The Role of CD4 + T Cells in Biphasic Hind Limb Paralysis Induced by the D Variant of Encephalomyocarditis Virus (EMC-D) in DBA/2 Mice
|
|
- Erik Rogers
- 5 years ago
- Views:
Transcription
1 Note Exp. Anim. 53(1), 31 35, 2004 The Role of CD4 + T Cells in Biphasic Hind Limb Paralysis Induced by the D Variant of Encephalomyocarditis Virus (EMC-D) in DBA/2 Mice Makio TAKEDA 1), Ryoichi OHTSUKA 1, 2), Yumi NAKAYAMA 2), and Kunio DOI 2) 1) Institute of Environmental Toxicology, Uchimoriya 4321, Mitsukaido, Ibaraki , and 2) Department of Veterinary Pathology, Faculty of Agriculture, The University of Tokyo, Yayoi, Bunkyo-ku, Tokyo , Japan Abstract: DBA/2 CrSlc mice infected with the D variant of encephalomyocarditis virus (EMC-D) (10 PFU/head) developed biphasic hind limb paralysis due to spinal cord lesion. The early phase lesion was characterized by demyelination with infiltration of macrophages in the funiculus lateraris and the late phase lesion by degeneration of motor neurons with infiltration of CD4 + T cells in the cornu ventrale (Takeda et al., Int. J. Exp. Pathol., 1993, 1995). In the present study, treatment with anti-mac1 monoclonal antibody (MAb) or anti- CD4 MAb prior to virus infection (-3 to -1 days) reduced the early phase lesion and the incidence of the first paralysis. Signals of viral RNAs were observed only in a few oligodendrocytes in the funiculus lateraris. Treatment with anti-cd4 MAb from 31 to 33 days post infection when mice showed recovery from the first paralysis reduced the late phase lesion and prevented the second paralysis. Signals of viral RNAs were still detected in a few degenerated neurons in the cornu ventrale. These results indicate that while macrophages and CD4 + T cells participate in the early phase lesion and paralysis and only CD4 + T cells in the late phase lesion and paralysis. Key words: CD4 + T cells, EMC-D, mouse spinal cord lesion We first reported that DBA/2 CrSlc mice inoculated with a low dose of the D variant of encephalomyocarditis virus (EMC-D) (10 PFU/head) developed biphasic hind limb paralysis [14]. Briefly, about 60% of the infected mice developed hind limb paralysis by 12 days post infection (DPI), twothirds of them showed recovery by 33 DPI, and 30% of the mice which had shown recovery developed paralysis again by 56 DPI. The character of this disease is biphasic spinal cord lesions. The degree of lesion is most prominent in the lumbar spinal cord. The lesion in the early phase is characterized by demyelination associated with infiltration of macrophages in the funiculus lateraris and that in the late phase by degeneration of motor neurons associated with infiltration of CD4 + T cells in the cornu ventrale. The virus titer of the spinal cord peaked at 7 DPI, decreased thereafter, and could no longer be detected even in paralysed mice at 28 DPI. We clarified using an in situ (Received 14 April 2003 / Accepted 6 August 2003) Address corresponding: K. Doi, Department of Veterinary Pathology, Graduate School of Agricultural and Life Sciences, The University of Tokyo, Yayoi, Bunkyo-ku, Tokyo , Japan
2 32 M. TAKEDA, ET AL. hybridization method that viral RNAs were observed in oligodendrocytes around demyelinated lesions with infiltration of macrophages in the early phase while they were observed in degenerated motor neurons with infiltration of CD4 + T cells in the late phase [15]. The aim of this study was to clarify the role of macrophages and especially CD4 + T cells in the development of spinal cord lesions and hind limb paralysis in DBA/2 mice infected with EMC-D using anti-mac1 and anti-cd4 monoclonal antibodies (MAb). The protocol of this study was approved by the Animal Care and Use Committee of Graduate School of Agricultural and Life Sciences, The University of Tokyo. One hundred and ten 8-week-old DBA/2 male mice were obtained from Charles River Japan Inc. (Kanagawa). The mice were housed in an animal room at a temperature of 23 ± 2 C with a relative humidity of 55 ± 5%, and fed MF pellets (Oriental Yeast Co., Ltd., Tokyo) and water ad libitum. EMC-D was kindly provided by Dr. J. W. Yoon [17], and anti-mac1 and anti-cd4 MAbs were prepared using hybridoma cell lines obtained from the American Type Culture Collection (Rockville, MO, USA). The mice were randomly divided into two groups, group A (35 mice) for the study of early lesion, and group B (75 mice) for the study of late lesion. Group A was further divided into 4 groups. Namely, 10 mice were treated intraperitoneally (i.p.) with 0.5 mg of anti- CD4 MAb three times (on days -3, -2 and -1) prior to virus infection (10 PFU/head) (A-1), and 10 mice were similarly treated with 0.5 mg of anti-mac1 MAb (A-2). Ten mice were inoculated i.p. with virus (10 PFU/head) alone as positive controls (A-3), and 5 mice were inoculated i.p. with 0.1 ml of PBS as negative controls (A-4). At 7 DPI, surviving mice were sacrificed by exsanguination under ether anesthesia. In group B, 70 mice were inoculated i.p. with EMC- D (10 PFU/head), and were checked for the sequence of clinical signs. Another 5 mice were inoculated i.p. with 0.1 ml of PBS as negative controls (B-4). Fifty surviving mice, showing recovery from clinical signs at 31 DPI were further divided into 3 groups. Fifteen mice were treated i.p. with 0.5 mg of anti-cd4 MAb three times (on 31, 32 and 33 DPI) (B-1), and 15 mice were treated with anti-mac1 MAb (B-2) in the same way. The remaining 20 mice were not treated with MAb and checked for further sequence of clinical signs as positive controls (B-3). At 51 DPI, all mice were sacrificed by exanguination under ether anesthesia. At autopsy, spleen cells of 5 randomly selected infected mice and 5 positive control mice were assayed