Surface expression of MPT64 as a fusion with the PE domain of PE_PGRS33 enhances BCG

Transcription

1 IAI Accepts, published online ahead of print on 4 October 2010 Infect. Immun. doi: /iai Copyright 2010, American Society for Microbiology and/or the Listed Authors/Institutions. All Rights Reserved. Surface expression of MPT64 as a fusion with the PE domain of PE_PGRS33 enhances BCG protective activity against Mycobacterium tuberculosis in mice. Michela Sali 1, Gabriele Di Sante 2, Alessandro Cascioferro 4, Antonella Zumbo 1, Chiara Nicolò 2, Valentina Donà 4, Stefano Rocca 5, Annabella Procoli 3, Matteo Morandi 1, Francesco Ria 2, Giorgio Palù 4, Giovanni Fadda 1, Riccardo Manganelli 4* and Giovanni Delogu 1*. 1 Institute of Microbiology, 2 Institute of General Pathology, 3 Institute of Gynecology, Catholic University, L.go A. Gemelli, Rome, Italy. 4 Department of Histology, Microbiology and Medical Biotechnologies, University of Padua, Via A. Gabelli, Padua, Italy; 5 Institute of General Pathology, Pathological Anatomy and Veterinary Obstetrics-Surgery Clinic, University of Sassari, Via Vienna Sassari, Italy. *Corresponding authors: Riccardo Manganelli, riccardo.manganelli@unipd.it ; tel ; fax Giovanni Delogu, gdelogu@rm.unicatt.it; tel ; fax Keywords: Tuberculosis; BCG; Vaccine;

2 Abstract To improve the current vaccine against tuberculosis, Bacille Calmette and Guerin (BCG), a rbcg expressing a Mycobacterium tuberculosis vaccine candidate antigen (MPT64) in strong association with the mycobacterial cell wall was developed. To deliver the candidate antigen on the surface we fused the mpt64 gene to the sequence encoding the PE domain of PE_PGRS33 of M. tuberculosis ( H PE- MPT64-BCG) which we have previously shown to transport proteins to the bacterial surface. In a series of protection experiments in the mouse model of tuberculosis we showed that: a) immunization of mice with H PE- MPT64-BCG provides levels of protection significantly higher than those afforded by the parental BCG strain, as assessed by bacterial colonization in the lung and spleen, and lung involvement (both at 28 and 70 days post-challenge); b) rbcg strains expressing MPT64 provides a better protection than the parental BCG strain only when this antigen is surfaceexpressed; and c) the H PE- MPT64-BCG induced MPT64-specific T cell repertoire when characterized by BV-BJ spectratyping indicates that protection correlates with the ability to recruit IFN-γ secreting T cells carrying the BV8.3-BJ1.5 of 172b shared rearrangement. These results demonstrate that H PE- MPT64-BCG is one of the most effective new vaccine so far tested in the mouse model of TB and underscore the impact of antigen cellular localization on the induction of the specific immune response induced by rbcg. 2

3 Introduction The 2007 WHO report an estimated 13.7 million prevalent cases of tuberculosis (TB) in the world and 1.77 million deaths (55). The HIV pandemic has contributed to the reemergence of TB in the last three decades, with deaths in HIV-positive patients in Nevertheless, of the 9.27 million incident TB cases in 2007, only 15% were HIV-positive (55), indicating that TB remains a major health problem also for immune-competent subjects and primarily in poor and developing countries. In the last few years, the emergence of Mycobacterium tuberculosis strains resistant to first and second-line drugs has raised further concern among health authorities and the scientific community, making even more urgent the need for effective control measures (31,32,49). The development of a new and improved vaccine against TB may provide one of the best tools to control the disease. The only vaccine currently available is Bacille Calmette and Guerin (BCG), introduced in 1921, that protects against the most severe forms of TB in children, but whose efficacy in preventing TB in adults has been challenged by several clinical studies (12). For this reason, the search for a new vaccine has gained a new momentum in the last fifteen years. Many technological platforms have been implemented, such as protein-based vaccines with new and innovative adjuvants (20,50,54); DNA vaccines expressing single and multiple antigens (14,15,50); live recombinant viral vectors like rmva (36) or adenovirus-based vectors (53); attenuated M. tuberculosis strains (19,39) and recombinant BCG (rbcg) expressing M. tuberculosis antigens Molecular engineering of the current BCG vaccine and over-expressing candidate antigens presents several advantages. In fact, despite all the problems (2), BCG is still the gold standard vaccine in animal models and very few vaccines have provided better protection (13). Moreover, the introduction of a recombinant BCG (rbcg) in human studies is seen as less problematic compared to other live vaccines for ethical reasons (5,10). Over-expression of dominant antigens like Ag85 complex (27,28), or re-introduction of selected genes lost during attenuation of BCG, like those encoded by RD1, are two examples of the strategies so far implemented to develop 3

4 rbcg (42). To improve immunogenicity, rbcg has also been manipulated to express the lysteriolisin of Listeria monocytogenes along with deletion of the urec gene to facilitate phagosome maturation and antigen processing following immunization (23,24). A similar approach has been taken via insertion of the perfringolysin gene along with genes that express certain antigens from M. tuberculosis (52) In a recent publication we have shown that the PE domain of the M. tuberculosis protein PE_PGRS33 localizes to the mycobacterial cell wall and that chimeric proteins constructed using the PE such as PE-GFP or PE-MPT64, are exposed on the mycobacterial surface provided that the PE domain is fused at their N-terminus (11). Therefore, the PE domain can be considered as a functional domain containing the information necessary to transport and expose proteins on the surface of mycobacteria and is an ideal candidate to develop a surface delivery system for mycobacteria. The MPT64 antigen used in these studies, is a secreted, highly immunogenic protein of M. tuberculosis, whose gene has been lost in most of the BCG strains during attenuation. It has been demonstrated that DNA vaccines expressing MPT64 can induce a partial level of protection in the mouse model of TB (14). Hence MPT64 is a candidate antigen for the development of a subunit vaccine against tuberculosis. In this study, we show that a live BCG strain expressing a PE-MPT64 chimeric protective antigen on its surface is more immunogenic and induces better protection against challenge with virulent M. tuberculosis than the parental strain or rbcg strains expressing the same antigen localized in different cellular compartments. 4

