ovrviw Lngth Curriculum Contxt Lsson Objctiv(s) Assssmnt Systms Thinking Concpt(s) Instructional Considrations Matrials Going Blow th Surfac Lvl of a Systm This lsson plan is an ovrviw
More informationBlind Estimation of Block Interleaver Parameters using Statistical Characteristics
Advancd Scinc and Tchnology Lttrs Vol.139 (FGC 2016), pp.51-56 http://dx.doi.org/10.14257/astl.2016.139.10 Blind Estimation of Block Intrlavr Paramtrs using Statistical Charactristics Jinwoo Jong 1, Youngkyun
More informationSUPPLEMENTARY INFORMATION
DOI: 1.138/n2633 Grllrt, Ptl t l. Supplmntry Figur 1 Plo1 Plk1 YTRYDCIGEGGFARCFRVK! YVRGRLLSKGGFAKCFEIS! LILELCEHKSLMELLRK! 3R VVLELCRRRSLLELHKR! hing plo1.s8 - plo1.s3 M17F Humniz (Enhn Bining) plo1.s9
More informationAvalon Desk with Hutch Assembly Instructions ITEM #
A. olt (0mm, / in) Assembly Instructions ITM # 705-70 hair Assembly HARWAR: PARTS LIST: Step Step. olt x pcs (5mm, / in). olt A A (75mm, in) Step Step. Washer. Lock Washer Allen Wrench x pc AUTION: Adult
More informationLETTERS NTURE Vol pril 2009 a cat-4 Tyr GTPCH TH DOP bas-1 D D VMT DT b Mol 1 Mol 2 D B E C F D nuron class 1 D nuron class 2 D nuron class 1 D
Vol 458 16 pril 2009 oi:10.1038/natur07929 Gn rgulatory logic of opamin nuron iffrntiation LETTERS Nuria Flams 1 & Olivr Hobrt 1 Dopamin signalling rgulats a varity of complx bhaviours, an fcts in opamin
More informationSupplemental Figure 1 Macrophages accumulate in CVU. (A) Immunohistochemistry staining
Supplmntal Information Sindrilaru t al. An unrtraind inflammatory M1 macrophag population inducd by iron impairs wound haling in humans and mic Supplmntal Figur 1 Macrophag accumulat in CVU. (A) Immunohistochmistry
More informationReliability Demonstration Test Plan
Rliability Dmonstration Tst Plan STATGRAPHICS Cnturion Rv. 6/7/04 Summary... Exampl... Analysis Window... Output... 4 Calculations... 5 Distributions... 5 Summary This procdur crats tst plans to dmonstrat
More informationAnalysis of piston behavior according to eccentricity ratio of disk in bent-axis type piston pump
Journal of Mhanial Sin an Thnology (8) 76~733 Journal of Mhanial Sin an Thnology www.springrlink.om/ontnt/738-494x DOI.7/s6-8-64-5 Analysis of piston bhavior aoring to ntriity ratio of isk in bnt-axis
More informationSupplementary information. MARCH8 inhibits HIV-1 infection by reducing virion incorporation of envelope glycoproteins
Supplementary information inhibits HIV-1 infection by reducing virion incorporation of envelope glycoproteins Takuya Tada, Yanzhao Zhang, Takayoshi Koyama, Minoru Tobiume, Yasuko Tsunetsugu-Yokota, Shoji
More informationb PolyA RNA-seq c RNA-seq read distribution FPKM
a Repliate 2 (FPKM) Poly+ RN-seq 14 1-2 R2 =.998 1-4 -4-2 1 1 14 Repliate 1 (FPKM) Repliate 2 (FPKM) Poly RN-seq 14 1-2 R2 =.996 1-4 1-4 1-2 14 Repliate 1 (FPKM) RN-seq rea istriution Intron 12% 14% Intergeni
More informationFinding Finding The For The For ces In A T ces In A russ Truss V? Next Contents
inin Th Th ors In Truss In this 19th ntury truss ri, th sizs of th iniviul mmrs r sin in proportion to th mnitus n hrtrs of th fors thy must rry. In this lsson, you will lrn th rphil thniqu for nlyzin
More informationRhesus monkey TRIM5a restricts HIV-1 production through rapid degradation of viral Gag polyproteins
monkey TRIM5a restricts HIV- production through rapid degradation of viral Gag polyproteins Ryuta Sakuma, Josh A Noser, Seiga Ohmine & Yasuhiro Ikeda Mammalian cells have developed diverse strategies to
More informationEpigenetic targeting of Hedgehog pathway transcriptional output through BET bromodomain inhibition
A r t i l s Epignti targting of Hdghog pathway transriptional output through BET bromodomain inhibition Yuji Tang 1,2, Shararh Gholamin 2, Simon Shubrt 1,2, Mind I Willardson 3, Alx L 4, Pratiti Bandopadhayay