with a fluorescence-activated cell sorter. More than 95% of MAb target cells were depleted in comparison with positive controls. During the experimental period, clinical signs and mortality were checked daily. In the spinal cord of EMC-D-infected mice, the lumbar spinal cord is most prominently affected as mentioned above [13]. Therefore, at autopsy, the lumbar spinal cords were fixed in 4% paraformaldehyde, and coronal paraffin sections of 4 µm were made. For histopathological observations, some of these sections were stained with hematoxylin and eosin (HE). In addition, 10-µm cryostat sections of small pieces of the fresh lumbar spinal cord were stained by the avidin-biotin-peroxidase complex (ABC) method using Vectastain Elite ABC kit (Vector Lab., Inc., USA). The primary antibodies used were as follows:monoclonal anti-mac1 (macrophage) rabbit IgG (Boehringer Mannheim Yamanouchi, Tokyo, Japan), monoclonal anti-l3t4 (CD4 + T cell) rabbit IgG (Biosys, Compiegne, France) and monoclonal anti-lyt2 (CD8 + T cell) rabbit IgG (Biosys). To detect viral RNAs, in situ hybridization was performed on paraffin sections of the lumbar spinal cord as described in a previous paper [14]. The crna probe for genome of EMC-D using in this experiment was 800 bases long and complementary to the structural proteins VP3-VP1, and was labeled by digoxigenin using a DIG-RNA labeling kit (Roche Diagnostics, Tokyo). The specificity of this probe was confirmed by northern blot analysis and sequencing [15]. As shown in Table 1, two mice died and the remaining 5 out of 8 mice (62.5%) developed hind limb paralysis by 7 DPI in group A-3 (0+EMC-D). On the other hand, in both groups A-1 (anti-cd4 + EMC-D) and A-2 (anti-mac1 + EMC-D), 1 of 10 mice developed hind limb paralysis and no mice died by 7 DPI. There were no clinical signs in group A-4. In group B, hind limb paralysis was first seen in some mice at 3 DPI and its incidence peaked at 12 DPI (60%). Twenty mice had died by 21 DPI, and the 50 surviving mice recovered from clinical signs and appeared normal at 30 DPI. Thereafter, as shown in Table 2, hind limb paralysis recurred in 6 of 20 mice of group
3 CD4 + T CELLS AND EMC-D INFECTION 33 Table 1. Effects of monoclonal antibodies on the incidence of EMC-D-induced firstphase paralysis at 7 DPI Table 2. Effects of monoclonal antibodies on the incidence of EMC-D-induced secondphase paralysis at 51 DPI Group Incidence of paralysed mice (%) A-1 (anti-cd4 + EMC-D) 1/10 (10) A-2 (anti-mac 1 + EMC-D) 1/10 (10) A-3 (EMC-D) 5/8 (62.5) A-4 (PBS) 0/4 (0) Group Incidence of paralysed mice (%) B-1 (EMC-D + anti-cd4) 0/15 (0) B-2 (EMC-D + anti-mac 1) 3/15 (20) B-3 (EMC-D) 4/15 (26.7) B-4 (PBS) 0/6 (0) B-3 (EMC-D +0) and 3 of 15 mice of group B-2 (EMC- D + anti-mac1) from 42 to 51 DPI. On the other hand, in group B-1 (EMC-D + anti-cd4), no mice developed the second hind limb paralysis. There were no clinical signs in group B-4 until 51 DPI. In group A, demyelination was seen in the funiculus lateralis in the spinal cords of mice showing the first hind limb paralysis. In group A-3, the lesions were severe and associated with infiltration of many anti- Mac1-positive macrophages (Fig. 1a) and a few anti-l3t4-positive CD4 + T cells. Signals of viral RNAs were observed in many oligodendrocytes in the lesion (Fig. 1b). On the other hand, in both group A-1 and group A-2, the lesions were minimal and not associated with mononuclear cell infiltration, and signals of viral RNAs were observed in only a few oligodendrocytes (Fig. 1c). There were no signals of viral RNAs in the spinal cords of mice of group A-4. In group B, in the spinal cord of 6 mice of group B-3 which exhibited the second hind limb paralysis, prominent infiltration of CD4 + T cells was found around degenerated motor neurons in the cornu ventrale at 51 DPI (Fig. 2a). In the funiculus lateralis, remyelination occurred in the previous demyelinated lesion as previously reported [14]. Lesions with similar characteristics and severity were also observed in the spinal cords of the 3 mice of group B-2 which exhibited the second hind limb paralysis. In the spinal cords of mice of group B-2 and group B-3 which showed the second hind limb paralysis, signals of viral RNAs were observed in a small number of degenerated motor neurons (Fig. 2b). On the other hand, in group B-1, a few degenerated neurons accompanying no mononuclear cell infiltration were observed, and a small number of signals of viral RNAs was observed in only a few motor neurons (Fig. 2c). There were neither spinal cord lesions nor signals of viral RNAs in group B-4. The mortality and the sequence of hind limb paraly- sis in EMC-D-infected mice observed in the present study were similar to those in our previous report [14]. In the early phase of the EMC-D-induced biphasic central nervous disease in DBA/2 mice, the treatment of anti-mac1 MAb or anti-cd4 MAb clearly reduced both demyelination in the funiculus lateralis and the incidence of hind limb paralysis. Macrophages and signals of viral RNAs in oligodendrocytes were also reduced. These results indicate that macrophages and CD4 + T cells play an important role in the development of demyelination in the funiculus lateralis and subsequent hind limb paralysis in addition to the direct effect of the virus on oligodendrocytes. In this regard, Sriram et al. [12] reported that treatment of anti-cd4 MAb prevented demyelination induced by EMC-M, and Topham et al. [16] reported that treatment of anti-cd4 MAb prevented encephalitis induced by EMC-M. On the other hand, Baek and Yoon [2, 3] and Hirasawa et al. [5 7] reported that macrophages, not T cells, played a crucial role in pancreatic β cell destruction in the early phase