5 Materials and Methods Animals. Pathogen-free C57Bl/6 female mice were obtained by Harlan (Italy). Mice were immunized at 8-10 weeks of age and were kept under barrier conditions and fed commercial mouse chow and water at libitum. All animal experiments were performed using protocols approved by the Catholic University Ethical Committee. Plasmids used in this study. The plasmids pste2 and pal2 were already used in our previous paper (11). To construct pal32 the DNA fragment encoding the PE_ MPT64 chimera was PCR amplified using Pfu polymerase (Stratagene) from pste2 (11) using the oligonucleotides RP86 (5 - GCTCTAGAATGTCATTTGTGGTCACGATCC-3 ) and RP303 (5 - ACAGATCTTTAGAGGCTAGCATAATCAGGAA-3 ). The upper primer (RP86) was designed to have an XbaI restriction site before the start codon of the PE 1818c coding sequence, while the lower primer (RP339) ws designed to have a BglII restriction site after the ORF stop codon. This fragment was introduced immediately downstream of the Rv1818c promoter present in pmv4-36 (Delogu G. unpublished) after its digestion with NheI and BamHI (Table 1). Microrganisms. M. tuberculosis Erdman (TMC107) and M. bovis BCG Pasteur (TMC1011) were obtained from the Trudeau Culture Collection. The recombinant BCG strains expressing the MPT64 antigen in different cellular compartments used in this study are described in Table 1. Whole cell enzyme-linked immunosorbent assay (ELISA). Cells were grown to an OD 600 of about 0.8, harvested by centrifugation at 4600 rpm for 10 minutes at room temperature, washed twice in TBST buffer (50 mm Tris-HCl ph 8.0, 150 mm NaCl, 1mM MgCl 2 and 0.05% Tween 80) and resuspended in 50 mm NaHCO 3 ph 9.6 to yield a cell concentration of about 1 x 10 9 cells ml µl of the so obtained cell suspension were transferred to each well of a microtitre plate (NUNC- Immuno MaxiSorp Surface, Nalge Nunc International). After a 24 h incubation at 4 C, the 5

6 microplate was centrifuged and the supernatant discarded. Samples were then blocked with 200 µl of 3% powdered skim milk in TBST for 1.5 h at room temperature. The samples were then washed once with 200 µl of TBST. The anti-mpt64 primary antibody (mouse) was diluted in 1% powdered skim milk in TBST, using a 1:6400 dilution, and 100 µl added to each well. After an incubation of 1 h at room temperature, the wells were washed three times with 200 µl of TBST. The secondary antimouse antibody alkaline phosphatase conjugate (Sigma) was diluted 1:5000 in TBST containing 1% powdered skim milk and 100 µl were added to each well. Incubation with the secondary antibodies was then carried out at room temperature for 1 h. After 4 washing steps with 200 µl of TBST, 200 µl of a solution of p-nitrophenyl phosphate (Sigma), diluted in Tris-HCl ph 8.0 to a final concentration of 1 mg/ml, was added to each well and incubated until the development of a pale yellow colour. The reaction was stopped by the addition of 50 µl of 3M NaOH to each well. Absorbance at 405 nm was measured with a microplate reader (Magellan, Tecan). Evaluation of the protective activity of recombinant BCG. Groups of C57Bl/6 mice were injected subcutaneously with CFU rbcg ( H PE- MPT64-BCG, 33 PE- MPT64-BCG, H MPT64- BCG, H PE-BCG, 33 PE-BCG) and, as a control, mice were vaccinated with CFU BCG Pasteur on day 0. Ten-weeks following the immunization vaccinated and control mice were infected aerogenically with about 100 CFU of M. tuberculosis Erdman using a Middlebrook chamber (Glas- Col, Terre Haute, Ind.) as described previously (34). The vaccinated and control mice were sacrificed 28 and 70 days after challenge and bacterial colonization of lung and spleen tissues assessed as described earlier (48). Briefly, to assess the bacterial growth in vivo, five mice per group were sacrificed, and the lungs and spleens were removed aseptically and homogenized separately in 5 ml of 0.04% Tween 80-PBS using a Seward Stomacher 80 blender (Tekmar, Cincinnati, Ohio). The homogenates were diluted serially in the Tween-PBS solution, and 50-µl aliquots were plated on Middlebrook 7H11 agar (Difco, Detroit, Mich.). containing 2-thiophenecarboxylic acid 6

7 hydrazide (2 µg/ml). The number of CFU in the infected organs was determined after 14 to 21 days of incubation at 37 in sealed plastic bags. For the survival studies, 10 animals per group were immunized and ten weeks later aerogenically infected with 100 CFU/animal and maintained until they became moribund and had to be euthanatized. Histopathologic analysis. The lung left lobes were perfused and fixed with 10% paraformaldehyde in PBS and then embedded in paraffin for sectioning. The tissue sections were stained with hematoxylin and eosin (H&E) reagent or with Ziehl-Neelsen acid-fast stain and were evaluated by light microscopy. For each lung left lobe at least three section were obtained and for each section the total surface area and the area with lesions was measured and the average calculated for each section and for each group (five lung left lobes per group). Measurements were carried out using the microscope Nikon Eclipse 80i, the camera control unit Nikon DS-L2 and the dedicated software T cell receptor repertoire analysis. Repertoire analysis was performed using a modification of a described protocol (45) spleen derived cells/well were cultured in the presence or absence of 20 µg/ml of recombinant MPT64 for three days in RPMI-1640 medium (Sigma- Aldrich, St Louis, MO, USA) supplemented with 2 mm L-glutamine, 50 µm 2-ME, 50 µg/ml gentamicin (Sigma- Aldrich, St Louis, MO, USA), and 10% Foetal Calf Serum (Gibco BRL Life Technologies, Basel, Switzerland) (complete medium). Total RNA was isolated from cell suspensions using RNeasy Mini Kit (Qiagen GmbH, Hilden, Germany) according to the manufacturer s instruction. cdna was synthesized using an oligo-dt primer (dt15) (Gibco BRL Life Technologies, Basel, Switzerland). For complete Immunoscope analysis (37) cdna was subjected to PCR amplification using a 7