More informationPHA Exam 1. Spring 2013
PHA 5128 Exam 1 Spring 2013 1 Antibiotics (5 points) 2 Body Wight/Pdiatrics (5 points) 3 Rnal Disas (10 points) 4 Aminoglycosids (5 points) 5 Amikacin (10 points) 6 Gntamicin (10 points) 7 Aminoglycosids
More informationTWO REFERENCE japollo LUNAR PARKING - ORBITS / T. P. TIMER. (NASA CR OR rmx OR AD NUMBER) OCTOBER 1965 GODDARD SPACE FLIGHT CENTER
x-543-55-399 * 1 TWO REFERENCE japollo LUNAR PARKING - ORBITS / I - -. -! BY T. P. TIMER,< CFSTI PRICE(S) $ c 4 (PAGES1 (NASA CR OR rmx OR AD NUMBER) 277 I (CATEGORY) ff 653 July 65 OCTOBER 1965,r ; I
More informationW e have previously found using confocal immunofluorescence. Hrs sorts ubiquitinated proteins into clathrin-coated microdomains of early endosomes
Hrs sorts ubiquitinat protins into clathrin-coat microomains of arly nosoms Camilla Raiborg*, Kristi G. Bach*, Davi J. Gillooly*, Ingr Hln Mashus, Espn Stang an Haral Stnmark* *Dpartmnt of Biochmistry,
More informationDistinctive Role of the ckit Receptor Tyrosine Kinase Signaling in Mammalian Melanocytes
ORIGINAL ARTICLE S rlat ontary on pag 945 Distintiv Rol of th Kit Rptor Tyrosin Kinas Signaling in Maalian Mlanoyts Vitali Alxv 1 an Kyonggun Yoon 1,2 Th Kit rptor plays a ritial rol in lanoyt physiology,
More informationInformation & Communication Technology
Unit Numr U3051252/KT3T Ky Skills Informtion & Communition Thnology Lvl 3 Mgzins 25 27 My 2005 Totl Mrks: 50 Tim: 1 hour 30 minuts (inluing ring tim) Mtrils rquir for xmintion This tst ppr A rturn sht
More informationSources of Productivity and Economic Growth in Latin America and the Caribbean,
Sourcs of Prouctivity an Economic Growth in Latin Amrica an th Caribban, 1990-2013 Anré Hofman Univrsity of Santiago in Chil 1 Clauio Aravna ECLAC an USACH Jorg Friman Univrsity of Santiago in Chil ABSTRACT
More informationSurvey shows participants positive to Gdansk conference
Survy shows participants positiv to Gdansk cfrnc Th 13 th Baltic Dvlopmnt Forum Summit and th Europan Commissi s 2 nd Annual Forum th EU Stratgy for th Baltic Sa Rgi was hld in Gdansk, Poland, 24-26 Octobr
More informationFuzzy-Neuro Control of an Exoskeletal Robot for Human Elbow Motion Support
Procings of th 2001 IEEE Intrnational Confrnc on Robotics & Automation Soul, Kora May 21-26, 2001 Fuzzy-Nuro Control of an Exoskltal Robot for Human Elbow Motion Support Kazuo Kiguchi *1, Shingo Kariya
More information17th AMC (C) 2 (D) 2 1 2
17th AC 8 2001 2 1. Cay ho cla i making a golf trohy. H ha to aint 300 iml on a golf ball. If it tak him 2 con to aint on iml, how many minut will h n to o hi job? (A) 4 (B) 6 (C) 8 (D) 10 (E) 12 2. I
More information1/28/18. DNA Replication. Watson and Crick. Double helix structure of DNA article in Nature
Rplication 2007-2008 Watson and Crick 19 articl in Natur Doubl hlix structur of It has not scapd our notic that th spcific pairing w hav postulatd immdiatly suggsts a possibl copying mchanism for th gntic
More informationA Method to Estimate Ball s State of Spin by Image Processing for Improving Strategies in the RoboCup Small-Size-Robot League
A Mtho to Estimat Ball s Stat of Spin by Imag Procssing for Improving Stratgis in th RoboCup Small-Siz-Robot Lagu Yuji Nunom, Kazuhito Murakami, Masahi Ito, Kunikazu Kobayashi an Taashi Narus Grauat School
More informationSEVERE HYPOXIA IMPAIRS LATERALIZATION IN A MARINE TELEOST FISH
First post onlin on 30 Octobr 2014 as 10.1242/jb.111229 J Exp Biol Avanc Accss Onlin th most Articls. rcnt vrsion First at post http://jb.biologists.org/lookup/oi/10.1242/jb.111229 onlin on 30 Octobr 2014
More informationChemometrics. Derivatives in Spectroscopy. Part I The Behavior of the Derivative. Howard Mark and Jerome Workman Jr.