of EMC-D infection. The reason for this discrepancy is still obscure. Matsuzaki et al. [9] reported that EMC-D replicated first in the pancreas and then spread to the other organs. Furthermore, Craighead et al. [4] reported that phagocytosis of viral particles by macrophages led to picornavirus-induced immunity. Taking these reports into account, it seems reasonable to consider that, the mechanism/route of macrophage infiltration in the pancreas being different from that in the spinal cord, macrophage infiltration in the spinal cord might be concerned with CD4 + T cells. As reported in our previous papers [14, 15], in the present study, many macrophages and a few CD4 + T cells infiltrated the demyelinated lesions in the funiculus lateralis of mice infected with 10 PFU of EMC-D at 7 DPI, and mononuclear cell infiltration was reduced not only in mice treated with anti-mac1 MAb but also in mice treated with anti-cd4
4 34 M. TAKEDA, ET AL. Fig. 1. Funiculus lateraris of lumbar spinal cord at the early phase after EMC-D infection. (a) Many anti- Mac1-positive cells are seen (0+EMC-D group). Immunostaining, 120. (b) Signals of viral RNA are seen in many oligodendrocytes (0+EMC-D group). In situ hybridization, 120. (c) Signals of viral RNAs are seen in a few oligodendrocytes and there are no infiltrating cells (anti-mac1+e MC-D group). In situ hybridization, 120. Fig. 2. Cornu ventrale of lumber spinal cord at the late phase after EMC-D infection. (a) Many anti-cd4 + T cells are seen around degenerated motor neurons (0+EMC-Dgroup). Immunostaining, 150. (b) Signals of viral RNAs are seen in a small number of degenerated mortor neurons (arrowheads) surrounded by many mononuclear cells (0 +EMC-D group). In situ hybridization, 150. (c) Signals of viral RNAs are seen in a few motor neurons (arrowhead) and there are no infiltrating cells. In situ hybridization, 150. MAb. These findings suggest the possibility that the CD4 + T cells might be memory T cells and rule the activity of macrophages. Only treatment with anti-cd4 MAb prevented the second hind limb paralysis, although a small number of signals of viral RNAs was still detected in a few degenerated neurons in the cornu ventrale. In addition, as described in our previous report [14], there were many CD4 + T cells around the degenerated neurons bearing viral RNAs in the cornu ventrale of the spinal cord of mice developing the second phase hind limb paralysis in the present study. Taken together, these suggest that CD4 + T cells may recognize some signals from the surface of degenerated neurons in which viral RNAs remain, resulting in destruction of these neu- rons. Huber [8] reported that 70 kda heat shock protein (hsp 70) was expressed on cardiocytes infected with EMC-M and coxsackie virus B3 (CVB3) in vitro, and cytolytic T lymphocytes which belong to the CD4 population were detected in the mice infected with CVB3. Furthermore, it was reported that CD4 + T cells reacted cytotoxically to myelin by releasing tumor necrosis factor alpha (TNF-α) in experimental autoimmune encephalomyelitis mice [10, 11]. Taking these reports into account, we hypothesize that CD4 + T cells might act as memory T cells in the early phase lesion and as cytotoxic T cells in the late phase lesion. As mentioned above, EMC-D-induced biphasic central nervous disease is thought to be a virus-induced autoimmune disease in which CD4 + T cells play an
5 CD4 + T CELLS AND EMC-D INFECTION 35 important role in the pathogenesis. Therefore, we consider that this model offers a good experimental tool for investigating viral immunity. Recently it was reported that Lewis rats, on recovery from monophasic clinical experimental allergic encephalitis, were induced to develop repeated paralytic relapses following intraperitoneal administration of IL-12. However the characteristics and mechanisms of the spinal cord lesion seem to be different from those of the present model. References 1. Ahmed, Z., Gveric, D., Pryce, G., Baker, D., Leonard, J.P., and Cuzner, M.L Am. J. Pathol. 158: Baek, H.S. and Yoon, J.W J. Virol. 64: Baek, H.S. and Yoon, J.W Diabetes 40: Craighead, J.E., Huber, S.A., and Sriam, S Lab. Invest. 63: Hirasawa, K., Jun, H.S., Han, H.S., Zhang, M.D., Hollenberg, M.D., and Yoon, J.W J. Virol. 73: Hirasawa, K., Jun H.S., Maeda, K., Kawaguchi, Y., Itagaki, S., Mikami, T., Baek, H.S., Doi, K., and Yoon, J.W J. Virol. 71: Hirasawa, K., Tsutsui, S., Takeda, M., Mizutani, M., Itagaki, S., and Doi, K J. Gen. Virol. 77: Huber, S.A Lab. Invest. 67: Matsuzaki, H., Doi, K., Doi, C., Onodera, T., and Mitsuoka, T Exp. Anim. 38: Powell, M.B., Miychell, D., and Lederman, J Int. Immunol. 2: Ruddle, N.H., Bergman, C.M., and McGrath, K.M J. Exp. Med. 172: Sriram, S., Topham, D.J., Huang, S.K., and Rodriguez, M J. Virol. 63: Takeda, M., Hirasawa, K., and Doi, K J. Vet. Med. Sci. 53: Takeda, M., Itagaki, S., and Doi, K Int. J. Exp. Path. 74: Takeda, M., Miura, R., Shiota, K., Hirasawa, K., Lee, M. J., Itagaki, S., and Doi, K Int. J. Exp. Path. 76: Topham, D.J., Adesina, A., Shenoy, M., Craighead, J.E., and Sriram, S J. Virol. 65: Yoon, J.W., McClintock, P.R., Onodera, T., and Notokins, A.L J. Exp. Med. 152:
The pathogenesis of nervous distemper
Veterinary Sciences Tomorrow - 2004 The pathogenesis of nervous distemper Marc Vandevelde Canine distemper is a highly contagious viral disease of dogs and of all animals in the Canidae, Mustellidae and
More informationSupplementary Figure 1.
Supplementary Figure 1. Female Pro-ins2 -/- mice at 5-6 weeks of age were either inoculated i.p. with a single dose of CVB4 (1x10 5 PFU/mouse) or PBS and treated with αgalcer or control vehicle. On day
More informationExplain the laboratory diagnosis of Rabies?