8 common Constant (C) β primer (CACTGATGTTCTGTGTGACA) in combination with the variable β(bv) primers previously described (47), following the nomenclature of Arden and coll. (3). Using 2 µl of this product as a template, run-off reactions were performed with a single internal fluorescent primer for each BJ tested (described previously (47)). These products were then denatured in formamide and analyzed on an Applied Biosystem 3130 Prism using Gene-mapper v4.0 software (Applied Biosystem, Foster City, CA, USA). Results are also reported as R.S.I (relative stimulation index = normalized peak area obtained from cells stimulated with Ag / normalized peak area of non stimulated cells). According to our experience in other model antigens (37,47) T cells carrying a TCR rearrangement can be considered expanded in a peptide-driven manner when RSI is 2. Staining and enrichment of IFN-γ secreting T cell. MPT64-specific T cells secreting IFN-γ were stained and enriched from spleen of C57Bl/6 mice (infected as described above) using MACS secretion kit (Milteny Biotec, Bergisch Gladbach, Germany), according to the manufacturer s instruction, following the protocols for enrichment of low frequency secreting cells. Briefly, 1 to 3x10 7 cells obtained from spleens were stimulated in the absence (background) or in the presence of 20 µg/ml recombinant MPT64, in 6 well plate at a concentration of 5x10 6 cells/ml. Sixteen hours later, cells were harvested and submitted to the staining procedure for the cytokine. Samples were also stained with FITC-labelled anti-cd4 (SouthernBiotech, Birmingham, AL, USA) or CD8 (Invitrogen, Camarillo, CA, USA) antibodies. In order to evaluate correctly the number of MPT64- specific cells, we examined by FACS 5x10 5 cells in each background and positive sample. The number of antigen-specific, cytokine secreting cells is obtained by subtracting the cells staining positively in the background sample from the number of the same cells in the Ag-stimulated sample. Total, negatively selected and positively selected cells were collected and prepared for mrna isolation. In order to prevent uncontrolled loss of mrna due to scarcity of cells, 10 6 α - β - BW cells 8

9 were added to the positively selected cells before proceeding with mrna isolation for the TCR repertoire analysis. Intracellular cytokine staining. The following monoclonal antibodies were used for intracellular staining: FITC-labeled anti-cd4 (SouthernBiotech, Birmingham, AL, USA); FITC-labeled anti- CD8a (Invitrogen, Camarillo, CA, USA); PE-labeled anti-ifn-γ (clone XMG1.2, BD Pharmingen, San Diego, CA, USA); PERCP-CY5.5-labeled anti-il-2 (clone JES6-5H4, BD Pharmingen); APC- CY7- labeled anti-tnf-a (clone MP6-XT22, BD Pharmingen). The intracellular staining procedure was performed using the Cytofix/Cytoperm kit with GolgiPlug Kit (BD Pharmingen) according to manufacturer s instructions. Briefly, 1x10 7 cells obtained from spleen of mice infected with BCG recombinant strains as described above, were stimulated in the absence (background) or in the presence of 20 µg/ml recombinant MPT64, in 24 well plate at a concentration of 10 7 cells/ml. BrefeldinA was added for the last 8 hrs of culture. Samples (5x10 5 cells in each background and positive sample) were analyzed on a BD FACScan flow cytometer. The number of antigen-specific T cells secreting a given cytokine for each mouse was obtained by subtracting the normalized number of T cells secreting the cytokine in the control sample (i.e. cultured in the absence of antigen) from the normalized number of T cells secreting the same cytokine in the sample cultured in the presence of MPT64. Statistical analysis. Prism 4.0 software (GraphPad Prism version 5.00 for Windows, GraphPad Software, San Diego, California, USA) was used for statistical analyses of protective activity data. The data were analyzed using one-way ANOVA and the Tukey s Multiple Comparison Test was used for selected pairwise comparisons. Log-rank (Mantel Cox) tests were performed to compare the survival curve. Unpaired T test was used for analysis of the data reported in Figure 4 and Figure 7B, and Square Chi test was used for the analysis of the data reported in Table 2. P values of less than 0,05 were considered significant. 9

10 Results In a previous work, we showed that when MPT64 deprived of its signal sequence ( MPT64) is expressed in mycobacteria it localizes into the cytoplasm, but when fused at the C-terminus with the PE domain derived from PE_PGRS33 (PE_ MPT64), it is surface exposed as determined by trypsin sensitivity assays, cell fractionation studies and immunogold electron microscopy (11). To confirm this finding, the cellular localization of these two recombinant proteins in BCG was further investigated by enzyme-linked immunosorbent assay (ELISA) on whole cells using an anti-mpt64 mouse antiserum. As shown in Figure 1, the PE_ MPT64 expressing strain ( H PE- MPT64-BCG) gave a 3-fold higher signal than that given from the MPT64 expressing strain ( H MPT64-BCG) when the expression of these proteins was similar (data not shown). Detection of the MPT64-HA expressing strain was comparable to that obtained using the wild type parental strain. Taken together, these data clearly support our previous finding that the PE domain targets the MPT64 protein to the surface of M. bovis BCG. HPE- MPT64-BCG elicits enhanced anti-tuberculous activity. To assess the impact of antigen cellular localization and load on the immunogenicity of the rbcgs, the different recombinant BCG strains expressing the model antigen MPT64 in the cytoplasm or at the surface (Table 1) were used to immunize C57Bl/6 mice, following standard protocols. Ten weeks after a single immunization, mice were aerogenically infected with a low-dose ( 200 CFUs) of M. tuberculosis Erdman. Four weeks later, mice were sacrificed and lung and spleen tissue removed to determine bacterial loads. As shown in Figure 2, BCG-immunized mice had a significantly lower mycobacterial load in the lung ( Log CFU/lung) compared to naïve mice. Interestingly, mice immunized with H PE- MPT64-BCG had significantly less bacteria in the lung compared to BCG immunized mice ( Log CFU/lung compared to naïve mice and 0.73 Log CFU/lung compared to the BCG group). A 10

