1/28/18. DNA Replication. Watson and Crick. Double helix structure of DNA article in Nature

Transcription

1 Rplication Watson and Crick 19 articl in Natur Doubl hlix structur of It has not scapd our notic that th spcific pairing w hav postulatd immdiatly suggsts a possibl copying mchanism for th gntic matrial. Watson & Crick 1

2 Dirctionality of You nd to numbr th carbons! it mattrs! P 4 nuclotid N bas This will b IMPRTANT!! 4 CH 2 ribos 1 H 2 Th backbon Putting th backbon togthr rfr to th and nds of th th last trailing carbon Sounds trivial, but this will b IMPRTANT!! P 4 CH 2 4 C P CH bas 1 bas 1 H 2 Anti-paralll strands Nuclotids in backbon ar bondd from phosphat to sugar btwn & carbons molcul has dirction complmntary strand runs in opposit dirction 2

3 Bonding in covalnt phosphodist r bonds hydrog n bonds.strong or wak bonds? AP How Biolo do th bonds fit th mchanism for copying? Bas pairing in Purins adnin (A) guanin (G) Pyrimidins thymin (T) cytosin (C) Pairing A : T 2 bonds C : G bonds Copying Rplication of bas pairing allows ach strand to srv as a tmplat for a nw strand nw strand is 1/2 parnt tmplat & 1/2 nw smi-consrvativ copy procss

4 Rplication Lt s mt th tam Larg tam of nzyms coordinats rplication Rplication: 1st stp Unwind hlicas nzym unwinds part of hlix I d lov to b hlicas & unzip your gns stabilizd by singl-strandd binding protins hlicas singl-strandd binding protins rplication fork Rplication: 2nd stp Build daughtr strand add nw complmntary bass polymras III Polymras III Whr s But th W r ENERGY missing somthing! for th What? bonding! 4

5 Enr of Rplication Whr dos for bonding usually com from? You rmmbr ATP! Ar thr Ar thr othr othr ways to gt nuclotid s? You out of bt! it? W com with our own! n r GT TT ATP CTP P modifid nuclotid And w lav bhind a nuclotid! AMP GMP TMP CMP ADP Enr of Rplication Th nuclotids arriv as nuclosids bass with P P P P-P-P = for bonding bass arriv with thir own sourc for bonding bondd by nzym: polymras III ATP GT P TT P CTP Rplication Adding bass can only add nuclotids to nd of a strand Polymras III Polymras III Polymras III nd a startr nuclotid to Polymras III bond to strand only grows B.Y.. ENERGY! Th ruls th procss

6 nd primr bass to add on to no to bond ligas Lading & Lagging strands Limits of polymras III can only build onto nd of an xisting strand rplication fork kazaki fragmnts ligas kazak i Lagging strand Lading strand Lagging strand kazaki fragmnts joind by ligas spot wldr nzym polymras III Lading strand continuous synthsis Rplication fork / Rplication bubbl polymras III lading strand lagging strand rplication fork lagging strand lading strand lading strand lagging strand rplication fork 6

7 Starting synthsis: RNA primrs Limits of polymras III can only build onto nd of an xisting strand rplication fork polymras III primas RNA RNA primr built by primas srvs as startr squnc for polymras III Rplacing RNA primrs with polymras I rmovs sctions of RNA primr and rplacs with nuclotids polymras I rplication fork ligas RNA But polymras I still can only build onto nd of an xisting strand Chromosom rosion All polymrass can only add to nd of an xisting strand polymras I Houston, w hav a problm! rplication fork polymras III RNA Loss of bass at nds in vry rplication chromosoms gt shortr with ach rplication AP limit Bioloto numbr of cll divisions? 7

8 Rpating, non-coding squncs at th nd of chromosoms = protctiv cap Tlomrs limit to ~0 cll divisions rplication fork tlomras Tlomras nzym xtnds tlomrs can add bass at nd diffrnt lvl of activity in diffrnt clls high in stm clls & cancrs -- Why? TTAAGGGTTAAGGGTTAAGGG Rplication fork polymras III polymras I kazaki primas ligas fragmnts SS B lading strand lagging strand polymras III hlicas dirction of rplication SSB = singl-strandd binding protins polymrass polymras III 1000 bass/scond! main buildr polymras I 20 bass/scond diting, rpair & primr rmoval polymras III nzym Thomas Kornbrg?? Arthur Kornbrg 199 8

9 Editing & proofrading 1000 bass/scond = lots of typos! polymras I proofrads & corrcts typos rpairs mismatchd bass rmovs abnormal bass rpairs damag throughout lif rducs rror rat from 1 in 10,000 to 1 in 100 million bass Fast & accurat! It taks E. coli <1 hour to copy million bas pairs in its singl chromosom divid to form 2 idntical daughtr clls Human cll copis its 6 billion bass & divid into daughtr clls in only fw hours rmarkably accurat only ~1 rror pr 100 million bass ~0 rrors pr cll cycl What dos it rally look lik?

10 Any Qustions??