Explain the laboratory diagnosis of Rabies? The standard test for rabies testing is dfa. This test has been thoroughly evaluated for more than 40 years, and is recognized as the most rapid and reliable
More informationBRIEF COMMUNICATION ANTIGENIC ANALYSIS OF JAPANESE ENCEPHALITIS VIRUS ISOLATED IN HOKKAIDO WITH MONOCLONAL ANTIBODIES
Title ANTIGENIC ANALYSIS OF JAPANESE ENCEPHALITIS VIRUS IS MONOCLONAL ANTIBODIES Author(s)OCHIAI, Kenichi; TAKASHIMA, Ikuo; HASHIMOTO, Nobuo CitationJapanese Journal of Veterinary Research, 37(1): 21-2
More informationDetection of Tissue Culture-Adapted Theiler's Virus RNA in
INFECTION AND IMMUNITY, Aug. 1982, p. 763-770 Vol. 37, No. 2 0019-9567/82/080763-08$02.00/0 Detection of Tissue Culture-Adapted Theiler's Virus RNA in Spinal Cord White Matter Cells Throughout Infection
More informationIKKα Causes Chromatin Modification on Pro-Inflammatory Genes by Cigarette Smoke in Mouse Lung
IKKα Causes Chromatin Modification on Pro-Inflammatory Genes by Cigarette Smoke in Mouse Lung Se-Ran Yang, Samantha Valvo, Hongwei Yao, Aruna Kode, Saravanan Rajendrasozhan, Indika Edirisinghe, Samuel
More informationThe Pathogenesis of Chlamydia pneumoniae in Multiple Sclerosis: Current Thoughts and Future Directions
The Pathogenesis of Chlamydia pneumoniae in Multiple Sclerosis: Current Thoughts and Future Directions Seminars in Pathology March 9, 2010 Charles W. Stratton, M.D. Features of C. pneumoniae Infection
More informationStudy of the main chemical components of Ganoderma lucidum
Study of the main chemical components of Ganoderma lucidum Yasuo Komota et al Tokyo Medical and Dental University [Purpose] As part of the means for exerting quality control on Ganoderma lucidum 50% ethanol
More informationStudy of the main chemical components of Ganoderma lucidum
Study of the main chemical components of Ganoderma lucidum Yasuo Komota et al Tokyo Medical and Dental University [Purpose] As part of the means for exerting quality control on Ganoderma lucidum 50% ethanol
More informationSupplementary Figure 1
Supplementary Figure 1 AAV-GFP injection in the MEC of the mouse brain C57Bl/6 mice at 4 months of age were injected with AAV-GFP into the MEC and sacrificed at 7 days post injection (dpi). (a) Brains
More informationRole of Tyk-2 in Th9 and Th17 cells in allergic asthma
Supplementary File Role of Tyk-2 in Th9 and Th17 cells in allergic asthma Caroline Übel 1*, Anna Graser 1*, Sonja Koch 1, Ralf J. Rieker 2, Hans A. Lehr 3, Mathias Müller 4 and Susetta Finotto 1** 1 Laboratory
More informationJOURNAL OF VIROLOGY, Oct. 1999, p Vol. 73, No. 10. Copyright 1999, American Society for Microbiology. All Rights Reserved.
JOURNAL OF VIROLOGY, Oct. 1999, p. 8541 8548 Vol. 73, No. 10 0022-538X/99/$04.00 0 Copyright 1999, American Society for Microbiology. All Rights Reserved. Prevention of Encephalomyocarditis Virus-Induced
More informationSUPPLEMENTARY METHODS
SUPPLEMENTARY METHODS Histological analysis. Colonic tissues were collected from 5 parts of the middle colon on day 7 after the start of DSS treatment, and then were cut into segments, fixed with 4% paraformaldehyde,
More informationThe roles of lymphotoxin and tumor necrosis factor-alpha in the pathogenesis of experimental allergic encephalomyelitis
Yale University EliScholar A Digital Platform for Scholarly Publishing at Yale Yale Medicine Thesis Digital Library School of Medicine 1993 The roles of lymphotoxin and tumor necrosis factor-alpha in the
More informationPhD thesis. The role of complement in Experimental Autoimmune Encephalomyelitis, the mouse modell of Multiple Sclerosis
PhD thesis The role of complement in Experimental Autoimmune Encephalomyelitis, the mouse modell of Multiple Sclerosis Nóra Terényi Supervisor: Prof. Anna Erdei Biology Doctorate School Immunology Program
More informationNature Medicine: doi: /nm.4322
1 2 3 4 5 6 7 8 9 10 11 Supplementary Figure 1. Predicted RNA structure of 3 UTR and sequence alignment of deleted nucleotides. (a) Predicted RNA secondary structure of ZIKV 3 UTR. The stem-loop structure
More informationCytotoxic Factor in Dengue Haemorrhagic Fever
Original Paper Med Principles Pract 1999;8:26 31 Received: October 1, 1997 Revised: February 23, 1998 U.C. Chaturvedi R. Agarwal A. Misra R. Mukerjee S. Kapoor R. Nagar Department of Microbiology, Lucknow,
More informationSupplementary Figures
Inhibition of Pulmonary Anti Bacterial Defense by IFN γ During Recovery from Influenza Infection By Keer Sun and Dennis W. Metzger Supplementary Figures d a Ly6G Percentage survival f 1 75 5 1 25 1 5 1
More informationBBS2711 Virology. Central Nervous System (CNS) Viruses. Dr Paul Young, Department of Microbiology & Parasitology.
BBS2711 Virology Central Nervous System (CNS) Viruses Dr Paul Young, Department of Microbiology & Parasitology. p.young@mailbox.uq.edu.au Viruses of the CNS Many human pathogenic viruses are capable of
More information2014 SEVPAC Case #63 (Slide ID: #1)
2014 SEVPAC Case #63 (Slide ID: #1) Tuskegee University College of Veterinary Medicine Dr. Ebony Gilbreath Tissues submitted to TUSVM diagnostic services for histopathology Puppies 4 weeks of age From
More informationEvaluation of Chromatin Clumping and Myelination of the Spinal Cord of Pigs with Congenital Tremor
Vet. Pathol. 12: 1-5 (1975) Evaluation of Chromatin Clumping and Myelination of the Spinal Cord of Pigs with Congenital Tremor C.H. LAMAR and D.C. VAN SICKLE School of Veterinary Medicine, Purdue University,
More informationTheiler s Murine Encephalomyelitis Virus-Induced CNS Autoimmunity
Theiler s Murine Encephalomyelitis Virus-Induced CNS Autoimmunity Virus-induced molecular mimicry is part of a mouse model of multiple sclerosis that is providing insights about the disease in humans Julie
More informationSupporting Information
Supporting Information Pang et al. 10.1073/pnas.1322009111 SI Materials and Methods ELISAs. These assays were performed as previously described (1). ELISA plates (MaxiSorp Nunc; Thermo Fisher Scientific)
More information3rd International Conference on Neurology & Therapeutics.
3rd International Conference on Neurology & Therapeutics www.neuroimmunology.ca Multiple sclerosis is a devastating disease The first description of the disease was mentioned in 14th century In 1838 Dr.