11 reduction was also observed in the spleen tissue (Figure 2B) although this reduction was not statistically significant. Over-expression of the chimeric antigen is necessary for this enhanced activity, since mice immunized with 33PE- MPT64-BCG, expressing PE_ MPT64 under the control of the PE_PGRS33 promoter (5-10 weaker than the hsp60 promoter as previously described (11,17)) showed bacterial loads in the lung and spleen tissues similar to the parental strain. Moreover, mice immunized with rbcg expressing the PE domain of PE_PGRS33 ( H PE-BCG (16) and 33 PE-BCG) had bacterial counts similar to BCG strain, indicating that the over-expression of the PE domain alone does not contribute to the superior activity of H PE- MPT64-BCG. Mice immunized with BCG over-expressing the MPT64 antigen in the cytoplasm did show lower bacterial counts in the host tissues compared to naïve mice (p<0,05) but this reduction was not statistically significant compared to the BCG parental strain (p>0,05). The activity of each of these rbcg strains was tested in at least another experiments and similar results were obtained. The attempts to express the MPT64 antigen in the plasmatic membrane or in the secreted form under the control of the hsp promoter were not successful. In fact, these recombinant strains did not grow properly in liquid and solid media, probably because over-expression of the antigen in these cellular compartments was toxic. Conversely, expression of these two chimeras was obtained under the control of the PE_PGRS33 promoter and mice immunized with these two BCG recombinant strains had bacterial counts similar to the BCG parental strain (data not shown). Taken together these results suggest that: a) H PE- MPT64-BCG induces an enhanced level of protective activity against M. tuberculosis infection compared to BCG; b) that this enhanced activity is dependent upon the MPT64 antigen; and c) that over-expression of the antigen and localization in the mycobacterial cell wall are both required to provide the enhanced activity. 11

12 Since only a few recombinant BCG vaccines have been able so far to induce enhanced antituberculous activity compared to the parental BCG strain (6), the H PE- MPT64-BCG was evaluated in other three independent protection experiment. Mice vaccinated with H PE- MPT64- BCG had consistent and statistically significant (at least p<0,05) lower bacterial counts compared to the BCG group at day 28 post-infection, and reduction in the lung tissue ranged from 0.38 to 0.75, while the reduction over naïve mice reached 2.16 Log CFU/lung. A similar pattern was also observed in the spleen, with mice immunized with H PE- MPT64-BCG showing consistently lower bacterial counts compared to BCG counterparts, although in this case differences were not always statistically significant. The results of four independent experiments clearly indicate that the H PE- MPT64-BCG induces level of anti-mycobacterial activity superior to those induced by BCG. Enhanced protection of H PE- MPT64-BCG is maintained during the chronic steps of infection. In the mouse model for TB used in these studies, reduction in terms of bacterial loads afforded by BCG vaccination is maximal at day 28 post-infection, while at later time points (for instance day 70) the difference in terms of Log CFU/organ between naïve and BCG-immunized mice can be less evident (15). To assess the activity of H PE- MPT64-BCG in the chronic steps of infection, immunized and control mice aerogenically infected with M. tuberculosis Erdman ( 200 CFU/animal) were sacrificed 70 days post-infection and bacterial loads assessed as previously indicated. As shown in Figure 3, mice immunized with H PE- MPT64-BCG showed 2.16 Log CFU reduction in the lung over naïve mice, and 1.08 reduction compared with BCG immunized mice. Lower bacterial counts were also observed in the spleen, with H PE- MPT64-BCG mice showing 0.54 Log CFU less than BCG immunized mice. These results indicate that the superior activity of HPE- MPT64-BCG over BCG is maintained even at 70 days post-infection. 12

13 Immunization with H PE- MPT64-BCG reduces lung involvement compared with BCG vaccination in M. tuberculosis infected mice. An effective vaccine against M. tuberculosis infection should induce a specific immune response that would not only control bacterial colonization but would also result in limited lung involvemente. The lung left lobe was isolated from immunized and control mice challenged with virulent M. tuberculosis at days 28 and 70 postinfection, perfused with formalin and subjected to histopathology. For each lung (five lung per group of immunized mice), at least three sections were subjected to a quantitative microscopic analysis to objectively assess the extent of the tissue damage. As shown in figure 4, the median granuloma surface area, the average surface of tissue with lesions, the number of granulomas per lung left lobe and the ratio between the area with lesions over the total lung surface were determined. All parameters indicated that the size of granulomas at day 28 post-infection was significantly reduced in mice immunized with BCG and HPE- MPT64-BCG compared with naïve mice. Indeed, while lung isolated at day 28 from non-immunized mice showed diffused granulomatous lesions containing many acid fast bacilli, histopathology in BCG and H PE- MPT64- BCG immunized groups was similar, with small lesions containing very few mycobacteria (data not shown). Interestingly, at day 70 post-infection, the extent of the lesions appeared smaller in H PE- MPT64- BCG-immunized mice compared not only to naïve mice but also to the BCG immunized group. As shown in figure 4, mice immunized with H PE- MPT64-BCG showed a reduction of the granuloma size compared with naïve mice but also compared to the BCG immunized group (figure 4A). The extent of lung involvement was significantly lower in H PE- MPT64-BCG compared to BCG as demonstrated by measuring the total surface area with lesions (figure 4 B, p<0,001) and the percent of tissue with lesions over the total area (figure 4D, p<0,001) and this despite the fact that a similar number of granulomas per lung left lobe was found in the two BCG-immunized group (figure 4C). 13