Chmomtrics Drivativs in Spctroscopy Part I Th Bhavior of th Drivativ Howar Mark an Jrom Workman Jr. Jrom Workman Jr. srvs on th Eitorial Avisory Boar of Spctroscopy an is vic-prsint of rsarch for Argos
More informationNF-kB in breast cancer cells promotes osteolytic bone metastasis by inducing osteoclastogenesis via GM-CSF
7 Natur Pulishing Group http://www.natur.om/naturmdiin NF-kB in rast anr lls promots ostolyti on mtastasis y induing ostolastognsis via GM-CSF Ba Kun Park 1, Honglai Zhang 1, Qinghua Zng 1, Jinlu Dai,
More informationRudolf Huber GmbH ELECTROMAGNETIC TOOTH CLUTCHES
Rudolf Hubr GmbH ELECTROMAGNETIC TOOTH CLUTCHES Aubingrwg 41 82178 Puchhim Tl: +49 (0)89 89026426 Fax: +49 (0)89 89026427 www.mz-kupplungn.d info@hubr-prazisionsmchanik.d Elctromagntic tooth clutchs with
More informationMARIA PONEC, PH.D., SJAN LAVRIJSEN, M.D., JOHANNA KEMPENAAR, LOUIS HAVEKES, PH.D., AND JoHANNES BooNSTRA, PH.D.
22-22X555-4 76$2. T HE JOURNAl, 1' INVESTIGATIVE DERMATOLOG Y, 5:476-42, 195 Copyrigh t 195 y Th Williams & Wilkins Co. Vol. 5, No.5 Printd in U.S. A. SV 4-Transformd (SVK 14 ) and Normal Kratinoyts: Similarity
More informationMATH 1300: Finite Mathematics EXAM 1 15 February 2017
MATH 1300: Finit Mathmatics EXAM 1 15 Fbruary 2017 NAME:... SECTION:... INSTRUCTOR:... SCORE Corrct (A): /15 = % INSTRUCTIONS 1. DO NOT OPEN THIS EXAM UNTIL INSTRUCTED TO BY YOUR ROOM LEADER. All xam pags
More informationPRELIMINARY STUDY ON DISPLACEMENT-BASED DESIGN FOR SEISMIC RETROFIT OF EXISTING BUILDINGS USING TUNED MASS DAMPER
Not: this papr was not abl to b rviwd in accordanc with DEST rquirmnts. PRELIMINARY STUDY ON DISPLACEMENT-BASED DESIGN FOR SEISMIC RETROFIT OF EXISTING BUILDINGS USING TUNED MASS DAMPER Chang-Yu Chn 1
More informationPreferences for Government Enforcement of a Common Pool Harvest Quota: Theory and Experimental Evidence from Fishing Communities in Colombia
January 2012 Prfrncs for Govrnmnt Enforcmnt of a Common Pool Harvst Quota: Thory and Exprimntal Evidnc from Fishing Communitis in Colombia MARIA ALEJANDRA VELEZ * School of Managmnt Univrsidad d los Ands
More informationEXPERIMENT 4 DETERMINATION OF ACCELERATION DUE TO GRAVITY AND NEWTON S SECOND LAW
EXPERIMENT 4 DETERMINATION OF ACCELERATION DUE TO GRAVITY AND NEWTON S SECOND LAW I. Introduction. Thr ar two objctivs in this laboratory xrcis. Th first objctiv, (A), is th study of th bhavior of a body
More informationOr-Light Efficiency and Tolerance New-generation intense and pulsed light system
Or-Light Efficincy and Tolranc Nw-gnration intns and pulsd light systm Dr Patricia BERGER INTRODUCTION Th us of pulsd and intns light systms (polychromatic, non-cohrnt and non-focussd light) is a commonly
More informationProbability, Genetics, and Games
" Probability, Gntics, and Gams Hav you vr hard of gns? (W don t man th kind you war!) What color ar your ys? Can you curl your tongu? Your birth parnts gav you a uniqu st of gns that dtrmin such things.