More informationSHORT COMMUNICATION. Human Papillomavirus Type 11 E1 Ú E4 and L1 Proteins Colocalize in the Mouse Xenograft System at Multiple Time Points
VIROLOGY 214, 259 263 (1995) SHORT COMMUNICATION Human Papillomavirus Type 11 E1 Ú E4 and L1 Proteins Colocalize in the Mouse Xenograft System at Multiple Time Points DARRON R. BROWN,*,,1 JANINE T. BRYAN,
More informationIMMUNOGENICITY OF FORMALDYDE INACTIVATED NEWCASTLE DISEASE VIRUS FIELD ISOLATE IN MATERNAL ANTIBODY FREE CHICKENS
IMMUNOGENICITY OF FORMALDYDE INACTIVATED NEWCASTLE DISEASE VIRUS FIELD ISOLATE IN MATERNAL ANTIBODY FREE CHICKENS Anak Agung Ayu Mirah Adi 1 *, IGusti Agung Arta Putra 2, Nyoman Mantik Astawa 3, I Made
More informationHYPERSENSITIVITY REACTIONS D R S H O AI B R AZ A
HYPERSENSITIVITY REACTIONS D R S H O AI B R AZ A HYPERSENSITIVITY REACTIONS Are exaggerated immune response upon antigenic stimulation Individuals who have been previously exposed to an antigen are said
More informationSUPPLEMENTARY FIG. S2. Representative counting fields used in quantification of the in vitro neural differentiation of pattern of dnscs.
Supplementary Data SUPPLEMENTARY FIG. S1. Representative counting fields used in quantification of the in vitro neural differentiation of pattern of anpcs. A panel of lineage-specific markers were used
More informationI.Tsunoda et al. Table 3 Three viral abilities determine neuropathogenesis Viral ability Mumps Rabies HTLV WNV TMEV Neurotropism Neurovirulence Neuroinvasiveness ZIKV adult mouse adult fetus? human fetus
More informationCNS pathology Third year medical students. Dr Heyam Awad 2018 Lecture 4: Myelin diseases of the CNS
CNS pathology Third year medical students Dr Heyam Awad 2018 Lecture 4: Myelin diseases of the CNS ILOS 1. to understand differences and similarities between diseases of myelin in CNS and PNS. 2. to understand
More informationLIST OF ORGANS FOR HISTOPATHOLOGICAL ANALYSIS:!! Neural!!!!!!Respiratory:! Brain : Cerebrum,!!! Lungs and trachea! Olfactory, Cerebellum!!!!Other:!
LIST OF ORGANS FOR HISTOPATHOLOGICAL ANALYSIS:!! Neural!!!!!!Respiratory:! Brain : Cerebrum,!!! Lungs and trachea! Olfactory, Cerebellum!!!!Other:! Spinal cord and peripheral nerves! Eyes, Inner ear, nasal
More informationProtection from avian influenza H5N1 virus infection with antibodyimpregnated
1 Protection from avian influenza H5N1 virus infection with antibodyimpregnated filters Yoichiro Kamiyama 1, Kazuhide Adachi 2, Ekowati Handharyani 3, Retno Damajanti Soejoedono 3, Takayuki Kusano 1, Marie
More informationRole of Nitric Oxide in the Pathogenesis of Encephalomyocarditis Virus-Induced Diabetes in Mice
JOURNAL OF VIROLOGY, Aug. 2009, p. 8004 8011 Vol. 83, No. 16 0022-538X/09/$08.00 0 doi:10.1128/jvi.00205-09 Copyright 2009, American Society for Microbiology. All Rights Reserved. Role of Nitric Oxide
More informationPrimary oligodendropathy is not a trigger of CNS autoimmunity
Primary oligodendropathy is not a trigger of CNS autoimmunity Ari Waisman Institute for Molecular Medicine University Medical Center, JGU Mainz 1 How is an anti-myelin immune response initiated? Secondary
More informationSupplemental Information. The Therapeutic Effect. of Anti-HER2/neu Antibody Depends. on Both Innate and Adaptive Immunity CONTENTS:
Cancer Cell, Volume 18 Supplemental Information The Therapeutic Effect of Anti-HER2/neu Antibody Depends on Both Innate and Adaptive Immunity SaeGwang Park, Zhujun Jiang, Eric D. Mortenson, Liufu Deng,
More informationParadoxic Effect of Anti-CD4 Therapy on Lacrimal Gland Disease in MKL/Mp-lpr/lpr Mice Douglas A. Jabs,* William H. Burns,^ and Robert A.
Paradoxic Effect of Anti-CD4 Therapy on Lacrimal Gland Disease in MKL/Mp-lpr/lpr Mice Douglas A. Jabs,* William H. Burns,^ and Robert A. Prendergast* Purpose. MKL/Mp-lpr/lpr mice (MRL/lpr) spontaneously
More informationExpression of acid base transporters in the kidney collecting duct in Slc2a7 -/-
Supplemental Material Results. Expression of acid base transporters in the kidney collecting duct in Slc2a7 -/- and Slc2a7 -/- mice. The expression of AE1 in the kidney was examined in Slc26a7 KO mice.