14 Representative slides showing the extent of lung involvement and the type of cellular infiltrate are shown in figure 4E and confirm that the majority of lung was healthy in mice receiving H PE- MPT64-BCG and indicate that the presence of acid-fast bacilli in these lesions was more frequent in the BCG group compared to the H PE- MPT64-BCG. Overall, the results obtained indicate that the activity of H PE- MPT64-BCG is superior to that of the BCG parental strain at day 70 postinfection, in terms of bacterial loads and extension of lung involvement. To further assess the anti-tuberculous activity of the rbcg under study, groups of 10 mice were immunized with H PE- MPT64-BCG and BCG, or left non immunized and then infected with a low-dose of M. tuberculosis Erdman. A statistically significant protection as measured by the extension of the median survival time was observed between the two BCG-vaccinated groups and naïve mice, but no statistically significant difference among the two BCG-vaccinated groups were measured (Figure 5). Cytokine production and persistence of MPT64-specific CD4+ and CD8+ T cells following infection with MPT64-expressing live BCG strains. To identify potential immunological correlates of protection, we examined the presence of CD4+ and CD8+ T cells secreting IFN-γ following vaccination in response to stimulation with MPT64. Groups of 6 to 10 mice were injected s.c. with live BCG strains. Mice were sacrificed at day 15 post-infection, cells were isolated from the spleen and cultured in vitro in the absence or presence of 10 µg/ml of recombinant MPT64. Sixteen hours later cells were stained with the MACS IFN-γ secretion assay and FITC labelled anti-cd4 or anti-cd8 monoclonal antibodies and cells secreting IFN-γ in antigen dependent manner were counted by FACS. Results are reported in Figure 6 (left column). The average +2SD value obtained in mice vaccinated with the control strain 33 PE-BCG (expressing the PE domain alone) was used to establish the threshold level for a specific response to MPT64. At day 15 post- 14

15 vaccination, all mice infected with H PE- MPT64-BCG showed a robust (although variable among individual absolute values) response to MPT64 in both CD4+ (average 8,55x10 3 cells /10 6 CD4 + cells) and CD8+ cells (average 4,26 x10 3 cells /10 6 CD8 + cells). At this time point, MPT64-specific CD4+ cells were more numerous than CD8+ cells. At the same time, 2 out of 3 mice infected with 33PE- MPT64-BCG, that expresses the antigen chimera PE_MPT64 under the control of a weaker promoter, showed levels of response comparable to that obtained with H PE- MPT64-BCG at day 15 (average 6,7 x10 3 cells /10 6 CD4 + cells, and 12,38 x10 3 cells /10 6 CD8 + cells respectively). Consistently positive although slightly lower values were obtained in mice infected with strain H MPT64-BCG, in which MPT64 localized in the cytoplasm (average 1,98 x10 3 cells /10 6 CD4 + cells and 3,31x10 3 cells /10 6 CD8 + cells. In order to test the role of T cells secreting IL-2 or TNF-α or the combination of two or more cytokines among IFN-γ, IL-2 and TNF-α in our model, intracellular staining for these cytokines was performed in spleenocytes isolated from immunized mice. Four groups of 5 to 6 mice were immunized as previously described and two weeks later spleen cells were obtained and cultured in the presence or absence of MPT64. The staining for intracellular IFN-γ, IL-2 and TNF-α was performed as described in Materials and Methods. Results for each single cytokines are reported in Figure 7A. Here, each dot represent the value obtained from the sample cultured in the presence of MPT64 subtracted of that obtained from the same sample in the absence of antigen (control). The number of CD4 + cells secreting IFN-γ or IL-2 observed with this technical approach overlapped that obtained using the MACS IFN-γ secretion assay for mice vaccinated with H PE- MPT64-BCG and H MPT64-BCG. However, the values obtained for 33 PE- MPT64-BCG and for CD8 + cells (not shown) were sensibly lower than those obtained with the MACS secretion assay and especially for CD8+ cells they were not distinguishable from those obtained in mice infected with the control strain 33 PE-BCG. Values obtained using intracellular staining were obtained by cumulating the 15

16 secretion of cytokines during the first 16 hours of stimulation; vice versa, the MACS secretion assay focuses on cytokines secreted after 16 hours of stimulation with the antigen, for a relatively short period. The discrepancy between values obtained with the two tests may therefore reflect differences in the kinetic of IFN-γ secretion between CD4 and CD8 cells and among the various protocols of vaccination. Finally, the number of TNF-α-secreting CD4 + cells in mice vaccinated with H MPT64-BCG and H PE- MPT64-BCG was approximately one tenth of those secreting IFNγ and IL-2 in the same groups. Next, the ability of MPT64-specific CD4 + T cells to secrete multiple cytokines was evaluated (1) and an example of the assay performed is shown in the upper panel of Figure 7B. We calculated the composition of the population of CD4+ cytokine secreting T cells in each sample obtained after stimulation with MPT64, independently from the fact that the number was actually higher than that obtained in absence of antigen-stimulation. Thus, values obtained from 33 PE-BCG immunized mice provide a view of the background composition of the T cell population. The distribution of the various population of MPT64-specific T cells upon vaccination with the various rbcg strains is shown in the lower panels of Figure 6B, as pie chart. CD4+ cells secreting TNF-α and IFN-γ were detected in some samples of the three groups of mice immunized with rbcg strains expressing MPT64, but not in the control mice ( 33 PE-BCG). However, the large variability among individual mice was such that in no case this difference was statistically significant. Intriguingly, CD4+ T cells secreting IFN-γ and IL-2 were found in larger proportion in mice H PE- MPT64-BCG immunized mice than in those immunized with 33 PE-BCG (p=0.011). A similar over-representation of this population was found in the H MPT64-BCG group, where it however fell short from being statistically significant (p=0.08) due to individual variability. As a final observation, the average total number of CD4+ T cells secreting cytokines in response to MPT64 was similar in the H PE- MPT64-BCG group (2.9x10 4 /10 6 CD4 + cells) and in the H MPT64-BCG (2.7x10 4 /10 6 CD4 + cells), while it was close to zero in the control 33 PE-BCG group (-0.1x10 4 /10 6 CD4 + cells). 16