More informationAnalysis of kinematic motion deviations of machining centers based on geometric tolerances
Bulltin of th JSME Journl of vn Mhnil Dsign, Sstms, n Mnufturing Vol.8, No.4, 4 nlsis of kinmti motion vitions of mhining ntrs bs on gomtri tolrns tsushi TKSI*, rt YOSID*, Wiroj TSN* Nobuhiro SUGIMUR*,
More informationsupplementary information
DOI: 10.1038/n1998 n!-tnin % rlt. mrna xprssion E-dhrin Vimntin pithlil msnhyml inv Cpn1 BXPC3 Cpn2 HPAF MiPC2 Pn1 diss d % rlt. xprssion MiPC2 E-dhrin x old inrs in E-dhrin % rlt. xprssion ontrol Pn1
More informationDocument downloaded from: This paper must be cited as:
Documnt ownloa from: http://hl.hanl.nt/151/4617 This papr must b cit as: Zotovic Stanisic, R.; Valra Frnánz, Á. (1. Ajusting th paramtrs of th mchanical impancfor vlocity, impact an forc control. Robotica.
More informationDISCUSSION ON THE TIMEFRAME FOR THE ACHIEVEMENT OF PE14.
SPORT NORTHERN IRELAND DISCUSSION ON THE TIMEFRAME FOR THE ACHIEVEMENT OF PE14. 1. PURPOSE OF PAPER 1.1 Th purpos of this papr is: to updat mmbrs on progrss that is bing mad in achiving Stratgy targt PE14
More informationARTICLES. Blockade of Dll4 inhibits tumour growth by promoting non-productive angiogenesis
Vol 444 21/28 Dmr 26 oi:1.138/ntur5355 Blok of Dll4 inhiits tumour growth y promoting non-proutiv ngiognsis Irn Nogur-Trois 1, Christophr Dly 1, Nihols J. Ppopoulos 1, Snr Cotz 1, Pt Boln 1, Nihols W.
More informationThermodynamic analysis of the actual air cycle refrigeration system
Availabl onlin at www.sindirt.om Systms Enginring Prodia (2) 2 6 2 Intrnational Confrn on Ris and Enginring Managmnt (REM) hrmodynami analysis of th atual air yl rfrigration systm Liu Shngjun a,b, Zhang
More informationA precise form of divisive suppression supports population coding in the primary visual cortex
A prcis form of ivisiv supprssion supports population coing in th primary visual cortx San P MacEvoy 1,2, Thomas R Tuckr 1,2 & Davi Fitzpatrick 1 Th rsponss of nurons in th primary visual cortx (V1) to
More informationP215 Cardiovascular System Blood Vessels Chapter 14 Introduction
P215 Cardiovascular Systm Blood Vssls Chaptr 14 Introduction vins tubs for blood flow lumn - for blood flow wall - Blood Flow Through Blood Vssls largst vins hart largst artris blood always containd by
More informationLETTER. A reserve stem cell population in small intestine renders Lgr5-positive cells dispensable
LETTER oi:10.1038/natur10408 A rsrv stm cll population in small intstin rnrs Lgr5-positiv clls ispnsabl Hua Tian 1, Brian Bihs 2, Sørn Warming 1, Kvin G. Long 3, Lina Rangll 4, Ophir D. Klin 2 & Frric
More informationThe Impact on Remote Maintenance of Varying the Aspect Ratio and Number of TF Coils for a Demonstration Fusion Power Plant
EUOFUSION WPM-CP(6) 5466 D Wolff t al. Th Impact on mot Maintnanc of Varying th Aspct atio an Numbr of TF Coils for a Dmonstration Fusion Powr Plant Prprint of Papr to b submitt for publication in Procings
More informationEarth Escape Trajectories Starting from L2 Point
Earth Escap Trajctoris Starting from L Point Masaki Nakamia (Soknai Univrsit), Hiroshi Yamakawa (AXA) Abstract Th L an L points of th Sun-Earth sstm, which ar locat about.5 million km awa from th Earth
More informationRetroviruses. ---The name retrovirus comes from the enzyme, reverse transcriptase.
Retroviruses ---The name retrovirus comes from the enzyme, reverse transcriptase. ---Reverse transcriptase (RT) converts the RNA genome present in the virus particle into DNA. ---RT discovered in 1970.
More informationPHA Case Study III (Answers)
PHA 5128 as Study III (Answrs) 1. TL is a 25 yar old mal who was admittd for a soft tissu infction in his abdomn. H is 5'10", 175 Ibs, WB 19, and BUN/Sr 12/1.1. Wound culturs ar positiv for Klbsilla pnumonia.