More informationSupplemental Materials for. Effects of sphingosine-1-phosphate receptor 1 phosphorylation in response to. FTY720 during neuroinflammation
Supplemental Materials for Effects of sphingosine-1-phosphate receptor 1 phosphorylation in response to FTY7 during neuroinflammation This file includes: Supplemental Table 1. EAE clinical parameters of
More informationJournal of Agricultural Technology 2012 Vol. 8(4): Journal of Agricultural
Journal of Agricultural Technology 2012 Vol. 8(4): 1389-1395 Journal of Agricultural Available Technology online http://www.ijat-aatsea.com 2012, Vol. 8(4): 1389-1395 ISSN 1686-9141 The effect of the decreased
More informationClass-Specific Antibody Response in Acyclovir- Treated and Adenine Arabinoside-Treated Patients with Primary Genital Herpes Simplex Virus Infection
Microbiol. Immunol., 39(10), 795-799, 1995 Class-Specific Antibody Response in Acyclovir- Treated and Adenine Arabinoside-Treated Patients with Primary Genital Herpes Simplex Virus Infection Takashi Kawana*,1,
More informationThe Immune System Preferentially Clears Theiler s Virus from the Gray Matter of the Central Nervous System
JOURNAL OF VIROLOGY, Nov. 1997, p. 8592 8601 Vol. 71, No. 11 0022-538X/97/$04.00 0 Copyright 1997, American Society for Microbiology The Immune System Preferentially Clears Theiler s Virus from the Gray
More informationDisease of Myelin. Reid R. Heffner, MD Distinguished Teaching Professor Emeritus Department of Pathology and Anatomy January 9, 2019
Disease of Myelin Reid R. Heffner, MD Distinguished Teaching Professor Emeritus Department of Pathology and Anatomy January 9, 2019 1 I HAVE NO CONFLICTS OF INTEREST OR DISCLOSURES TO DECLARE. I HAVE NO
More informationCharacterization of Ross River Virus Tropism and Virus-Induced Inflammation in a Mouse Model of Viral Arthritis and Myositis
JOURNAL OF VIROLOGY, Jan. 2006, p. 737 749 Vol. 80, No. 2 0022-538X/06/$08.00 0 doi:10.1128/jvi.80.2.737 749.2006 Copyright 2006, American Society for Microbiology. All Rights Reserved. Characterization
More informationIMMUNOHISTOCHEMICAL DISTRIBUTION OF ALPHA B-CRYSTALLIN IN THE CEREBELLUM OF DOGS INFECTED WITH CANINE DISTEMPER VIRUS
Acta Veterinaria Hungarica 56 (1), pp. 117 123 (2008) DOI: 10.1556/AVet.56.2008.1.12 IMMUNOHISTOCHEMICAL DISTRIBUTION OF ALPHA B-CRYSTALLIN IN THE CEREBELLUM OF DOGS INFECTED WITH CANINE DISTEMPER VIRUS
More informationIKK-dependent activation of NF-κB contributes to myeloid and lymphoid leukemogenesis by BCR-ABL1
Supplemental Figures BLOOD/2014/547943 IKK-dependent activation of NF-κB contributes to myeloid and lymphoid leukemogenesis by BCR-ABL1 Hsieh M-Y and Van Etten RA Supplemental Figure S1. Titers of retroviral
More informationPathogenesis of Cervical Myelopathy in Chronic Cervical Cord Compression Model of Rat
Pathogenesis of Cervical Myelopathy in Chronic Cervical Cord Compression Model of Rat Shigeru Kobayashi,MD,PhD 1, Masafumi Kubota, PT 1, Hisao Iwamoto, MD,PhD 2, Riya Kosaka,MD,PhD 3, Katsuhiko Hayakawa,MD,PhD
More informationeffect on the upregulation of these cell surface markers. The mean peak fluorescence intensity
SUPPLEMENTARY FIGURE 1 Supplementary Figure 1 ASIC1 disruption or blockade does not effect in vitro and in vivo antigen-presenting cell activation. (a) Flow cytometric analysis of cell surface molecules
More informationHISTOLOGICAL CHANGES IN THE BRAIN OF YOUNG FLUORIDE-INTOXICATED RATS
12 Fluoride Vol. 35 No. 1 12-21 2002 Research Report HISTOLOGICAL CHANGES IN THE BRAIN OF YOUNG FLUORIDE-INTOXICATED RATS YM Shivarajashankara, a AR Shivashankara, a P Gopalakrishna Bhat, b S Muddanna
More informationPerforin and Gamma Interferon-Mediated Control of Coronavirus Central Nervous System Infection by CD8 T Cells in the Absence of CD4 T Cells
JOURNAL OF VIROLOGY, Feb. 2004, p. 1739 1750 Vol. 78, No. 4 0022-538X/04/$08.00 0 DOI: 10.1128/JVI.78.4.1739 1750.2004 Copyright 2004, American Society for Microbiology. All Rights Reserved. Perforin and
More informationSupporting Information
Supporting Information Valkenburg et al. 10.1073/pnas.1403684111 SI Materials and Methods ELISA and Microneutralization. Sera were treated with Receptor Destroying Enzyme II (RDE II, Accurate) before ELISA
More informationPearson r = P (one-tailed) = n = 9
8F4-Specific Lysis, % 1 UPN1 UPN3 8 UPN7 6 Pearson r =.69 UPN2 UPN5 P (one-tailed) =.192 4 UPN8 n = 9 2 UPN9 UPN4 UPN6 5 1 15 2 25 8 8F4, % Max MFI Supplementary Figure S1. AML samples UPN1-UPN9 show variable
More informationDemyelinating Diseases: Multiple Sclerosis January 10, 2018 Dr. Ostrow
Demyelinating Diseases: Multiple Sclerosis January 10, 2018 Dr. Ostrow Reading: Robbins & Cotran, 9 th edition, pp 1283-1286 Robbins Basic Pathology, 9 th edition, 832-835 Overview: Grossly, myelin is
More informationSupplemental Information
Electronic Supplementary Material (ESI) for Food & Function. This journal is The Royal Society of Chemistry 2016 Supplemental Information Supplementary Materials and Methods Materials Assay kits of total
More informationSC-L-H shared(37) Specific (1)
A. Brain (total 2) Tissue-specific (2) Brain-heart shared (8) Specific (2) CNS-heart shared(68) Specific () Heart (total 4) Tissue-specific () B-L-H shared (37) specific () B. Brain (total 2) Tissue-specific
More informationSimultaneous blockade of PD-1 and VEGFR2 induces synergistic. Short title: Synergistic antitumour effect by dual blockade of PD-1 and VEGFR2
carticle Simultaneous blockade of PD-1 and VEGFR2 induces synergistic antitumour effect in vivo 1 Short title: Synergistic antitumour effect by dual blockade of PD-1 and VEGFR2 S. Yasuda 1, M. Sho 1, I.