17 Since mice were challenged with M. tuberculosis at week 11 after vaccination, we examined the presence of CD4+ and CD8+ T cells secreting IFN-γ in response to stimulation with MPT64 also at day 77 post vaccination. Results are shown in Figure 6 (right column), and indicate that the CD4+ mediated response had strongly declined in all of the groups. Mice vaccinated with 33 PE- MPT64- BCG and H MPT64-BCG as well as 2 out of 3 mice vaccinated with H PE- MPT64-BCG did not show a number of MPT64-specific CD4+ cells different from that of mice immunized with the control strain 33 PE-BCG. On the contrary, the CD8-mediated response appeared to be better conserved within the H PE- MPT64-BCG group (average 9,67x10 3 cells /10 6 CD8 + cells), showing values still comparable to those obtained at day 15 and higher than H MPT64-BCG (average 1,740,5 x10 3 cells /10 6 CD8 + cells) and 33 PE- MPT64-BCG (average 0,55 x10 3 cells /10 6 CD8 + cells). Analysis of T cell repertoires involved in response to MPT64 shows that H PE- MPT64-BCG selectively activates T cells carrying a shared BV8.3-BJ1.5 rearrangement. The T cell repertoire involved in the response to MPT64 was analyzed by means of the BV-BJ spectratyping (the so-called immunoscope ). Following the procedure described in (47), we pooled the cdnas obtained from MPT64-stimulated spleen cells of three mice 15 days after vaccination with H PE- MPT64-BCG. Pooled cdnas were then submitted to a complete immunoscope analysis in which the 288 Vβ-Jβ primer combinations were used to perform the first CDR3 length fragment analysis. In this analysis each CDR3-β profile can be depicted as a function of the CDR3 length. Each peak represents a 3 b difference in the product of recombination corresponding to one amino acid residue. In non-vaccinated mice, most peak patterns display a Gaussian distribution. 56 combinations however displayed the presence of one peak that altered such a Gaussian distribution (Figure 7A, black areas). We then examined these BV-BJ recombinations on cdnas obtained from 17

18 7 individual mice, comparing the MPT64-stimulated sample with the un-stimulated sample from each individual mouse. We thus found that 4 rearrangements, each characterized by recombination of a BV, a BJ and a base length, that expanded in response to MPT64, were used frequently in mice vaccinated with H PE- MPT64-BCG. The four rearrangements were BV3.1-BJ2.2 of 127b, BV5.2- BJ21.6 of 178b, BV8.3-BJ1.5 of 172b and BV20-BJ2.1 of 118b. Data are reported in Table 2, and examples are shown in Figure 7B. We next examined the association of each of the shared rearrangements with T cells secreting IFN-γ in response to stimulation of spleen cells with recombinant MPT64. In four distinct experiments, spleen cells obtained from mice vaccinated with H PE- MPT64-BCG were stimulated with recombinant MPT64 and IFN- γ secreting cells were enriched as described previously (37). In two experiments, cells from three mice were pooled and examined; in the other two experiments cells from a total of 6 mice were examined individually. Results are reported in Table 3. Rearrangements BV5.2-BJ21.6 of 178b and BV8.3-BJ1.5 of 172b were consistently associated with IFN-γ secreting cells, indicating that cells carrying these rearrangements secreted IFN- γ when re-stimulated with MPT64. Finally, we examined the ability of strains 33 PE- MPT64-BCG and H MPT64-BCG to activate T cells carrying these shared TCRs. Results are shown in Table 2. T cells carrying rearrangement BV3.1-BJ2.2 of 127b are recruited in mice vaccinated with all tested strains. Vaccination with H MPT64-BCG and 33 PE- MPT64-BCG failed to recruit BV8.3-BJ1.5 of 172b. Also T cells carrying the BV5.2-BJ1.6 of 178b TCR were not recruited following vaccination with H MPT64-BCG. Recruitment of T cells carrying TCR-b chains BV20-BJ1.6 (118b) and BV3.1- BJ2.2 (127b) was reduced after vaccination with H MPT64-BCG and 33 PE- MPT64-BCG, respectively, although reduction did not reach statistical significance. Taken together, these data suggest that protection associates with ability to recruit the IFN-γ secreting T cells carrying the BV8.3-BJ1.5 of 172b shared rearrangement. 18

19 Discussion The superior activity of H PE- MPT64-BCG over the parental strain is remarkable when compared to that of other rbcg vaccines tested in similar experimental settings. Two rbcgs expressing the ESAT6 antigen, in the secreted form or in the cytosol, were shown to be as safe as the parental strain, but did not provide enhanced immunogenicity nor anti-tuberculous activity (4), and this despite the fact that ESAT6 is one of the most promising subunit vaccine candidate antigens (34,35). Overexpression in BCG of the immunodominant secreted antigen Ag85B (28) has shown enhanced protection over BCG in the guinea pig model and recently this vaccine was shown to be more immunogenic and safe in human clinical trials (26). Moreover, a rbcg overexpressing Ag85C was shown to induce enhanced and enduring protection against TB in a guinea pig model of TB (30). However, when a rbcg overexpressing Ag85B was tested in the mouse model, no differences in terms of anti-tuberculous activity were observed (43), suggesting that in mice, which are more resistant to TB than guinea pigs, the enhanced activity of rbcg Ag85B/C could not be observed. In this report, a new recombinant BCG strain expressing the candidate antigen MPT64 on the bacterial surface was developed using a recently described PE-based mycobacterial surface-delivery system (11). We confirmed that the PE_ MPT64 chimera expressed in a live M. bovis BCG strain ( H PE- MPT64-BCG) is exposed on the mycobacterial surface. Immunization of mice with this live recombinant BCG strain induced a level of protection against M. tuberculosis that was significantly superior to the that induced by the parental BCG as assessed by enumeration of CFUs and histopathological analysis. Moreover, the enhanced protection conferred by H PE- MPT64-BCG correlates with the induction of IFN-γ expressing CD4 and CD8 cells and the emergence of an MPT64 specific T cell clone. 19