More informationEnergy spectral properties of the twin-cme driven shocks
Enrgy spctral proprtis of th twin-cme drivn shocks Xinjiang Astronomical Obsrvatory, Chins Acadmy of Scincs, Urumqi 83, China CAS Ky Laboratory of Solar Activity, NAOC, Bijing 2, China Ky Laboratory of
More informationELEC 353 Solution to Assignment #8. = mv, z. Vmax. = 0.285e = j0.1262
EEC 5 Solution to Assignmnt #8.An nginr nds to masur th impdan of an antnna at 450 MH. Th following masurmnts ar mad on a slottd lin, using th iruit shown abov. Th maximum voltag amplitud on th transmission
More informationHow HIV Causes Disease Prof. Bruce D. Walker
How HIV Causes Disease Howard Hughes Medical Institute Massachusetts General Hospital Harvard Medical School 1 The global AIDS crisis 60 million infections 20 million deaths 2 3 The screen versions of
More informationDr She Lok, Dr David Greenberg, Barbara Gill, Andrew Murphy, Dr Linda McNamara
Dr Sh Lok, Dr David Grnbrg, Barbara Gill, Andrw Murphy, Dr Linda McNamara This is a joint working projct btwn Mount Vrnon Cancr ntwork and Roch Products Ltd. 1 Introduction Dscrib th work that Mount Vrnon
More informationExistence of a microrna pathway in anucleate platelets
Existn of mirorna pthwy in nult pltlts Ptrii Lnry 1, Isll Plnt 1, Dominiqu L Oullt 1,3, Mrjori P Prron 1,3, Guy Roussu 2 & Ptrik Provost 1 hv ruil rol in th mintnn of hmostsis s wll s in thromosis n vssl
More informationA e C l /C d. S j X e. Z i
DESIGN MODIFICATIONS TO ACHIEVE LOW-BOOM AND LOW-DRAG SUPERSONIC CONCEPTUAL DESIGNS Danil. B. L Advisor: Prof. Jams C. McDanil Univrsity of Virginia, Charlottsvill, VA 94 NASA Mntor: Dr. Wu Li NASA Langly
More informationThe Federal Reserve has made significant
Nw Evidnc on th Output Cost of Fighting Inflation By Andrw J. Filardo Th Fdral Rsrv has mad significant progrss toward pric stability ovr th last two dcads. Th annual inflation rat has dclind from 13 prcnt
More informationSupplemental Materials and Methods Plasmids and viruses Quantitative Reverse Transcription PCR Generation of molecular standard for quantitative PCR
Supplemental Materials and Methods Plasmids and viruses To generate pseudotyped viruses, the previously described recombinant plasmids pnl4-3-δnef-gfp or pnl4-3-δ6-drgfp and a vector expressing HIV-1 X4
More informationGAL4 Mutations That Separate the Transcriptional Activation and GALSO- Interactive Functions of the Yeast GAL4 Protein
opyright 0 1990 y th Gntics Socity of Amrica GAL4 Mutations That Sparat th Transcriptional Activation an GALSO Intractiv Functions of th Yast GAL4 Protin John M. Salmron, Jr., Krstin K. Luthr an Stphn
More information13 th World Conference on Earthquake Engineering Vancouver, B.C., Canada August 1-6, 2004 Paper No. 3482
13 th World Confrnc on Earthquak Enginring Vancouvr, B.C., Canada August 1-6, 24 Papr No. 3482 A TUDY ON THE EIMIC ORCE REITING MECHANIM O A MULTI-TORY HEAR WALL YTEM CONIDERING THE INTERACTION BETWEEN
More informationThe relation between survival and expression of HER1 and HER2 depends on the expression of HER3 and HER4: a study in bladder cancer patients
British Journl of Cnr (26) 94, 173 179 & 26 Cnr Rsrh UK All rights rsrv 7 92/6 $3. www.jnr.om Th rltion twn survivl n xprssion of HER1 n HER2 pns on th xprssion of HER3 n HER4: stuy in lr nr ptints AA
More informationOptimize Neural Network Controller Design Using Genetic Algorithm
Procdings of th 7th World Congrss on Intllignt Control and Automation Jun 25-27, 28, Chongqing, China Optimiz Nural Ntwork Controllr Dsign Using Gntic Algorithm Aril Kopl, Xiao-Hua Yu Dpartmnt of Elctrical
More informationResearch into the effect of the treatment of the carpal tunnel syndrome with the Phystrac traction device
Rsarch into th ffct of th tratmnt of th carpal tunnl syndrom with th Phystrac traction dvic Rsarch carrid out in commission of: Fysiothrapi Cntrum Zuidwold By: Irn Kloostrman MA Octobr 2006 Forword This
More information