More informationPotential Rebalancing of the Immune System by Anti-CD52 Therapy
Potential Rebalancing of the Immune System by Anti-CD52 Therapy Johanne Kaplan, PhD VP Neuroimmunology Research Genzyme March 26, 2013 RESTRICTED USE SEE TRAINING MEMO 2011 DO Genzyme NOT 1COPY Corporation
More informationSupplementary Information
Supplementary Information Title Degeneration and impaired regeneration of gray matter oligodendrocytes in amyotrophic lateral sclerosis Authors Shin H. Kang, Ying Li, Masahiro Fukaya, Ileana Lorenzini,
More informationulation of NK cells that retain the capability of expressing the HNK-1 differentiation antigen. Children with the Chediak-Higashi (CH)' syndrome,
RAPID PUBLICATIONS Natural Killer (HNK-1l) Cells in Chediak-Higashi Patients Are Present in Numbers but Are Abnormal in Function and Morphology TORu ABO, JOHN C. RODER, WATARU ABO, MAX D. COOPER, and CHARLES
More informationThe First Department of Bacteriology and Department of Tuberculosis, National Institute of Health, Kamiosaki, Shinagawa-ku, Tokyo 141
Japan. J. Med. Sci. Biol., 37, 97-104, 1984. DECREASED RESISTANCE TO MYCOBACTERIAL INFECTION IN MICE FED A TRICHOTHECENE COMPOUND (T-2 TOXIN) Koomi KANAI and Eiko KONDO The First Department of Bacteriology
More informationPRIMARY DISEASES OF MYELIN. By: Shifaa Al Qa qa
PRIMARY DISEASES OF MYELIN By: Shifaa Al Qa qa Most diseases of myelin are primarily white matter disorders??? Myelinated axons most diseases of CNS myelin do not involve the peripheral nerves to any significant
More informationAcute neurological syndromes
Acute neurological syndromes Assoc.Prof. Murat Sayan Kocaeli Üniversitesi, Rutin PCR Lab. Sorumlu Öğt.Üyesi Yakın Doğu Üniversitesi, DESAM Kurucu Öğrt. Üyesi sayanmurat@hotmail.com 0533 6479020 Medical
More informationSUPPLEMENTARY FIGURE 1
SUPPLEMENTARY FIGURE 1 A LN Cell count (1 ) 1 3 1 CD+ 1 1 CDL lo CD hi 1 CD+FoxP3+ 1 1 1 7 3 3 3 % of cells 9 7 7 % of cells CD+ 3 1 % of cells CDL lo CD hi 1 1 % of CD+ cells CD+FoxP3+ 3 1 % of CD+ T
More informationNature Neuroscience: doi: /nn Supplementary Figure 1. Splenic atrophy and leucopenia caused by T3 SCI.
Supplementary Figure 1 Splenic atrophy and leucopenia caused by T3 SCI. (a) Gross anatomy of representative spleens from control and T3 SCI mice at 28 days post-injury. (b and c) Hematoxylin and eosin
More informationSUPPLEMENTARY INFORMATION GENOTOXICITY. In vitro Genotoxicity Studies
SUPPLEMENTARY INFORMATION GENOTOXICITY In vitro Genotoxicity Studies The in vitro immortalisation (IVIM) assay relies on the induction of a survival advantage by insertional activation of cellular proto-oncogenes,
More informationRelevant Disclosures
6/18/215 Therapeutic developments for autoimmune demyelinating diseases: Musings from a MD (Mouse Doctor) Michael K. Racke, M.D. May 28, 215 Relevant Disclosures Editorial Boards for Journal of Neuroimmunology,
More informationSupplementary Fig. 1. Delivery of mirnas via Red Fluorescent Protein.
prfp-vector RFP Exon1 Intron RFP Exon2 prfp-mir-124 mir-93/124 RFP Exon1 Intron RFP Exon2 Untransfected prfp-vector prfp-mir-93 prfp-mir-124 Supplementary Fig. 1. Delivery of mirnas via Red Fluorescent
More informationDavid L. Bartlett, M.D. University of Pittsburgh
A Phase I Dose-Escalation Trial of vvdd- CDSR (Double-Deleted Vaccinia Virus Plus CD/SMR) Administered by Intratumoral Injection in Patients with Superficial Injectable Tumors David L. Bartlett, M.D. University
More informationNS1 Protein Expression in the JaOArS982 Strain of Japanese Encephalitis Virus Does Not Enhance Virulence in Mice
Tropical Medicine and Health Vol. 43 No.4, 2015, 233 237 doi: 10.2149/tmh.2015-27 Copyright 2015 by The Japanese Society of Tropical Medicine 233 Short Communications NS1 Protein Expression in the JaOArS982
More informationSupplementary Figure 1
Supplementary Figure 1 The average sigmoid parametric curves of capillary dilation time courses and average time to 50% peak capillary diameter dilation computed from individual capillary responses averaged
More informationEffects of beta 2 adrenergic agonists on axonal injury and mitochondrial metabolism in experimental autoimmune encephalomyelitis rats
Effects of beta 2 adrenergic agonists on axonal injury and mitochondrial metabolism in experimental autoimmune encephalomyelitis rats Z.W. Zhang 1,2, X.Y. Qin 1, F.Y. Che 2, G. Xie 2, L. Shen 2 and Y.Y.
More informationAvian encephalomyelitis (AE) Epidemic tremor. Dr./ Wafaa Abd El-ghany Assistant Professor of poultry dis., Fac. Vet. Med., Cairo Univ.
Avian encephalomyelitis (AE) Epidemic tremor Dr./ Wafaa Abd El-ghany Assistant Professor of poultry dis., Fac. Vet. Med., Cairo Univ. Definition Avian encephalomyelitis (AE) is a viral infection affecting
More informationTerminology. Terminology. Terminology. Terminology. Terminology. Bromodeoxyuridine
Kateřina Náměstková, Zuzana Šimonová, Eva Syková Behavioural Brain Research Bromodeoxyuridine : Doublecortin : DCX Glial Fibrillary Acidic Protein : GFAP Trace eye blink conditioning 1 Volume 163 : pp.