20 Superior vaccine efficacy was observed in mice with the rbcg expressing the membraneperforating listeriolysin ( urec hly + rbcg strain) and the enhanced activity correlated with improved cross-priming, which caused enhanced T cell-mediated immunity (23). Another rbcg strain (AFRO-1) expressing perfringolysin O and overexpressing key immunodominant M. tuberculosis antigens provided slightly enhanced activity in terms of survival in mice infected with the clinical M. tuberculosis strain HN878, but did not demonstrate a reduction in mycobacterial loads in the lungs and spleens compared to the parent BCG strain (52). To our knowledge, the protective activity induced by H PE- MPT64-BCG in the mouse model of TB ranks this new vaccine among the most effective so far tested in the mouse TB challenge model. It would be of great interest to perform the protection assays in the guinea pig and non-human primate models of M. tuberculosis infection. Lipoarabinomann, arabinogalactan and other sugars; mycolic acids, glycolipids and phenolic lipids, together with peptidoglycan are the main components of the mycobacterial cell wall. It is well established that the mycobacterial cell wall is a very immunogenic component with strong immunostimulatory properties as classically highlighted by the use of the Freund s adjuvant, that is made of oleic acid and heat killed M. tuberculosis. The adjuvant properties are linked to the proinflammatory activity of these molecules that induce TNF, IL-6, IL-1, IL-12, and trigger upregulation of MHC-II and CD1d1 on macrophages (21). To enhance the immune response specifically induced against the recombinant antigen expressed by BCG, we aimed at expressing a protein antigen, MPT64, in the context of the mycobacterial cell wall. Localization of the MPT64 protein on the BCG surface, in tight association with the mycobacterial cell wall, was achieved using a PE-based delivery system that we recently developed (11), and resulted in enhanced immunogenicity and protective activity of the recombinant BCG. When the MPT64 was overexpressed in the cytoplasm, or associated to the inner membrane, or secreted out of 20

21 the cell, we could not obtain a similar anti-tuberculous activity. Nevertheless, in line with previous studies (25), overexpression of the PE_ MPT64 chimera was necessary, since mice immunized with 33 PE- MPT64-BCG did not show enhanced protection over the BCG group. Moreover, since overexpression of the PE domain only did not provide enhanced activity to BCG, we conclude that association of MPT64 with the mycobacterial cell wall enhances the antigen specific immunogenicity and contributes to the superior activity of H PE- MPT64-BCG over the other rbcg expressing MPT64. Indeed, antigen-specific immune response determined in mice immunized with the different rbcgs was shown to be dependent upon MPT64 cellular localization. In particular, we show that H PE- MPT64-BCG is able to sustain an MPT64-specific CD8-mediated response over time, much more effectively than 33 PE- MPT64-BCG and H MPT64-BCG, despite all three strain induce similar numbers of CD8+ specific cells early after vaccination. On the contrary, the number of IFN-γ secreting MPT64-specific CD4+ cells declines to similar levels in mice compared with all tested BCG strains. Thus, the number of CD4+ or CD8+ MPT64-specific cells induced early after vaccination does not appear to correlate with protection. We also find that the number of CD4+ T cells secreting IFN-γ and IL2 in response to stimulation with MPT64 is more constantly increased following immunization with H PE- MPT64-BCG than with the other BCG strains. It may be suggested that IL-2 secretion by these cells plays a role in favouring survival of CD8 + cells while IFN-γ helps to maintain the secretion of type1 cytokines. It has been reported that protection from infection with SIV in monkeys correlates with the ability to recruit one specific T cell repertoire, more than to a global immune response (41). Similarly, we have shown that T cell repertoires are different in pathogenic and non-pathogenic autoimmune 21

22 responses in human disease and experimental models (40,46). We therefore asked if cell localization ( H PE- MPT64-BCG versus H MPT64-BCG) and amount of antigen produced ( H PE- MPT64-BCG versus 33 PE- MPT64-BCG) impact on T cell repertoire selection, and if differences in the composition of the MPT64-specific repertoire were correlated with protection. The results reported in Table 2 clearly draw the attention to the failure of both 33 PE- MPT64-BCG and H MPT64-BCG to recruit T cells carrying the BV8.3-BJ1.5 of 172b length compared to HPE- MPT64-BCG. The relevance of this observation is further increased by data reported in Table 3, showing that these cells are consistently associated with antigen driven IFN-γ secretion. The avidity of a TCR for its ligand is one of the factors that determine the secretory phenotype acquired by a T cell upon activation. In particular, cells with TCR showing high avidity for an MHC/peptide complex are biased to differentiate into Th1 cells (8,9,29). The fact that T cells carrying the BV8.3-BJ1.5 of 172b length rearrangement secrete IFN-γ even upon Th2-promoting conditions (unpublished results) suggests that they may recognize with high affinity an epitope derived from MPT64. However, the same cells are not recruited by the PE_ MPT64, when it is expressed under the control of a weaker promoter in the 33 PE- MPT64-BCG strain. A possible explanation for this result is that the specific T cell epitope induced by these live BCG strains behave as a subdominant epitope. If this is the case, dendritic cells will present it efficiently when infected by the high-expressing H PE- MPT64-BCG strain, but fail to present it at a level sufficient for T cell priming when infected by the low-expressing 33 PE- MPT64-BCG strain. More in depth studies are required to identify and characterize the immunological correlates of protection, specifically during infection. It would be of interest for instance to monitor the emergence of the MPT64-specific T cell clones identified in this study in the spleen and lung tissue at different time points following M. tuberculosis infection in naïve versus BCG and H PE- MPT64-BCG immunized mice and determine how these correlates with the degree of disease. 22