More informationISOLATION OF A SARCOMA VIRUS FROM A SPONTANEOUS CHICKEN TUMOR
ISOLATION OF A SARCOMA VIRUS FROM A SPONTANEOUS CHICKEN TUMOR Shigeyoshi ITOHARA, Kouichi HIRATA, Makoto INOUE, Masanori Veterinary Pathology, Faculty of Agriculture, Yamaguchi University* HATSUOKA, and
More informationEosinophilic Substance is Not Amyloid in the Mouse Nasal Septum
Vet Pathol 44:796 802 (2007) Eosinophilic Substance is Not Amyloid in the Mouse Nasal Septum T. DOI, Y. KOTANI, H. KOKOSHIMA, T. KANNO, Y. WAKO, AND M. TSUCHITANI Mitsubishi Chemical Safety Institute Ltd.,
More informationBrief Definitive Report
Published Online: 1 May, 1988 Supp Info: http://doi.org/10.1084/jem.167.5.1749 Downloaded from jem.rupress.org on January 6, 2019 Brief Definitive Report VIRUS-TRIGGERED IMMUNE SUPPRESSION IN MICE CAUSED
More informationBone marrow-derived mesenchymal stem cells improve diabetes-induced cognitive impairment by
Nakano et al. Supplementary information 1. Supplementary Figure 2. Methods 3. References Bone marrow-derived mesenchymal stem cells improve diabetes-induced cognitive impairment by exosome transfer into
More informationSupplementary Figure 1. Prevalence of U539C and G540A nucleotide and E172K amino acid substitutions among H9N2 viruses. Full-length H9N2 NS
Supplementary Figure 1. Prevalence of U539C and G540A nucleotide and E172K amino acid substitutions among H9N2 viruses. Full-length H9N2 NS nucleotide sequences (a, b) or amino acid sequences (c) from
More informationChemokine Regulation of Oligodendrocyte Development in the Spinal Cord. Bob Avino Saint Louis University Senior Honors Thesis April 19, 2011
Chemokine Regulation of Oligodendrocyte Development in the Spinal Cord Bob Avino Saint Louis University Senior Honors Thesis April 19, 2011 Richard J. Miller, PhD Northwestern University Feinberg School
More informationProtection against doxorubicin-induced myocardial dysfunction in mice by cardiac-specific expression of carboxyl terminus of hsp70-interacting protein
Protection against doxorubicin-induced myocardial dysfunction in mice by cardiac-specific expression of carboxyl terminus of hsp70-interacting protein Lei Wang 1, Tian-Peng Zhang 1, Yuan Zhang 2, Hai-Lian
More informationMacrophage Apoptosis in the Central Nervous System in Experimental Autoimmune Encephalomyelitis
Macrophage Apoptosis in the Central Nervous System in Experimental Autoimmune Encephalomyelitis Kim B. Nguyen, Pamela A. McCombe and Michael P. Pender Abstract Using light and electron microscopy, we have
More informationSupplementary Materials
Supplementary Materials Fig. S1. Weights of full-dose treatment groups comparing 1 st, 2 nd, and 3 rd generation gene replacement therapy. Mice were treated at p1 with 4x10 11 GC of the three different
More informationSupplementary Appendix
Supplementary Appendix This appendix has been provided by the authors to give readers additional information about their work. Supplement to: Tavakoli NP, Wang H, Dupuis M, et al. Fatal case of deer tick
More informationMicrotubule Teardrop Patterns
Supporting Information Microtubule Teardrop Patterns Kosuke Okeyoshi 1, Ryuzo Kawamura 1, Ryo Yoshida 2, and Yoshihito Osada 1 * 1 RIKEN Advanced Science Institute, 2-1 Hirosawa, Wako-shi, Saitama 351-0198,
More informationAcute lung injury in children : from viral infection and mechanical ventilation to inflammation and apoptosis Bern, R.A.
UvA-DARE (Digital Academic Repository) Acute lung injury in children : from viral infection and mechanical ventilation to inflammation and apoptosis Bern, R.A. Link to publication Citation for published
More informationThe GDVII Strain of Theiler s Virus Spreads via Axonal Transport
JOURNAL OF VIROLOGY, July 1999, p. 6093 6098 Vol. 73, No. 7 0022-538X/99/$04.00 0 Copyright 1999, American Society for Microbiology. All Rights Reserved. The GDVII Strain of Theiler s Virus Spreads via
More informationNature Medicine: doi: /nm.3922
Title: Glucocorticoid-induced tumor necrosis factor receptor-related protein co-stimulation facilitates tumor regression by inducing IL-9-producing helper T cells Authors: Il-Kyu Kim, Byung-Seok Kim, Choong-Hyun
More informationProgress Report for NJCSCR (Yu-Wen Chang)
Progress Report for NJCSCR (Yu-Wen Chang) Overall Plan Summary: Traumatic injury to the spinal cord initiates a cascade of degenerative processes, known as secondary injury, which include various inflammatory
More informationSupplementary methods:
Supplementary methods: Primers sequences used in real-time PCR analyses: β-actin F: GACCTCTATGCCAACACAGT β-actin [11] R: AGTACTTGCGCTCAGGAGGA MMP13 F: TTCTGGTCTTCTGGCACACGCTTT MMP13 R: CCAAGCTCATGGGCAGCAACAATA
More informationINTRABULBAR INOCULATION OF JAPANESE ENCEPHALITIS VIRUS TO MICE
THE KURUME MEDICAL JOURNAL Vol. 15, No. 1, 1968 INTRABULBAR INOCULATION OF JAPANESE ENCEPHALITIS VIRUS TO MICE TOSHINORI TSUCHIYA Department of Microbiology, and Department of Ophthalmology, Kurume University
More informationSupporting Information
Supporting Information Desnues et al. 10.1073/pnas.1314121111 SI Materials and Methods Mice. Toll-like receptor (TLR)8 / and TLR9 / mice were generated as described previously (1, 2). TLR9 / mice were
More informationReceptor-interacting Protein Kinases Mediate Necroptosis In Neural Tissue Damage After Spinal Cord Injury
Receptor-interacting Protein Kinases Mediate Necroptosis In Neural Tissue Damage After Spinal Cord Injury Haruo Kanno, M.D., Ph.D., Hiroshi Ozawa, M.D., Ph.D., Satoshi Tateda, M.D., Kenichiro Yahata, M.D.,
More informationA Central Role for CD4 T Cells and RANTES in Virus-Induced Central Nervous System Inflammation and Demyelination
JOURNAL OF VIROLOGY, Feb. 2000, p. 1415 1424 Vol. 74, No. 3 0022-538X/00/$04.00 0 Copyright 2000, American Society for Microbiology. All Rights Reserved. A Central Role for CD4 T Cells and RANTES in Virus-Induced
More informationE, Ixperimental allergic encephalomyelitis
Experimental allergic optic neuritis in guinea pigs: preliminary report Narsing A. Rao, Mark O. M. Tso," and Lorenz E. Zimmerman An experimental model for acute allergic optic neuritis was produced in
More informationLa risposta immune all infezione da virus ebola. Chiara Agrati, PhD
La risposta immune all infezione da virus ebola Chiara Agrati, PhD Pathogenetic mechanisms This virus infection is able to: - disable the immune system, preventing an effective protective immune response
More informationDepartment of Virology III, National Institute of Infectious Diseases, Tokyo ; and 2
Jpn. J. Infect. Dis., 64, 499-505, 2011 Original Article Receptor-Independent Infection by Mutant Viruses Newly Isolated from the Neuropathogenic Mouse Hepatitis Virus srr7 Detected through a Combination
More informationCancer model Liver metastasis I
Cancer model Liver metastasis I H. Suemizu, M. Monnai, Y. Ohnishi, M. Ito, N. Tamaoki, and M. Nakamura. 2007. Identification of a key molecular regulator of liver metastasis in human pancreatic carcinoma
More informationFood and drug reactions and anaphylaxis
Food and drug reactions and anaphylaxis A clinical analysis of gelatin allergy and determination of its causal relationship to the previous administration of gelatin-containing acellular pertussis vaccine
More information