23 Several studies have shown that cellular localization of the heterologous protein expressed by a rbcg affects the antigen-specific immune response elicited (for a review see ref. (18)). Previous attempts to deliver an antigen to the mycobacterial cell wall relied mostly on the use of the 19kDalipoprotein signal sequence (22,51). The 19kDa lipoprotein has immunomodulatory properties, has been implicated in the downregulation of immune effector mechanisms of the host (38) and it has been demonstrated that overexpression of 19 kda antigen in BCG abrogates the protective activity of BCG due to a polarization of the host immune response towards Th2 (44). Indeed, immunization of mice with rbcg expressing the outer surface protein A (OspA) of Borrelia burgdorferi as a membrane-associated lipoprotein resulted in protective antibody response that was fold higher than the response elicited by immunization with rbcg expressing the same antigen in the cytoplasm or as a secreted fusion protein (51). Similar results were also observed when proteins of the porcine reproductive and respiratory syndrome virus (7) or pneumococcal surface protein A (33) were expressed as 19 Kda-fusion proteins on the mycobacterial surface. In this study, immunization with H PE- MPT64-BCG did not induce specific humoral response against MPT64 but rather elicited a higher and more persistent CD8 T cell response compared to that induced by the other rbcg expressing MPT64 in other cellular compartments. These results underline the usefulness of the PE-delivery system for the expression of heterologous antigens in BCG for which a strong cell mediated immune response is pursued. Acknowledgment This work has been supported by an E.U. 6 th Framework grant ( Innovac project; LSH ) to G.D. and R.M and by the italian MIUR (2007BEP8WH) to G.F. We would like to thank Dr. Maria 23

24 Emiliana Caristo and the staff at the animal facility at the Catholic University of the Sacred Hearth for the professional support provided. We also thank Michael J. Brennan for the helpful insights provided during the experiments and for careful reviewing the manuscript. Figure legends Figure 1. Whole cells ELISA on M. bovis BCG wild type or recombinant BCG expressing PE_ MPT64 or MPT64HA. The assay was developed using an anti-mpt64 mouse antiserum as primary antibody Figure 2: Protective activity induced by a series of rbcg strains expressing the MPT64 antigen in different cellular compartments or expressing the PE domain only. Immunized and control mice were infected 10 weeks post-immunization with M. tuberculosis Erdman. 28 days later mice were sacrificed and lung and spleen bacterial load were determined by CFU counting. A) Lung; B) Spleen. (* p < 0,05 Naïve vs. vaccinated groups; ** p< 0,05 BCG vs. H PE- MPT64-BCG). Figure 3: Protective activity induced by the H PE- MPT64-BCG strain at day 70 post-infection. Immunized and control mice were infected 10 weeks post-immunization with M. tuberculosis Erdman. 70 days later mice were sacrificed and lung and spleen bacterial load were determined by CFU counting. A) Bacterial loads at day 70 in the lung and spleen tissue (* p < 0,05 Naïve vs. vaccinated groups; ** p< 0,05 BCG vs. H PE- MPT64-BCG). 24

25 Figure 4: Histopathological analysis carried out on lung tissue of mice immunized with the various BCG strains and infected with M. tuberculosis. The lung left lobes were removed, fixed and stained with H&E. Extension of the tissue damage was assessed by determining: A) Median granuloma surface area; B) Median total tissue surface area with lesions; C) Median number of granulomas per lung left lobe; D) ratio between the tissue surface area with lesions and the total area (expressed in %). At least three section per lung, and five lungs per group were analyzed as indicated in materials and methods. Statistical nalysis was performed using the ttest (* p<0,05 versus naïve group; **p<0,01 versus BCG group; E) Histopathological analysis performed on lung tissues isolated from mice obtained 70 days following aerogenic challenge with M. tuberculosis Erdman. Representative slides are shown for mice immunized with BCG, H PE- MPT64-BCG and Naïve. Magnification is 40X, 200X and 400X from top to bottom. Figure 5. Survival of vaccinated and control mice following a low-dose aerogenic challenge with the virulent Mtb Erdman strain. Ten mice per group were used in this experiment. Log-rank (Mantel Cox) tests were performed to compare survival curves. Naïve ( ) vs. BCG ( ) and H PE- MPT64-BCG ( ) mice were statistically different (p<0.05). Figure 6: Induction and persistence of MTP64-specific type 1 CD4+ and CD8+ cells. C57Bl/6 mice were vaccinated with H PE- MPT64-BCG, 33 PE- MPT64-BCG and H MPT64-BCG or with the control 33 PE-BCG strains. Spleen cells were obtained 2 or 11 weeks after vaccination, and the number of T cells secreting IFN-γ in response to stimulation with MPT64 was assessed as described in Materials and Methods. Each dot represents an individual mouse. The dashed line represents the average +2 SD of the value obtained in mice vaccinated with the control strain 33 PE-BCG. 25

26 Fig. 7: Analysis of multifunctional CD4+ T cells specific for MPT64. Four groups of mice were infected with 33 PE-BCG (5 mice), H PE- MPT64-BCG (6 mice), 33 PE- MPT64-BCG (5 mice) and H MPT64-BCG (6 mice). Fifteen days later, spleen cells were obtained and cultured for 16h in the absence or presence of MPT64. BrefeldinA was added for the last 8 hr of culture. Cells were then stained for CD4 and for intracellular IFN-γ, IL-2 and TNF-α. A) MPT64-driven secretion of each tested cytokine. Each dot represents the value of MPT64-specific CD4+ cell (number of cells secreting the cytokine in the presence of MPT64 minus the number obtained in the sample cultured in the absence of added antigen) for a single mouse. In the cases in which the value was negative, it is reported as a 0. B) Evaluation of multifunctional T cells in MPT64-stimulated samples. Upper panels: exemplificative analysis of one sample; numbers (1-6) refer each population to the color code of the pie charts, reported in the lower panels. Pie charts: distribution of cytokine secretion of the CD4+ T cells in MPT64-stimulated samples. Areas report the average proportion of each functional population in each group of mice described above. Figure 8: Immunoscope analysis of the response to MPT64. A) C57Bl/6 mice were vaccinated with HPE- MPT64-BCG. Two weeks later spleen cells were obtained and cultured in the presence or absence of MPT64. mrna and cdna were prepared and pooled. A complete immunoscope was performed as described in Materials and Methods. Black squares indicate those spectra showing an alteration of the Gaussian distribution of CDR3 length for the BV-BJ rearrangement. B) Examples of the spectra obtained for the indicated shared rearrangements obtained culturing spleen cells in the absence or presence of MPT64. Peaks corresponding to the expanded shared rearrangements are shaded. 26